Starting /dee2/code/volunteer_pipeline.sh SRR10225139 current disk space = 3052478959616 free memory = 1413705944 SRR10225139 SRAfilesize ab136e91aa4aacefe947275920856224 SRR10225139.sra SRR10225139.sra file validated SRR10225139 is paired end SRR10225139 is conventional basespace SRR10225139 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10225139_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7775 34.0 31.0 34.0 31.0 34.0 2 33.023 34.0 33.0 34.0 31.0 34.0 3 33.1085 34.0 33.0 34.0 31.0 34.0 4 36.448 37.0 37.0 37.0 35.0 37.0 5 36.39025 37.0 37.0 37.0 35.0 37.0 6 36.32375 37.0 37.0 37.0 35.0 37.0 7 36.41775 37.0 37.0 37.0 35.0 37.0 8 36.4315 37.0 37.0 37.0 35.0 37.0 9 38.25675 39.0 39.0 39.0 37.0 39.0 10-11 38.2025 39.0 39.0 39.0 37.0 39.0 12-13 38.260374999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.797625 41.0 40.0 41.0 37.5 41.0 16-17 39.72625 41.0 40.0 41.0 37.5 41.0 18-19 39.742000000000004 41.0 40.0 41.0 37.0 41.0 20-21 39.678250000000006 41.0 40.0 41.0 37.0 41.0 22-23 39.694374999999994 41.0 40.0 41.0 37.0 41.0 24-25 39.612750000000005 41.0 40.0 41.0 37.0 41.0 26-27 39.526 41.0 39.5 41.0 36.5 41.0 28-29 39.392375 41.0 39.5 41.0 36.5 41.0 30-31 39.286500000000004 41.0 39.0 41.0 36.0 41.0 32-33 39.126 41.0 39.0 41.0 36.0 41.0 34-35 39.021625 40.0 39.0 41.0 35.0 41.0 36-37 38.877250000000004 40.0 38.5 41.0 35.0 41.0 38-39 38.798125 40.0 38.0 41.0 35.0 41.0 40-41 38.64425 40.0 38.0 41.0 34.5 41.0 42-43 38.431125 40.0 38.0 41.0 34.5 41.0 44-45 38.73975 40.0 39.0 41.0 35.0 41.0 46-47 38.82875 41.0 39.0 41.0 35.0 41.0 48-49 38.72525 41.0 38.5 41.0 35.0 41.0 50-51 38.673375 40.5 38.5 41.0 34.5 41.0 52-53 38.5365 40.0 38.0 41.0 34.5 41.0 54-55 38.2425 40.0 38.0 41.0 34.0 41.0 56-57 38.089749999999995 40.0 37.0 41.0 34.0 41.0 58-59 37.7495 40.0 37.0 41.0 33.0 41.0 60-61 37.488 39.0 36.0 41.0 33.0 41.0 62-63 37.241749999999996 39.0 35.5 41.0 33.0 41.0 64-65 36.837 38.5 35.0 41.0 32.0 41.0 66-67 36.59162499999999 37.5 35.0 40.0 32.0 41.0 68-69 36.138625000000005 37.0 35.0 39.0 32.0 41.0 70-71 35.857625 36.5 35.0 39.0 32.0 41.0 72-73 35.394125 36.0 35.0 39.0 32.0 40.5 74-75 34.407875000000004 35.5 35.0 37.0 30.5 39.0 76-77 34.070750000000004 35.0 35.0 37.0 30.0 39.0 78-79 33.7445 35.0 34.5 36.5 30.0 38.5 80-81 33.45425 35.0 34.0 36.0 30.0 37.0 82-83 33.295500000000004 35.0 34.0 36.0 30.0 37.0 84-85 33.088125000000005 35.0 34.0 35.0 30.0 36.5 86-87 32.914874999999995 35.0 34.0 35.0 29.5 36.0 88-89 32.792125 35.0 34.0 35.0 29.0 36.0 90-91 32.646249999999995 35.0 34.0 35.0 29.0 36.0 92-93 32.531375 35.0 34.0 35.0 29.0 35.5 94-95 32.4755 35.0 34.0 35.0 29.5 35.0 96-97 32.1965 35.0 34.0 35.0 29.0 35.0 98-99 32.070750000000004 35.0 34.0 35.0 29.0 35.0 100 32.07175 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 0.0 11 1.0 12 2.0 13 7.0 14 1.0 15 3.0 16 5.0 17 4.0 18 5.0 19 9.0 20 7.0 21 6.0 22 6.0 23 9.0 24 18.0 25 19.0 26 17.0 27 36.0 28 40.0 29 62.0 30 39.0 31 58.0 32 67.0 33 88.0 34 114.0 35 182.0 36 366.0 37 867.0 38 1625.0 39 334.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.62776659959759 35.38732394366197 21.830985915492956 13.153923541247483 2 34.300000000000004 30.875000000000004 18.425 16.400000000000002 3 30.525000000000002 31.924999999999997 21.5 16.05 4 29.2 28.225 24.175 18.4 5 24.349999999999998 31.3 23.799999999999997 20.549999999999997 6 29.349999999999998 26.900000000000002 24.025 19.725 7 27.650000000000002 26.974999999999998 25.1 20.275000000000002 8 23.275000000000002 30.65 26.6 19.475 9 24.175 31.25 25.575 19.0 10-11 23.8625 30.025000000000002 25.8 20.3125 12-13 23.5 29.4375 26.1625 20.9 14-15 23.3 30.0875 25.7125 20.9 16-17 22.912499999999998 29.1375 26.75 21.2 18-19 23.8125 27.9375 27.8875 20.3625 20-21 23.5375 28.050000000000004 27.487499999999997 20.925 22-23 24.95 29.612500000000004 25.4875 19.950000000000003 24-25 22.85 29.5375 25.55 22.0625 26-27 23.2875 27.8875 27.1625 21.6625 28-29 22.95 29.2875 26.0 21.762500000000003 30-31 23.8125 27.5875 27.875 20.724999999999998 32-33 24.349999999999998 28.287499999999998 25.637500000000003 21.725 34-35 22.825 27.0 26.974999999999998 23.200000000000003 36-37 23.7375 29.099999999999998 25.95 21.212500000000002 38-39 23.549999999999997 28.725 27.1625 20.5625 40-41 22.3125 28.050000000000004 27.5875 22.05 42-43 22.85 27.1125 28.1 21.9375 44-45 23.674999999999997 26.887499999999996 28.287499999999998 21.15 46-47 23.599999999999998 27.3875 28.425 20.5875 48-49 22.9875 28.287499999999998 28.3125 20.4125 50-51 23.3125 27.987499999999997 26.387500000000003 22.3125 52-53 23.875 28.8625 25.887500000000003 21.375 54-55 23.5 27.462500000000002 26.4125 22.625 56-57 22.7375 27.5875 28.199999999999996 21.475 58-59 23.2125 27.462500000000002 28.325 21.0 60-61 23.1125 28.15 26.825 21.912499999999998 62-63 22.9375 28.549999999999997 27.925 20.5875 64-65 23.5625 28.9 26.700000000000003 20.837500000000002 66-67 24.075 29.4875 26.4625 19.975 68-69 23.775 29.425 26.450000000000003 20.349999999999998 70-71 23.8404800600075 29.703712964120516 25.55319414926866 20.902612826603324 72-73 23.375 29.5875 26.974999999999998 20.0625 74-75 23.225 29.8375 26.825 20.1125 76-77 23.4125 29.1625 25.900000000000002 21.525 78-79 23.6875 28.625 26.85 20.837500000000002 80-81 24.025 28.275 26.887499999999996 20.8125 82-83 23.375 28.775000000000002 27.075 20.775 84-85 23.1375 28.825 26.950000000000003 21.087500000000002 86-87 23.9125 28.125 27.3125 20.65 88-89 22.875 27.6875 27.5125 21.925 90-91 23.9875 26.625 28.537499999999998 20.849999999999998 92-93 22.675 27.9125 28.3875 21.025 94-95 24.45 28.212500000000002 26.724999999999998 20.6125 96-97 23.8875 28.799999999999997 27.0875 20.225 98-99 24.25 27.962500000000002 27.55 20.2375 100 24.5 27.375 27.525 20.599999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 1.0 11 1.5 12 0.5 13 0.5 14 0.5 15 0.0 16 1.0 17 1.5 18 1.5 19 1.0 20 0.0 21 1.0 22 1.0 23 3.0 24 5.5 25 7.0 26 7.0 27 5.5 28 6.0 29 7.0 30 11.0 31 13.5 32 19.0 33 35.0 34 53.0 35 68.5 36 82.0 37 101.0 38 119.0 39 151.5 40 198.5 41 217.0 42 238.5 43 267.0 44 267.5 45 261.0 46 264.0 47 247.0 48 222.5 49 205.5 50 162.0 51 131.5 52 110.0 53 90.5 54 80.5 55 63.5 56 54.0 57 47.5 58 35.0 59 23.0 60 21.0 61 14.0 62 6.5 63 6.5 64 6.5 65 7.0 66 4.5 67 4.5 68 7.5 69 7.5 70 5.5 71 3.0 72 3.0 73 1.5 74 1.0 75 2.0 76 2.0 77 1.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06976744186046 95.85000000000001 2 0.7235142118863048 1.4000000000000001 3 0.07751937984496124 0.22499999999999998 4 0.05167958656330749 0.2 5 0.025839793281653745 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025839793281653745 0.4 >50 0.025839793281653745 1.7999999999999998 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATG 72 1.7999999999999998 TruSeq Adapter, Index 7 (100% over 49bp) CAACACGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTG 16 0.4 No Hit AGATGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 5 0.125 TruSeq Adapter, Index 7 (100% over 46bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 2.425 0.0 0.0 0.0 0.0 2 2.425 0.0 0.0 0.0 0.0 3 2.425 0.0 0.0 0.0 0.0 4 2.425 0.0 0.0 0.0 0.0 5 2.425 0.0 0.0 0.0 0.0 6 2.425 0.0 0.0 0.0 0.0 7 2.425 0.0 0.0 0.0 0.0 8 2.425 0.0 0.0 0.0 0.0 9 2.425 0.0 0.0 0.0 0.0 10-11 2.425 0.0 0.0 0.0 0.0 12-13 2.45 0.0 0.0 0.0 0.0 14-15 2.45 0.0 0.0 0.0 0.0 16-17 2.45 0.0 0.0 0.0 0.0 18-19 2.45 0.0 0.0 0.0 0.0 20-21 2.45 0.0 0.0 0.0 0.0 22-23 2.45 0.0 0.0 0.0 0.0 24-25 2.45 0.0 0.0 0.0 0.0 26-27 2.4625000000000004 0.0 0.0 0.0 0.0 28-29 2.475 0.0 0.0 0.0 0.0 30-31 2.475 0.0 0.0 0.0 0.0 32-33 2.475 0.0 0.0 0.0 0.0 34-35 2.4875 0.0 0.0 0.0 0.0 36-37 2.5 0.0 0.0 0.0 0.0 38-39 2.5 0.0 0.0 0.0 0.0 40-41 2.5 0.0 0.0 0.0 0.0 42-43 2.5 0.0 0.0 0.0 0.0 44-45 2.5 0.0 0.0 0.0 0.0 46-47 2.5 0.0 0.0 0.0 0.0 48-49 2.5 0.0 0.0 0.0 0.0 50-51 2.5 0.0 0.0 0.0 0.0 52-53 2.5 0.0 0.0 0.0 0.0 54-55 2.5 0.0 0.0 0.0 0.0 56-57 2.5125 0.0 0.0 0.0 0.0 58-59 2.5374999999999996 0.0 0.0 0.0 0.0 60-61 2.575 0.0 0.0 0.0 0.0 62-63 2.6 0.0 0.0 0.0 0.0 64-65 2.6 0.0 0.0 0.0 0.0 66-67 2.6 0.0 0.0 0.0 0.0 68-69 2.6 0.0 0.0 0.0 0.0 70-71 2.6125 0.0 0.0 0.0 0.0 72-73 2.65 0.0 0.0 0.0 0.0 74-75 2.675 0.0 0.0 0.0 0.0 76-77 2.6875 0.0 0.0 0.0 0.0 78-79 2.7375 0.0 0.0 0.0 0.0 80-81 2.75 0.0 0.0 0.0 0.0 82-83 2.75 0.0 0.0 0.0 0.0 84-85 2.775 0.0 0.0 0.0 0.0 86-87 2.8375 0.0 0.0 0.0 0.0 88 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR10225139 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10225139_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34 34.0 31.0 34.0 30.0 34.0 2 32.416 34.0 31.0 34.0 31.0 34.0 3 32.33375 34.0 31.0 34.0 30.0 34.0 4 35.77225 37.0 37.0 37.0 35.0 37.0 5 35.715 37.0 37.0 37.0 35.0 37.0 6 35.644 37.0 36.0 37.0 35.0 37.0 7 35.525 37.0 36.0 37.0 35.0 37.0 8 35.58175 37.0 37.0 37.0 35.0 37.0 9 37.45325 39.0 39.0 39.0 35.0 39.0 10-11 37.411875 39.0 39.0 39.0 35.0 39.0 12-13 37.33675 39.0 38.5 39.0 35.0 39.0 14-15 38.801125 41.0 40.0 41.0 35.0 41.0 16-17 38.795375 41.0 39.5 41.0 35.5 41.0 18-19 38.611875 41.0 39.0 41.0 35.0 41.0 20-21 38.514250000000004 41.0 39.0 41.0 35.0 41.0 22-23 38.3955 41.0 39.0 41.0 34.5 41.0 24-25 38.315375 41.0 39.0 41.0 34.0 41.0 26-27 38.230374999999995 41.0 39.0 41.0 34.0 41.0 28-29 38.0275 40.5 38.5 41.0 33.5 41.0 30-31 37.9525 40.0 38.0 41.0 33.5 41.0 32-33 37.8845 40.0 38.0 41.0 33.0 41.0 34-35 37.5625 40.0 38.0 41.0 32.5 41.0 36-37 37.497 40.0 38.0 41.0 32.5 41.0 38-39 37.45075 40.0 38.0 41.0 32.5 41.0 40-41 37.461875 40.0 38.0 41.0 32.5 41.0 42-43 37.217625 40.0 38.0 41.0 32.0 41.0 44-45 37.2395 40.0 38.0 41.0 31.5 41.0 46-47 37.492625000000004 40.0 38.0 41.0 32.5 41.0 48-49 37.3985 40.0 38.0 41.0 32.0 41.0 50-51 37.32525 40.0 37.5 41.0 32.0 41.0 52-53 37.144625 40.0 37.0 41.0 32.0 41.0 54-55 37.01875 40.0 37.0 41.0 31.5 41.0 56-57 36.74925 40.0 36.0 41.0 31.0 41.0 58-59 36.56575 40.0 36.0 41.0 31.0 41.0 60-61 36.361625000000004 39.0 35.0 41.0 31.0 41.0 62-63 36.123625 39.0 35.0 41.0 30.5 41.0 64-65 35.549125000000004 38.5 35.0 41.0 29.0 41.0 66-67 34.954 37.5 35.0 40.0 27.5 41.0 68-69 34.4845 37.0 35.0 39.5 28.0 41.0 70-71 34.034125 36.5 35.0 39.0 26.0 41.0 72-73 33.6 36.0 34.0 39.0 26.0 40.5 74-75 33.206125 35.5 34.0 37.5 25.5 39.5 76-77 32.924875 35.0 34.0 37.0 26.0 39.0 78-79 32.644999999999996 35.0 34.0 37.0 26.0 39.0 80-81 32.273125 35.0 34.0 36.0 25.0 37.5 82-83 31.996875 35.0 34.0 36.0 25.0 37.0 84-85 31.7485 35.0 34.0 35.5 24.5 37.0 86-87 31.538625 35.0 34.0 35.0 24.0 36.0 88-89 31.365000000000002 35.0 34.0 35.0 22.5 36.0 90-91 31.13925 35.0 33.0 35.0 20.5 36.0 92-93 30.893875 35.0 33.0 35.0 18.5 35.5 94-95 30.70175 35.0 33.0 35.0 16.0 35.0 96-97 30.5745 35.0 33.0 35.0 3.5 35.0 98-99 30.486625 35.0 33.0 35.0 2.0 35.0 100 30.3385 35.0 33.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 44.0 3 13.0 4 8.0 5 4.0 6 2.0 7 12.0 8 11.0 9 6.0 10 8.0 11 7.0 12 4.0 13 7.0 14 10.0 15 9.0 16 7.0 17 12.0 18 9.0 19 12.0 20 13.0 21 10.0 22 17.0 23 17.0 24 27.0 25 43.0 26 32.0 27 24.0 28 27.0 29 42.0 30 50.0 31 51.0 32 69.0 33 77.0 34 159.0 35 197.0 36 313.0 37 756.0 38 1512.0 39 379.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.349999999999994 16.05 15.675 26.924999999999997 2 31.95 8.0 20.599999999999998 39.45 3 20.875 9.35 20.474999999999998 49.3 4 23.7 8.175 21.325 46.800000000000004 5 24.9 12.025 22.725 40.35 6 33.35833958489622 13.15328832208052 25.406351587896975 28.08202050512628 7 20.875 28.175 32.15 18.8 8 15.625 31.275 33.275 19.825 9 15.225 32.550000000000004 31.900000000000002 20.325 10-11 18.375 31.075000000000003 30.95 19.6 12-13 18.862499999999997 29.1875 29.975 21.975 14-15 18.9 27.787499999999998 30.8 22.5125 16-17 19.85 27.750000000000004 30.75 21.65 18-19 20.0375 28.7 29.875 21.3875 20-21 18.987499999999997 29.575000000000003 29.5375 21.9 22-23 21.8125 28.825 28.1 21.2625 24-25 20.075000000000003 29.875 27.900000000000002 22.15 26-27 19.1 31.35 28.000000000000004 21.55 28-29 20.424999999999997 30.275000000000002 27.175 22.125 30-31 19.9625 30.15 27.925 21.9625 32-33 19.425 29.5375 28.3625 22.675 34-35 20.925 30.612499999999997 26.224999999999998 22.237499999999997 36-37 19.275000000000002 29.862499999999997 28.449999999999996 22.412499999999998 38-39 19.875 27.85 28.925 23.35 40-41 20.6875 29.562500000000004 27.0125 22.7375 42-43 21.175 29.5 27.462500000000002 21.8625 44-45 21.6125 28.8375 27.400000000000002 22.15 46-47 20.1375 28.475 28.1125 23.275000000000002 48-49 21.5 28.1875 27.55 22.7625 50-51 20.5625 28.6625 26.987499999999997 23.7875 52-53 19.7375 29.612500000000004 28.237499999999997 22.412499999999998 54-55 19.5 29.425 28.3375 22.7375 56-57 19.675 29.9625 28.299999999999997 22.0625 58-59 19.425 30.4 28.3625 21.8125 60-61 19.950000000000003 31.35 27.3 21.4 62-63 19.162499999999998 31.1 26.5375 23.200000000000003 64-65 20.075000000000003 29.925 27.325 22.675 66-67 19.8625 30.55 27.200000000000003 22.3875 68-69 19.9625 30.9375 26.3125 22.787499999999998 70-71 19.9125 30.4 26.924999999999997 22.7625 72-73 20.962500000000002 29.95 26.787499999999998 22.3 74-75 20.474999999999998 28.1125 27.437499999999996 23.974999999999998 76-77 20.4625 29.375 27.3125 22.85 78-79 20.6125 30.2125 26.575 22.6 80-81 20.3875 29.562500000000004 27.025 23.025000000000002 82-83 21.075 28.975 26.637499999999996 23.3125 84-85 20.625 29.175 27.3125 22.8875 86-87 21.2 28.725 26.6625 23.4125 88-89 20.0875 29.8875 26.787499999999998 23.2375 90-91 19.975 30.55 26.2875 23.1875 92-93 21.8625 29.175 26.5125 22.45 94-95 21.2625 28.5625 27.05 23.125 96-97 20.4875 29.3875 27.0875 23.0375 98-99 20.8875 29.3875 27.325 22.400000000000002 100 21.75 29.625 25.0 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 1.5 20 0.5 21 2.0 22 2.5 23 3.5 24 6.0 25 8.5 26 11.5 27 15.0 28 19.0 29 22.0 30 24.0 31 39.0 32 59.0 33 62.0 34 76.5 35 100.0 36 108.0 37 123.5 38 147.5 39 168.0 40 193.0 41 197.5 42 198.5 43 221.0 44 237.0 45 230.5 46 205.5 47 204.5 48 202.0 49 166.5 50 140.5 51 134.5 52 113.0 53 89.0 54 76.5 55 64.0 56 52.5 57 42.0 58 42.5 59 37.0 60 26.5 61 23.0 62 22.0 63 15.5 64 7.5 65 6.0 66 7.5 67 5.0 68 3.5 69 7.0 70 5.5 71 1.5 72 3.0 73 5.5 74 3.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83810999225406 95.7 2 0.8778724502969274 1.7000000000000002 3 0.20655822359927703 0.6 4 0.02581977794990963 0.1 5 0.02581977794990963 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02581977794990963 1.775 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 71 1.775 Illumina Single End PCR Primer 1 (100% over 50bp) GCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 2.125 0.0 0.0 0.0 0.0 2 2.125 0.0 0.0 0.0 0.0 3 2.125 0.0 0.0 0.0 0.0 4 2.125 0.0 0.0 0.0 0.0 5 2.125 0.0 0.0 0.0 0.0 6 2.125 0.0 0.0 0.0 0.0 7 2.125 0.0 0.0 0.0 0.0 8 2.125 0.0 0.0 0.0 0.0 9 2.125 0.0 0.0 0.0 0.0 10-11 2.125 0.0 0.0 0.0 0.0 12-13 2.15 0.0 0.0 0.0 0.0 14-15 2.15 0.0 0.0 0.0 0.0 16-17 2.15 0.0 0.0 0.0 0.0 18-19 2.175 0.0 0.0 0.0 0.0 20-21 2.225 0.0 0.0 0.0 0.0 22-23 2.25 0.0 0.0 0.0 0.0 24-25 2.2625 0.0 0.0 0.0 0.0 26-27 2.3125 0.0 0.0 0.0 0.0 28-29 2.325 0.0 0.0 0.0 0.0 30-31 2.3375000000000004 0.0 0.0 0.0 0.0 32-33 2.35 0.0 0.0 0.0 0.0 34-35 2.3625 0.0 0.0 0.0 0.0 36-37 2.375 0.0 0.0 0.0 0.0 38-39 2.375 0.0 0.0 0.0 0.0 40-41 2.375 0.0 0.0 0.0 0.0 42-43 2.375 0.0 0.0 0.0 0.0 44-45 2.375 0.0 0.0 0.0 0.0 46-47 2.375 0.0 0.0 0.0 0.0 48-49 2.3875 0.0 0.0 0.0 0.0 50-51 2.4 0.0 0.0 0.0 0.0 52-53 2.4 0.0 0.0 0.0 0.0 54-55 2.4 0.0 0.0 0.0 0.0 56-57 2.4124999999999996 0.0 0.0 0.0 0.0 58-59 2.4375 0.0 0.0 0.0 0.0 60-61 2.475 0.0 0.0 0.0 0.0 62-63 2.5 0.0 0.0 0.0 0.0 64-65 2.5 0.0 0.0 0.0 0.0 66-67 2.5 0.0 0.0 0.0 0.0 68-69 2.5 0.0 0.0 0.0 0.0 70-71 2.5125 0.0 0.0 0.0 0.0 72-73 2.525 0.0 0.0 0.0 0.0 74-75 2.525 0.0 0.0 0.0 0.0 76-77 2.5374999999999996 0.0 0.0 0.0 0.0 78-79 2.5875000000000004 0.0 0.0 0.0 0.0 80-81 2.6 0.0 0.0 0.0 0.0 82-83 2.6 0.0 0.0 0.0 0.0 84-85 2.625 0.0 0.0 0.0 0.0 86-87 2.6875 0.0 0.0 0.0 0.0 88 2.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra Read 5230296 spots for SRR10225139.sra Written 5230296 spots for SRR10225139.sra SRR ids: ['SRR10225139.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wbl9z0gb SRR10225139.sra spots: 104605920 blocks: [[1, 5230296], [5230297, 10460592], [10460593, 15690888], [15690889, 20921184], [20921185, 26151480], [26151481, 31381776], [31381777, 36612072], [36612073, 41842368], [41842369, 47072664], [47072665, 52302960], [52302961, 57533256], [57533257, 62763552], [62763553, 67993848], [67993849, 73224144], [73224145, 78454440], [78454441, 83684736], [83684737, 88915032], [88915033, 94145328], [94145329, 99375624], [99375625, 104605920]] SRR10225139 file size 28612113 SRR10225139 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10225139 SRR10225139_1.fastq SRR10225139_2.fastq Input file: SRR10225139_1.fastq Paired file: SRR10225139_2.fastq trimmed: SRR10225139-trimmed-pair1.fastq, SRR10225139-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:55:19 2025 >> started Tue Feb 11 22:58:14 2025 >> done (174.777s) 104605920 read pairs processed; of these: 715525 ( 0.68%) short read pairs filtered out after trimming by size control 3913864 ( 3.74%) empty read pairs filtered out after trimming by size control 99976531 (95.57%) read pairs available; of these: 13991759 (14.00%) trimmed read pairs available after processing 85984772 (86.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 36653 0.04% 19 22471 0.02% 20 31982 0.03% 21 13958 0.01% 22 8719 0.01% 23 10731 0.01% 24 25203 0.03% 25 27422 0.03% 26 20014 0.02% 27 15142 0.02% 28 9899 0.01% 29 12313 0.01% 30 12796 0.01% 31 8885 0.01% 32 9538 0.01% 33 7034 0.01% 34 5226 0.01% 35 5847 0.01% 36 6211 0.01% 37 6654 0.01% 38 7285 0.01% 39 7860 0.01% 40 9028 0.01% 41 9306 0.01% 42 9722 0.01% 43 11355 0.01% 44 11568 0.01% 45 12571 0.01% 46 12912 0.01% 47 13497 0.01% 48 14719 0.01% 49 15780 0.02% 50 16968 0.02% 51 18413 0.02% 52 19383 0.02% 53 21088 0.02% 54 23072 0.02% 55 26057 0.03% 56 26526 0.03% 57 28745 0.03% 58 30563 0.03% 59 176866 0.18% 60 180762 0.18% 61 105390 0.11% 62 113938 0.11% 63 124209 0.12% 64 124350 0.12% 65 129347 0.13% 66 134670 0.13% 67 141554 0.14% 68 141647 0.14% 69 147426 0.15% 70 150046 0.15% 71 146041 0.15% 72 150186 0.15% 73 158752 0.16% 74 159372 0.16% 75 169982 0.17% 76 181909 0.18% 77 171816 0.17% 78 173554 0.17% 79 178893 0.18% 80 184280 0.18% 81 200076 0.20% 82 204445 0.20% 83 219982 0.22% 84 229693 0.23% 85 233297 0.23% 86 222941 0.22% 87 252522 0.25% 88 262925 0.26% 89 290139 0.29% 90 341551 0.34% 91 505796 0.51% 92 359860 0.36% 93 422657 0.42% 94 435594 0.44% 95 1766500 1.77% 96 566611 0.57% 97 731002 0.73% 98 1027774 1.03% 99 1730288 1.73% 100 85984772 86.00% 99976531 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=24 prefix-density=0.37 prefix-fanout=2.0 sequence=CTGTGATCCATG criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=199.72 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=23.5 sequence=AGAAGAAGAAAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=24 prefix-density=0.21 prefix-fanout=1.9 sequence=CATCTCAGACCTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=845.20 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=29.2 sequence=AAAACAAAAATCAGAGTCAATTGTTTATTTTAAATTCCAAACTTCGCACATCATCTAAAGCCTTGTACTCGTAAACCACAAAATCGAAAAAAAAGCGCCTCAATTCATCATCTCCATGCTTCAGCTTCAAGCTT SRR10225139 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:59:02 Started mapping on | Feb 11 22:59:02 Finished on | Feb 11 23:12:32 Mapping speed, Million of reads per hour | 444.34 Number of input reads | 99976531 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 85925491 Uniquely mapped reads % | 85.95% Average mapped length | 194.85 Number of splices: Total | 37074477 Number of splices: Annotated (sjdb) | 36003942 Number of splices: GT/AG | 36249995 Number of splices: GC/AG | 508906 Number of splices: AT/AC | 52354 Number of splices: Non-canonical | 263222 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.04% Deletion average length | 2.54 Insertion rate per base | 0.03% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3915988 % of reads mapped to multiple loci | 3.92% Number of reads mapped to too many loci | 4518999 % of reads mapped to too many loci | 4.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.25% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 10627974 10627974 10627974 N_multimapping 3915988 3915988 3915988 N_noFeature 3318105 4082712 84431725 N_ambiguous 1371905 631464 15741 UnstrandedReadsAssigned:81235481 PositiveStrandReadsAssigned:81211315 NegativeStrandReadsAssigned:1478025 Dataset is classified positive stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR10225139 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR10225139-trimmed-pair1.fastq SRR10225139-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 99,976,531 reads, 85,163,017 reads pseudoaligned [quant] estimated average fragment length: 252.45 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,347 rounds 52401 SRR10225139.ke.tsv 34699 SRR10225139.se.tsv 87100 total ==> SRR10225139.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.55 11348.7 54.8795 Potri.005G024800.1.v4.1 1035 783.55 1942 21.1725 Potri.004G059700.1.v4.1 961 709.554 1636 19.6965 Potri.007G009000.2.v4.1 1416 1164.55 0 0 Potri.003G141000.2.v4.1 2943 2691.55 2593 8.22982 Potri.016G087400.1.v4.1 270 64.3367 7912.1 1050.57 Potri.015G069301.1.v4.1 564 313.074 0 0 Potri.010G195200.1.v4.1 1773 1521.55 816 4.58136 Potri.012G127500.1.v4.1 977 725.554 27861 328.033 ==> SRR10225139.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 144 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 2754 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 983 SRR10225139 completed mapping pipeline successfully