Starting /dee2/code/volunteer_pipeline.sh SRR10225137 current disk space = 3052376870912 free memory = 1479686608 SRR10225137 SRAfilesize 98f845428e8c3282d57c4f4068228cf4 SRR10225137.sra SRR10225137.sra file validated SRR10225137 is paired end SRR10225137 is conventional basespace SRR10225137 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10225137_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80125 34.0 31.0 34.0 31.0 34.0 2 33.039 34.0 33.0 34.0 31.0 34.0 3 33.0955 34.0 33.0 34.0 31.0 34.0 4 36.45925 37.0 37.0 37.0 35.0 37.0 5 36.4245 37.0 37.0 37.0 35.0 37.0 6 36.2805 37.0 37.0 37.0 35.0 37.0 7 36.36475 37.0 37.0 37.0 35.0 37.0 8 36.416 37.0 37.0 37.0 35.0 37.0 9 38.308 39.0 39.0 39.0 37.0 39.0 10-11 38.207625 39.0 39.0 39.0 37.0 39.0 12-13 38.244625 39.0 39.0 39.0 37.0 39.0 14-15 39.798 41.0 40.0 41.0 38.0 41.0 16-17 39.689499999999995 41.0 40.0 41.0 37.0 41.0 18-19 39.66674999999999 41.0 40.0 41.0 37.0 41.0 20-21 39.567625 41.0 40.0 41.0 37.0 41.0 22-23 39.521875 41.0 40.0 41.0 37.0 41.0 24-25 39.564750000000004 41.0 40.0 41.0 37.0 41.0 26-27 39.432249999999996 41.0 39.5 41.0 36.5 41.0 28-29 39.34125 41.0 39.0 41.0 36.0 41.0 30-31 39.198499999999996 41.0 39.0 41.0 36.0 41.0 32-33 39.050125 41.0 39.0 41.0 35.5 41.0 34-35 38.96825 40.0 39.0 41.0 35.0 41.0 36-37 38.73025 40.0 38.0 41.0 35.0 41.0 38-39 38.706875 40.0 38.0 41.0 35.0 41.0 40-41 38.49725 40.0 38.0 41.0 34.5 41.0 42-43 38.089875 40.0 38.0 41.0 33.5 41.0 44-45 38.586875000000006 40.0 38.0 41.0 34.5 41.0 46-47 38.67425 40.0 38.0 41.0 35.0 41.0 48-49 38.537375 40.0 38.0 41.0 34.5 41.0 50-51 38.494749999999996 40.0 38.0 41.0 34.5 41.0 52-53 38.311625 40.0 38.0 41.0 34.0 41.0 54-55 37.960375 40.0 37.0 41.0 33.5 41.0 56-57 37.83775 40.0 37.0 41.0 33.5 41.0 58-59 37.48225 39.5 36.0 41.0 33.0 41.0 60-61 37.228625 39.0 36.0 41.0 32.5 41.0 62-63 37.061125000000004 39.0 35.0 41.0 33.0 41.0 64-65 36.7175 38.5 35.0 40.5 32.5 41.0 66-67 36.346875 37.0 35.0 40.0 32.0 41.0 68-69 35.99225 37.0 35.0 39.0 32.0 41.0 70-71 35.602625 36.0 35.0 39.0 32.0 41.0 72-73 35.08425 36.0 35.0 39.0 31.5 40.5 74-75 33.7815 35.0 34.5 37.0 29.0 39.0 76-77 33.257625000000004 35.0 34.0 37.0 28.0 39.0 78-79 33.003625 35.0 34.0 36.5 28.0 39.0 80-81 32.653 35.0 34.0 36.0 27.0 37.0 82-83 32.469750000000005 35.0 34.0 36.0 27.0 37.0 84-85 32.3675 35.0 34.0 35.0 27.5 36.5 86-87 32.067875 35.0 34.0 35.0 27.0 36.0 88-89 31.957375 35.0 34.0 35.0 26.5 36.0 90-91 31.839750000000002 35.0 34.0 35.0 26.5 36.0 92-93 31.631625 35.0 34.0 35.0 25.5 35.0 94-95 31.46 35.0 33.5 35.0 24.5 35.0 96-97 31.353 35.0 34.0 35.0 24.0 35.0 98-99 31.19675 35.0 33.0 35.0 23.5 35.0 100 31.09325 35.0 34.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 2.0 10 1.0 11 4.0 12 4.0 13 4.0 14 4.0 15 5.0 16 10.0 17 5.0 18 6.0 19 10.0 20 10.0 21 6.0 22 5.0 23 13.0 24 16.0 25 16.0 26 21.0 27 43.0 28 72.0 29 85.0 30 40.0 31 54.0 32 84.0 33 94.0 34 123.0 35 185.0 36 377.0 37 856.0 38 1501.0 39 341.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.122833458929914 35.89550364230093 20.67319768902286 12.308465209746295 2 36.85 30.95 17.325 14.875 3 30.3 33.625 21.325 14.75 4 29.049999999999997 29.325000000000003 24.825 16.8 5 26.75 29.225 23.075000000000003 20.95 6 32.475 27.6 22.45 17.474999999999998 7 28.7 27.900000000000002 24.175 19.225 8 21.775 33.75 26.900000000000002 17.575 9 23.45 33.175 24.6 18.775 10-11 25.75 30.2875 26.0375 17.925 12-13 24.425 27.8125 26.4625 21.3 14-15 22.45 31.025000000000002 25.2375 21.2875 16-17 22.0625 29.012500000000003 26.687499999999996 22.237499999999997 18-19 25.074999999999996 26.8125 28.000000000000004 20.1125 20-21 22.95 28.275 27.3375 21.4375 22-23 23.775 29.6875 26.0375 20.5 24-25 22.6375 29.2 25.0625 23.1 26-27 21.85 27.474999999999998 28.125 22.55 28-29 22.825 29.9 25.7 21.575 30-31 24.075 27.487499999999997 27.0875 21.349999999999998 32-33 22.287499999999998 29.8875 25.5 22.325 34-35 24.337500000000002 27.425 25.2875 22.95 36-37 23.1125 29.65 27.3375 19.900000000000002 38-39 23.0875 30.562499999999996 25.124999999999996 21.224999999999998 40-41 25.0125 29.062500000000004 24.575 21.349999999999998 42-43 22.650000000000002 27.125 27.8875 22.3375 44-45 21.475 28.0625 28.525 21.9375 46-47 24.975 27.5125 27.6375 19.875 48-49 22.9875 29.25 27.712500000000002 20.05 50-51 25.0 27.55 25.387500000000003 22.0625 52-53 24.65 27.537499999999998 25.275 22.537499999999998 54-55 22.225 27.150000000000002 29.175 21.45 56-57 22.4875 27.125 29.312500000000004 21.075 58-59 23.125 27.0625 27.9375 21.875 60-61 23.35 27.200000000000003 26.9625 22.4875 62-63 22.875 27.437499999999996 29.4875 20.200000000000003 64-65 24.125 29.1875 26.2125 20.474999999999998 66-67 22.9875 31.362499999999997 26.025 19.625 68-69 23.575 31.15 25.6125 19.662499999999998 70-71 23.5125 31.05 24.5375 20.9 72-73 22.7 32.2 25.124999999999996 19.975 74-75 22.625 29.8875 26.924999999999997 20.5625 76-77 23.1375 29.1625 26.937499999999996 20.7625 78-79 24.1625 29.325000000000003 26.437500000000004 20.075000000000003 80-81 23.5875 29.3875 26.700000000000003 20.325 82-83 22.625 28.65 27.150000000000002 21.575 84-85 22.9375 29.2375 27.400000000000002 20.424999999999997 86-87 23.8625 29.525000000000002 26.200000000000003 20.4125 88-89 24.099999999999998 28.075 26.724999999999998 21.099999999999998 90-91 23.4875 29.2875 27.150000000000002 20.075000000000003 92-93 23.150000000000002 28.9 26.0 21.95 94-95 23.1 28.925 27.187499999999996 20.7875 96-97 23.9875 28.299999999999997 26.787499999999998 20.925 98-99 23.7375 28.9 26.950000000000003 20.4125 100 23.674999999999997 30.525000000000002 25.525 20.275000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 2.0 17 2.0 18 2.0 19 2.5 20 1.0 21 0.5 22 3.0 23 4.5 24 4.5 25 5.0 26 5.5 27 7.5 28 9.0 29 11.0 30 13.5 31 15.0 32 22.5 33 34.0 34 43.0 35 57.0 36 74.0 37 98.5 38 134.0 39 164.5 40 200.0 41 235.0 42 255.5 43 272.0 44 269.0 45 252.0 46 251.0 47 225.5 48 215.5 49 198.5 50 153.0 51 133.5 52 109.5 53 85.0 54 75.0 55 71.5 56 56.5 57 45.0 58 40.5 59 28.0 60 18.5 61 18.0 62 15.5 63 12.5 64 8.5 65 5.0 66 3.0 67 3.5 68 4.0 69 4.0 70 5.0 71 4.0 72 1.5 73 0.5 74 1.5 75 1.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.05511811023622 94.35 2 0.7349081364829396 1.4000000000000001 3 0.07874015748031496 0.22499999999999998 4 0.026246719160104987 0.1 5 0.05249343832020997 0.25 6 0.0 0.0 7 0.0 0.0 8 0.026246719160104987 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.026246719160104987 3.4750000000000005 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATG 139 3.4750000000000005 TruSeq Adapter, Index 9 (100% over 49bp) CAACACGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTG 8 0.2 No Hit AACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAAC 5 0.125 No Hit AGATCGGAAGAGCACACGTCTGAACAGATCGGAAGAGCACACGTCTGAAC 5 0.125 Illumina Multiplexing PCR Primer 2.01 (96% over 25bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 4.375 0.0 0.0 0.0 0.0 2 4.375 0.0 0.0 0.0 0.0 3 4.375 0.0 0.0 0.0 0.0 4 4.375 0.0 0.0 0.0 0.0 5 4.375 0.0 0.0 0.0 0.0 6 4.375 0.0 0.0 0.0 0.0 7 4.375 0.0 0.0 0.0 0.0 8 4.375 0.0 0.0 0.0 0.0 9 4.375 0.0 0.0 0.0 0.0 10-11 4.4 0.0 0.0 0.0 0.0 12-13 4.4375 0.0 0.0 0.0 0.0 14-15 4.525 0.0 0.0 0.0 0.0 16-17 4.5375 0.0 0.0 0.0 0.0 18-19 4.575 0.0 0.0 0.0 0.0 20-21 4.5875 0.0 0.0 0.0 0.0 22-23 4.6125 0.0 0.0 0.0 0.0 24-25 4.625 0.0 0.0 0.0 0.0 26-27 4.625 0.0 0.0 0.0 0.0 28-29 4.625 0.0 0.0 0.0 0.0 30-31 4.6375 0.0 0.0 0.0 0.0 32-33 4.675 0.0 0.0 0.0 0.0 34-35 4.6875 0.0 0.0 0.0 0.0 36-37 4.7375 0.0 0.0 0.0 0.0 38-39 4.75 0.0 0.0 0.0 0.0 40-41 4.75 0.0 0.0 0.0 0.0 42-43 4.75 0.0 0.0 0.0 0.0 44-45 4.75 0.0 0.0 0.0 0.0 46-47 4.75 0.0 0.0 0.0 0.0 48-49 4.75 0.0 0.0 0.0 0.0 50-51 4.75 0.0 0.0 0.0 0.0 52-53 4.75 0.0 0.0 0.0 0.0 54-55 4.75 0.0 0.0 0.0 0.0 56-57 4.75 0.0 0.0 0.0 0.0 58-59 4.7625 0.0 0.0 0.0 0.0 60-61 4.775 0.0 0.0 0.0 0.0 62-63 4.775 0.0 0.0 0.0 0.0 64-65 4.775 0.0 0.0 0.0 0.0 66-67 4.775 0.0 0.0 0.0 0.0 68-69 4.8 0.0 0.0 0.0 0.0 70-71 4.8 0.0 0.0 0.0 0.0 72-73 4.825 0.0 0.0 0.0 0.0 74-75 4.825 0.0 0.0 0.0 0.0 76-77 4.8375 0.0 0.0 0.0 0.0 78-79 4.85 0.0 0.0 0.0 0.0 80-81 4.85 0.0 0.0 0.0 0.0 82-83 4.9 0.0 0.0 0.0 0.0 84-85 4.925 0.0 0.0 0.0 0.0 86-87 4.925 0.0 0.0 0.0 0.0 88 4.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR10225137 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10225137_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.092 34.0 31.0 34.0 30.0 34.0 2 32.21 34.0 31.0 34.0 30.0 34.0 3 32.22575 34.0 31.0 34.0 30.0 34.0 4 35.70225 37.0 37.0 37.0 35.0 37.0 5 35.5325 37.0 35.0 37.0 35.0 37.0 6 35.5785 37.0 35.0 37.0 35.0 37.0 7 35.475 37.0 36.0 37.0 35.0 37.0 8 35.5465 37.0 37.0 37.0 35.0 37.0 9 37.3565 39.0 39.0 39.0 35.0 39.0 10-11 37.26425 39.0 39.0 39.0 35.0 39.0 12-13 37.260625000000005 39.0 39.0 39.0 35.0 39.0 14-15 38.701 41.0 39.5 41.0 35.0 41.0 16-17 38.691125 41.0 39.5 41.0 35.0 41.0 18-19 38.495625000000004 41.0 39.0 41.0 34.5 41.0 20-21 38.355875 41.0 39.0 41.0 34.5 41.0 22-23 38.146625 41.0 39.0 41.0 34.0 41.0 24-25 38.035375 41.0 39.0 41.0 33.0 41.0 26-27 37.99925 41.0 39.0 41.0 33.5 41.0 28-29 37.818 40.0 38.0 41.0 33.0 41.0 30-31 37.545 40.0 38.0 41.0 32.0 41.0 32-33 37.471875 40.0 38.0 41.0 31.5 41.0 34-35 37.33125 40.0 38.0 41.0 31.5 41.0 36-37 37.20525 40.0 38.0 41.0 31.0 41.0 38-39 37.224875 40.0 38.0 41.0 31.0 41.0 40-41 37.26275 40.0 38.0 41.0 32.0 41.0 42-43 37.014375 40.0 37.5 41.0 30.5 41.0 44-45 37.100875 40.0 38.0 41.0 31.0 41.0 46-47 37.302625 40.0 38.0 41.0 31.5 41.0 48-49 37.22425 40.0 38.0 41.0 31.5 41.0 50-51 37.144125 40.0 37.5 41.0 31.5 41.0 52-53 36.896125 40.0 37.0 41.0 30.5 41.0 54-55 36.7235 40.0 36.5 41.0 31.0 41.0 56-57 36.47825 40.0 36.0 41.0 30.0 41.0 58-59 36.28475 39.5 35.5 41.0 30.0 41.0 60-61 36.033 39.0 35.0 41.0 29.5 41.0 62-63 35.8005 39.0 35.0 41.0 29.5 41.0 64-65 35.292874999999995 38.0 35.0 40.5 28.5 41.0 66-67 34.459 37.0 34.5 40.0 25.5 41.0 68-69 33.627125 37.0 34.0 39.5 20.5 41.0 70-71 33.269625000000005 36.5 34.0 39.0 18.0 41.0 72-73 32.844 36.0 34.0 39.0 18.0 40.5 74-75 32.41375 35.5 34.0 37.5 16.0 39.5 76-77 32.081875000000004 35.0 34.0 37.0 15.0 39.0 78-79 31.690375 35.0 33.0 37.0 9.0 39.0 80-81 31.466250000000002 35.0 33.0 36.0 8.5 37.5 82-83 31.13025 35.0 33.0 36.0 3.5 37.0 84-85 30.847375 35.0 33.0 35.5 2.0 37.0 86-87 30.573375 35.0 33.0 35.0 2.0 36.0 88-89 30.376125000000002 35.0 33.0 35.0 2.0 36.0 90-91 30.19525 35.0 32.5 35.0 2.0 36.0 92-93 29.98675 35.0 32.5 35.0 2.0 35.0 94-95 29.823124999999997 35.0 32.0 35.0 2.0 35.0 96-97 29.648625000000003 35.0 32.0 35.0 2.0 35.0 98-99 29.48225 35.0 32.0 35.0 2.0 35.0 100 29.46025 35.0 32.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 54.0 3 8.0 4 11.0 5 7.0 6 4.0 7 15.0 8 6.0 9 7.0 10 9.0 11 8.0 12 7.0 13 8.0 14 11.0 15 9.0 16 9.0 17 2.0 18 18.0 19 11.0 20 12.0 21 14.0 22 21.0 23 18.0 24 30.0 25 85.0 26 57.0 27 25.0 28 40.0 29 35.0 30 69.0 31 57.0 32 91.0 33 86.0 34 130.0 35 167.0 36 314.0 37 719.0 38 1435.0 39 391.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.800000000000004 16.3 16.125 28.775000000000002 2 31.025000000000002 6.375 19.875 42.725 3 18.3 9.875 20.8 51.025 4 22.05 7.5 22.85 47.599999999999994 5 22.8 10.9 23.1 43.2 6 33.35 10.6 26.1 29.95 7 21.349999999999998 26.924999999999997 32.5 19.225 8 15.475 32.025 33.650000000000006 18.85 9 16.175 31.225 33.1 19.5 10-11 18.462500000000002 31.4 31.3 18.8375 12-13 19.425 27.737499999999997 30.85 21.987499999999997 14-15 19.412499999999998 27.3875 32.237500000000004 20.962500000000002 16-17 19.875 26.5875 30.675 22.8625 18-19 20.1625 27.650000000000002 31.162499999999998 21.025 20-21 17.8 30.887500000000003 29.349999999999998 21.9625 22-23 22.2125 28.8375 27.962500000000002 20.9875 24-25 21.5375 29.775000000000002 27.1 21.587500000000002 26-27 18.987499999999997 31.912499999999998 28.0625 21.0375 28-29 20.9875 31.025000000000002 26.700000000000003 21.2875 30-31 20.45 27.8375 29.7 22.0125 32-33 21.325 29.225 28.675 20.775 34-35 21.3875 29.575000000000003 27.150000000000002 21.8875 36-37 19.325 30.349999999999998 28.6875 21.637500000000003 38-39 19.45 27.8375 29.75 22.9625 40-41 21.825 27.987499999999997 27.3625 22.825 42-43 21.875 27.987499999999997 28.9 21.2375 44-45 22.625 28.199999999999996 27.575 21.6 46-47 19.6875 27.900000000000002 28.675 23.7375 48-49 21.9 27.6625 27.537499999999998 22.900000000000002 50-51 20.4625 27.825 27.9125 23.799999999999997 52-53 19.1375 30.599999999999998 28.9375 21.325 54-55 19.5125 28.0625 29.762499999999996 22.662499999999998 56-57 18.462500000000002 29.9375 29.562500000000004 22.037499999999998 58-59 19.3875 29.825000000000003 29.225 21.5625 60-61 19.287499999999998 32.074999999999996 27.0875 21.55 62-63 19.662499999999998 31.55 25.9875 22.8 64-65 19.9875 31.3 26.575 22.1375 66-67 19.525000000000002 31.937500000000004 27.175 21.3625 68-69 18.862499999999997 33.074999999999996 26.2875 21.775 70-71 19.85 30.162499999999998 27.4125 22.575 72-73 20.325 30.25 26.8375 22.5875 74-75 19.9875 29.7375 27.800000000000004 22.475 76-77 20.2375 30.4625 26.474999999999998 22.825 78-79 20.5625 29.4375 27.537499999999998 22.4625 80-81 20.825 29.25 26.9125 23.0125 82-83 20.849999999999998 29.9 26.825 22.425 84-85 20.599999999999998 29.125 26.8375 23.4375 86-87 19.7 29.1625 27.237499999999997 23.9 88-89 20.4625 29.1875 27.3375 23.0125 90-91 20.349999999999998 29.349999999999998 27.462500000000002 22.8375 92-93 21.0125 29.7875 26.200000000000003 23.0 94-95 20.8 28.599999999999998 27.962500000000002 22.6375 96-97 20.1125 28.962500000000002 27.787499999999998 23.1375 98-99 21.175 27.962500000000002 27.712500000000002 23.150000000000002 100 21.175 29.125 27.400000000000002 22.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 1.0 17 1.5 18 2.0 19 2.5 20 4.5 21 4.0 22 4.0 23 6.5 24 10.5 25 13.0 26 13.5 27 15.5 28 18.5 29 21.5 30 30.5 31 40.5 32 49.0 33 66.5 34 75.5 35 85.5 36 108.5 37 127.5 38 147.0 39 174.0 40 203.0 41 200.0 42 190.0 43 204.5 44 229.5 45 244.5 46 230.0 47 214.0 48 197.5 49 166.0 50 132.5 51 111.0 52 97.5 53 83.0 54 67.0 55 58.5 56 55.0 57 43.5 58 40.0 59 40.0 60 34.0 61 28.5 62 21.5 63 15.5 64 10.5 65 10.5 66 11.0 67 6.5 68 3.5 69 2.5 70 2.5 71 3.0 72 2.5 73 2.5 74 2.5 75 1.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.25211864406779 92.75 2 1.2976694915254237 2.45 3 0.26483050847457623 0.75 4 0.1059322033898305 0.4 5 0.05296610169491525 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.026483050847457626 3.4000000000000004 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 136 3.4000000000000004 Illumina Single End PCR Primer 1 (100% over 50bp) GCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTT 5 0.125 No Hit GTTCAGACGTGTGCTCTTCCGATCTAGATCGGAAGAGCGTCGTGTAGGGA 5 0.125 Illumina Single End PCR Primer 1 (100% over 25bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 3.9 0.0 0.0 0.0 0.0 2 3.9 0.0 0.0 0.0 0.0 3 3.9 0.0 0.0 0.0 0.0 4 3.9 0.0 0.0 0.0 0.0 5 3.9 0.0 0.0 0.0 0.0 6 3.9 0.0 0.0 0.0 0.0 7 3.9 0.0 0.0 0.0 0.0 8 3.9 0.0 0.0 0.0 0.0 9 3.9 0.0 0.0 0.0 0.0 10-11 3.925 0.0 0.0 0.0 0.0 12-13 3.975 0.0 0.0 0.0 0.0 14-15 4.05 0.0 0.0 0.0 0.0 16-17 4.0625 0.0 0.0 0.0 0.0 18-19 4.1875 0.0 0.0 0.0 0.0 20-21 4.2375 0.0 0.0 0.0 0.0 22-23 4.2625 0.0 0.0 0.0 0.0 24-25 4.325 0.0 0.0 0.0 0.0 26-27 4.4625 0.0 0.0 0.0 0.0 28-29 4.475 0.0 0.0 0.0 0.0 30-31 4.525 0.0 0.0 0.0 0.0 32-33 4.575 0.0 0.0 0.0 0.0 34-35 4.5875 0.0 0.0 0.0 0.0 36-37 4.6125 0.0 0.0 0.0 0.0 38-39 4.625 0.0 0.0 0.0 0.0 40-41 4.625 0.0 0.0 0.0 0.0 42-43 4.625 0.0 0.0 0.0 0.0 44-45 4.625 0.0 0.0 0.0 0.0 46-47 4.625 0.0 0.0 0.0 0.0 48-49 4.625 0.0 0.0 0.0 0.0 50-51 4.625 0.0 0.0 0.0 0.0 52-53 4.625 0.0 0.0 0.0 0.0 54-55 4.625 0.0 0.0 0.0 0.0 56-57 4.625 0.0 0.0 0.0 0.0 58-59 4.6375 0.0 0.0 0.0 0.0 60-61 4.65 0.0 0.0 0.0 0.0 62-63 4.65 0.0 0.0 0.0 0.0 64-65 4.65 0.0 0.0 0.0 0.0 66-67 4.65 0.0 0.0 0.0 0.0 68-69 4.675 0.0 0.0 0.0 0.0 70-71 4.675 0.0 0.0 0.0 0.0 72-73 4.7 0.0 0.0 0.0 0.0 74-75 4.7 0.0 0.0 0.0 0.0 76-77 4.7125 0.0 0.0 0.0 0.0 78-79 4.725 0.0 0.0 0.0 0.0 80-81 4.725 0.0 0.0 0.0 0.0 82-83 4.775 0.0 0.0 0.0 0.0 84-85 4.8 0.0 0.0 0.0 0.0 86-87 4.8 0.0 0.0 0.0 0.0 88 4.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163091 spots for SRR10225137.sra Written 3163091 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra Read 3163085 spots for SRR10225137.sra Written 3163085 spots for SRR10225137.sra SRR ids: ['SRR10225137.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f35on8z3 SRR10225137.sra spots: 63261706 blocks: [[1, 3163085], [3163086, 6326170], [6326171, 9489255], [9489256, 12652340], [12652341, 15815425], [15815426, 18978510], [18978511, 22141595], [22141596, 25304680], [25304681, 28467765], [28467766, 31630850], [31630851, 34793935], [34793936, 37957020], [37957021, 41120105], [41120106, 44283190], [44283191, 47446275], [47446276, 50609360], [50609361, 53772445], [53772446, 56935530], [56935531, 60098615], [60098616, 63261706]] SRR10225137 file size 17296578 SRR10225137 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10225137 SRR10225137_1.fastq SRR10225137_2.fastq Input file: SRR10225137_1.fastq Paired file: SRR10225137_2.fastq trimmed: SRR10225137-trimmed-pair1.fastq, SRR10225137-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:19:51 2025 >> started Tue Feb 11 23:20:48 2025 >> done (57.114s) 63261706 read pairs processed; of these: 586741 ( 0.93%) short read pairs filtered out after trimming by size control 3984505 ( 6.30%) empty read pairs filtered out after trimming by size control 58690460 (92.77%) read pairs available; of these: 8697716 (14.82%) trimmed read pairs available after processing 49992744 (85.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 47699 0.08% 19 31192 0.05% 20 41990 0.07% 21 19086 0.03% 22 12764 0.02% 23 14039 0.02% 24 28487 0.05% 25 33012 0.06% 26 24615 0.04% 27 18302 0.03% 28 12496 0.02% 29 15766 0.03% 30 15501 0.03% 31 10430 0.02% 32 10847 0.02% 33 6929 0.01% 34 4436 0.01% 35 4621 0.01% 36 4949 0.01% 37 5112 0.01% 38 5713 0.01% 39 6193 0.01% 40 7048 0.01% 41 7026 0.01% 42 7341 0.01% 43 8314 0.01% 44 8488 0.01% 45 9135 0.02% 46 9124 0.02% 47 9402 0.02% 48 10255 0.02% 49 11082 0.02% 50 11779 0.02% 51 12703 0.02% 52 13078 0.02% 53 14211 0.02% 54 15499 0.03% 55 17437 0.03% 56 17641 0.03% 57 18919 0.03% 58 19675 0.03% 59 117674 0.20% 60 122497 0.21% 61 70209 0.12% 62 74308 0.13% 63 79266 0.14% 64 80576 0.14% 65 83607 0.14% 66 88440 0.15% 67 95362 0.16% 68 92448 0.16% 69 93316 0.16% 70 94775 0.16% 71 92011 0.16% 72 95296 0.16% 73 103416 0.18% 74 101345 0.17% 75 106796 0.18% 76 115463 0.20% 77 106608 0.18% 78 107679 0.18% 79 111614 0.19% 80 111777 0.19% 81 123514 0.21% 82 127746 0.22% 83 135098 0.23% 84 145379 0.25% 85 145190 0.25% 86 135837 0.23% 87 156200 0.27% 88 161199 0.27% 89 174704 0.30% 90 207098 0.35% 91 300819 0.51% 92 212637 0.36% 93 249085 0.42% 94 259248 0.44% 95 1034816 1.76% 96 336786 0.57% 97 436304 0.74% 98 610965 1.04% 99 998272 1.70% 100 49992744 85.18% 58690460 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=23 prefix-density=0.02 prefix-fanout=2.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=201.00 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=11.9 sequence=AGAAAGAAGGAGTGACTTGGTCCGTTCACCGGCCTGATGTTATCTTTGGGTTTTCGCCTTATAGCTTGATGAATTTGATTGTCACTATTTCTGTTTACGCTGCAATATGCAAGCACGAGGGAGCTCCTTTAATCTTTCGTGGAACAAAAGAGGCATGGAATGGTTACGCAATTGCTTCTGATGCAGATCTGATTGCAGAGCATGAAATTTGGGCGTGTGTGGATCCTAATGCACAAAATGAAGCTTTTAATATCCACAACGGAGATCTGTTCAAATGGAAGCATTTGTGGAGGATTTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=26 prefix-density=0.27 prefix-fanout=2.3 sequence=GACTTGTACTTGTAAGGGTGCGTTGGTGGTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=686.44 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=29.2 sequence=AAAACAAAAATCAGAGTCAATTGTTTATTTTAAATTCCAAACTTCGCACATCATCTAAAGCCTTGTACTCGTAAACCACAAAATCGAAAAAAAAGCGCCTCAATTCATCATCTCCATGCTTCAGCTTCAAGCTT SRR10225137 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:21:25 Started mapping on | Feb 11 23:21:25 Finished on | Feb 11 23:27:11 Mapping speed, Million of reads per hour | 610.65 Number of input reads | 58690460 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 49849444 Uniquely mapped reads % | 84.94% Average mapped length | 194.51 Number of splices: Total | 20561362 Number of splices: Annotated (sjdb) | 19935549 Number of splices: GT/AG | 20103448 Number of splices: GC/AG | 276414 Number of splices: AT/AC | 28108 Number of splices: Non-canonical | 153392 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.04% Deletion average length | 2.52 Insertion rate per base | 0.03% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2468366 % of reads mapped to multiple loci | 4.21% Number of reads mapped to too many loci | 2457120 % of reads mapped to too many loci | 4.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.33% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6711445 6711445 6711445 N_multimapping 2468366 2468366 2468366 N_noFeature 2043745 2493427 48966599 N_ambiguous 853335 413618 9975 UnstrandedReadsAssigned:46952364 PositiveStrandReadsAssigned:46942399 NegativeStrandReadsAssigned:872870 Dataset is classified positive stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR10225137 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR10225137-trimmed-pair1.fastq SRR10225137-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 58,690,460 reads, 49,417,764 reads pseudoaligned [quant] estimated average fragment length: 260.13 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR10225137.ke.tsv 34699 SRR10225137.se.tsv 87100 total ==> SRR10225137.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.87 10133.2 83.8882 Potri.005G024800.1.v4.1 1035 775.87 1880 35.2822 Potri.004G059700.1.v4.1 961 701.878 805 16.7002 Potri.007G009000.2.v4.1 1416 1156.87 0 0 Potri.003G141000.2.v4.1 2943 2683.87 1464.83 7.94716 Potri.016G087400.1.v4.1 270 62.9029 3472.2 803.751 Potri.015G069301.1.v4.1 564 305.346 0 0 Potri.010G195200.1.v4.1 1773 1513.87 438.757 4.2201 Potri.012G127500.1.v4.1 977 717.878 12232 248.104 ==> SRR10225137.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 42 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1305 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 38 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 337 SRR10225137 completed mapping pipeline successfully