Starting /dee2/code/volunteer_pipeline.sh SRR10225143 current disk space = 3052348153856 free memory = 1511938492 SRR10225143 SRAfilesize 88da4a9e2b7f28817c9452245e75c5fd SRR10225143.sra SRR10225143.sra file validated SRR10225143 is paired end SRR10225143 is conventional basespace SRR10225143 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10225143_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.837 34.0 33.0 34.0 31.0 34.0 2 33.096 34.0 33.0 34.0 31.0 34.0 3 33.1775 34.0 33.0 34.0 31.0 34.0 4 36.5055 37.0 37.0 37.0 35.0 37.0 5 36.48125 37.0 37.0 37.0 35.0 37.0 6 36.41825 37.0 37.0 37.0 35.0 37.0 7 36.4505 37.0 37.0 37.0 35.0 37.0 8 36.4655 37.0 37.0 37.0 35.0 37.0 9 38.33275 39.0 39.0 39.0 37.0 39.0 10-11 38.28275 39.0 39.0 39.0 37.0 39.0 12-13 38.324125 39.0 39.0 39.0 37.0 39.0 14-15 39.925625 41.0 40.0 41.0 38.0 41.0 16-17 39.774125 41.0 40.0 41.0 37.5 41.0 18-19 39.747625 41.0 40.0 41.0 37.0 41.0 20-21 39.719125000000005 41.0 40.0 41.0 37.0 41.0 22-23 39.6455 41.0 40.0 41.0 37.0 41.0 24-25 39.687375 41.0 40.0 41.0 37.0 41.0 26-27 39.57025 41.0 40.0 41.0 37.0 41.0 28-29 39.40975 41.0 39.5 41.0 36.5 41.0 30-31 39.311875 41.0 39.0 41.0 36.5 41.0 32-33 39.094750000000005 41.0 39.0 41.0 36.0 41.0 34-35 38.967375000000004 40.0 39.0 41.0 35.5 41.0 36-37 38.817875 40.0 38.0 41.0 35.0 41.0 38-39 38.807625 40.0 38.0 41.0 35.0 41.0 40-41 38.60225 40.0 38.0 41.0 35.0 41.0 42-43 38.287 40.0 38.0 41.0 34.0 41.0 44-45 38.609750000000005 40.0 38.0 41.0 35.0 41.0 46-47 38.658874999999995 40.0 38.0 41.0 35.0 41.0 48-49 38.604749999999996 40.5 38.0 41.0 35.0 41.0 50-51 38.501374999999996 40.0 38.0 41.0 34.5 41.0 52-53 38.26675 40.0 37.5 41.0 34.0 41.0 54-55 38.014125 40.0 37.0 41.0 34.0 41.0 56-57 37.80075 40.0 37.0 41.0 33.0 41.0 58-59 37.424 39.0 36.0 41.0 33.0 41.0 60-61 37.229 39.0 35.0 41.0 33.0 41.0 62-63 36.908 39.0 35.0 41.0 32.5 41.0 64-65 36.619375000000005 37.5 35.0 40.0 32.5 41.0 66-67 36.268 37.0 35.0 40.0 32.0 41.0 68-69 35.898624999999996 37.0 35.0 39.0 32.0 41.0 70-71 35.557874999999996 36.0 35.0 39.0 32.0 41.0 72-73 35.168125 36.0 35.0 38.0 32.0 39.5 74-75 34.23025 35.0 35.0 37.0 30.5 39.0 76-77 33.8865 35.0 35.0 37.0 30.5 39.0 78-79 33.607625 35.0 34.0 36.0 30.0 38.0 80-81 33.273624999999996 35.0 34.0 36.0 30.0 37.0 82-83 33.181625 35.0 34.0 35.5 30.0 37.0 84-85 32.98075 35.0 34.0 35.0 30.0 36.0 86-87 32.719875 35.0 34.0 35.0 29.0 36.0 88-89 32.604625 35.0 34.0 35.0 29.0 36.0 90-91 32.4715 35.0 34.0 35.0 29.0 36.0 92-93 32.35225 35.0 34.0 35.0 29.0 35.0 94-95 32.241875 35.0 34.0 35.0 29.0 35.0 96-97 32.063 35.0 34.0 35.0 27.5 35.0 98-99 32.015249999999995 35.0 34.0 35.0 28.0 35.0 100 31.90825 35.0 34.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 4.0 10 1.0 11 4.0 12 7.0 13 5.0 14 2.0 15 3.0 16 4.0 17 8.0 18 2.0 19 4.0 20 11.0 21 11.0 22 9.0 23 8.0 24 13.0 25 15.0 26 18.0 27 27.0 28 40.0 29 52.0 30 37.0 31 44.0 32 73.0 33 86.0 34 147.0 35 218.0 36 398.0 37 991.0 38 1457.0 39 300.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.178706267304307 35.36370500880947 21.64611125094387 12.811477472942363 2 36.0 32.324999999999996 17.025000000000002 14.649999999999999 3 30.25 33.175 22.525000000000002 14.05 4 29.125 29.65 23.425 17.8 5 27.325 30.55 23.075000000000003 19.05 6 28.425 29.075 23.674999999999997 18.825 7 26.325 29.375 24.875 19.425 8 23.549999999999997 30.675 28.1 17.675 9 24.0 30.475 27.35 18.175 10-11 24.837500000000002 30.775000000000002 25.8125 18.575 12-13 24.425 29.1875 26.1125 20.275000000000002 14-15 23.0125 28.875 26.637499999999996 21.475 16-17 24.3125 29.7 25.074999999999996 20.9125 18-19 23.4625 28.675 27.250000000000004 20.6125 20-21 23.4875 29.312500000000004 26.275 20.925 22-23 25.0125 30.1875 26.1625 18.637500000000003 24-25 23.825 28.875 25.275 22.025 26-27 23.175 29.612500000000004 26.575 20.6375 28-29 23.175 29.625 26.0625 21.1375 30-31 24.2375 28.537499999999998 26.974999999999998 20.25 32-33 24.462500000000002 29.0875 25.837500000000002 20.6125 34-35 23.5875 28.3625 26.974999999999998 21.075 36-37 24.8 29.362500000000004 26.075 19.7625 38-39 23.849999999999998 28.3125 26.4625 21.375 40-41 24.3625 29.875 26.150000000000002 19.6125 42-43 23.6875 27.3875 27.35 21.575 44-45 23.4375 28.037499999999998 26.337500000000002 22.1875 46-47 23.799999999999997 28.4 27.8125 19.9875 48-49 23.225 28.075 28.1 20.599999999999998 50-51 23.8875 28.3125 26.400000000000002 21.4 52-53 25.55 27.175 25.912499999999998 21.3625 54-55 24.0375 27.6375 26.6625 21.6625 56-57 23.775 26.724999999999998 28.7 20.8 58-59 23.849999999999998 27.5625 27.500000000000004 21.087500000000002 60-61 23.9125 27.0875 27.650000000000002 21.349999999999998 62-63 23.2875 28.037499999999998 28.999999999999996 19.675 64-65 24.6625 28.0625 26.6 20.674999999999997 66-67 23.6375 29.299999999999997 27.037499999999998 20.025000000000002 68-69 23.2875 28.825 26.775 21.1125 70-71 23.1125 29.7875 26.7625 20.3375 72-73 23.849999999999998 29.475 26.9125 19.7625 74-75 24.6 29.1125 26.3125 19.975 76-77 24.2375 28.999999999999996 26.3125 20.45 78-79 24.25 27.3125 27.200000000000003 21.2375 80-81 24.825 27.875 26.987499999999997 20.3125 82-83 25.2375 28.575 26.5625 19.625 84-85 23.674999999999997 28.799999999999997 27.462500000000002 20.0625 86-87 24.975 28.7375 26.375 19.9125 88-89 24.7875 27.150000000000002 26.400000000000002 21.6625 90-91 24.3625 29.049999999999997 26.937499999999996 19.650000000000002 92-93 24.2625 27.825 27.6 20.3125 94-95 24.75 28.025 26.687499999999996 20.5375 96-97 24.1875 28.275 26.450000000000003 21.087500000000002 98-99 24.2375 27.037499999999998 27.962500000000002 20.7625 100 24.325 28.449999999999996 27.1 20.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 1.0 4 1.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 1.0 14 3.0 15 3.5 16 3.0 17 3.0 18 5.0 19 5.0 20 5.5 21 5.0 22 3.0 23 8.0 24 7.0 25 4.5 26 7.0 27 8.0 28 9.5 29 15.0 30 18.5 31 19.0 32 26.0 33 40.5 34 50.0 35 53.0 36 72.0 37 105.0 38 132.0 39 145.5 40 161.5 41 204.0 42 232.5 43 238.0 44 245.0 45 260.0 46 254.5 47 231.0 48 218.0 49 195.5 50 164.5 51 140.5 52 114.0 53 105.5 54 93.5 55 64.5 56 47.5 57 42.0 58 43.0 59 34.5 60 28.5 61 20.5 62 17.0 63 14.5 64 9.0 65 6.5 66 6.5 67 5.0 68 3.0 69 7.0 70 6.5 71 3.5 72 5.5 73 3.5 74 1.5 75 2.0 76 1.5 77 1.5 78 2.0 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.06282722513089 93.65 2 1.4659685863874345 2.8000000000000003 3 0.20942408376963353 0.6 4 0.10471204188481677 0.4 5 0.026178010471204192 0.125 6 0.052356020942408384 0.3 7 0.0 0.0 8 0.0 0.0 9 0.026178010471204192 0.22499999999999998 >10 0.026178010471204192 0.5499999999999999 >50 0.026178010471204192 1.35 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATG 54 1.35 TruSeq Adapter, Index 4 (100% over 49bp) CAACACGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTG 22 0.5499999999999999 No Hit CTCTTAGTACTGCACCATCTCATCGTCATGTGATCCTTTTGCTCCTCCCT 9 0.22499999999999998 No Hit TACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCC 6 0.15 No Hit GAATGCATTGGATGGATGCCCGGGCATTGAGAAGGAAGGACGCTTTCAAA 6 0.15 No Hit CTTAGTACTGCACCATCTCATCGTCATGTGATCCTTTTGCTCCTCCCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 1.875 0.0 0.0 0.0 0.0 2 1.875 0.0 0.0 0.0 0.0 3 1.875 0.0 0.0 0.0 0.0 4 1.875 0.0 0.0 0.0 0.0 5 1.875 0.0 0.0 0.0 0.0 6 1.875 0.0 0.0 0.0 0.0 7 1.875 0.0 0.0 0.0 0.0 8 1.875 0.0 0.0 0.0 0.0 9 1.875 0.0 0.0 0.0 0.0 10-11 1.875 0.0 0.0 0.0 0.0 12-13 1.875 0.0 0.0 0.0 0.0 14-15 1.9125 0.0 0.0 0.0 0.0 16-17 1.925 0.0 0.0 0.0 0.0 18-19 1.925 0.0 0.0 0.0 0.0 20-21 1.925 0.0 0.0 0.0 0.0 22-23 1.925 0.0 0.0 0.0 0.0 24-25 1.925 0.0 0.0 0.0 0.0 26-27 1.9375 0.0 0.0 0.0 0.0 28-29 1.9625 0.0 0.0 0.0 0.0 30-31 1.975 0.0 0.0 0.0 0.0 32-33 1.975 0.0 0.0 0.0 0.0 34-35 1.975 0.0 0.0 0.0 0.0 36-37 1.975 0.0 0.0 0.0 0.0 38-39 1.975 0.0 0.0 0.0 0.0 40-41 1.975 0.0 0.0 0.0 0.0 42-43 1.975 0.0 0.0 0.0 0.0 44-45 1.975 0.0 0.0 0.0 0.0 46-47 1.975 0.0 0.0 0.0 0.0 48-49 1.975 0.0 0.0 0.0 0.0 50-51 1.975 0.0 0.0 0.0 0.0 52-53 1.975 0.0 0.0 0.0 0.0 54-55 2.0 0.0 0.0 0.0 0.0 56-57 2.0 0.0 0.0 0.0 0.0 58-59 2.0 0.0 0.0 0.0 0.0 60-61 2.0 0.0 0.0 0.0 0.0 62-63 2.0 0.0 0.0 0.0 0.0 64-65 2.025 0.0 0.0 0.0 0.0 66-67 2.025 0.0 0.0 0.0 0.0 68-69 2.0374999999999996 0.0 0.0 0.0 0.0 70-71 2.05 0.0 0.0 0.0 0.0 72-73 2.05 0.0 0.0 0.0 0.0 74-75 2.0875000000000004 0.0 0.0 0.0 0.0 76-77 2.1 0.0 0.0 0.0 0.0 78-79 2.175 0.0 0.0 0.0 0.0 80-81 2.1875 0.0 0.0 0.0 0.0 82-83 2.25 0.0 0.0 0.0 0.0 84-85 2.25 0.0 0.0 0.0 0.0 86-87 2.2625 0.0 0.0 0.0 0.0 88 2.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATCGG 15 6.0909643E-4 95.17722 1 GATCGGA 15 6.409497E-4 93.9875 2 GAAGAGC 15 6.409497E-4 93.9875 7 CGGAAGA 15 6.409497E-4 93.9875 5 ATCGGAA 15 6.409497E-4 93.9875 3 AAGAGCA 20 0.002009417 70.49062 8 TCGGAAG 20 0.002009417 70.49062 4 GGAAGAG 20 0.002009417 70.49062 6 AGAGCAC 25 0.004866334 56.392498 9 >>END_MODULE SRR10225143 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10225143_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.35575 34.0 31.0 34.0 31.0 34.0 2 32.58625 34.0 31.0 34.0 31.0 34.0 3 32.577 34.0 31.0 34.0 31.0 34.0 4 35.92625 37.0 37.0 37.0 35.0 37.0 5 35.861 37.0 37.0 37.0 35.0 37.0 6 35.7825 37.0 37.0 37.0 35.0 37.0 7 35.77525 37.0 37.0 37.0 35.0 37.0 8 35.8085 37.0 37.0 37.0 35.0 37.0 9 37.60225 39.0 39.0 39.0 35.0 39.0 10-11 37.55575 39.0 39.0 39.0 35.0 39.0 12-13 37.538624999999996 39.0 39.0 39.0 35.0 39.0 14-15 39.0305 41.0 40.0 41.0 36.0 41.0 16-17 39.016375 41.0 40.0 41.0 36.0 41.0 18-19 38.8845 41.0 39.5 41.0 36.0 41.0 20-21 38.812875000000005 41.0 39.5 41.0 36.0 41.0 22-23 38.642125 41.0 39.0 41.0 35.0 41.0 24-25 38.60825 41.0 39.0 41.0 35.0 41.0 26-27 38.418 41.0 39.0 41.0 34.5 41.0 28-29 38.312125 40.5 39.0 41.0 34.0 41.0 30-31 38.186499999999995 40.0 38.5 41.0 33.5 41.0 32-33 38.0895 40.0 38.0 41.0 33.5 41.0 34-35 37.919624999999996 40.0 38.0 41.0 33.0 41.0 36-37 37.799875 40.0 38.0 41.0 33.0 41.0 38-39 37.80525 40.0 38.0 41.0 33.0 41.0 40-41 37.840875 40.0 38.0 41.0 33.0 41.0 42-43 37.613125 40.0 38.0 41.0 33.0 41.0 44-45 37.661249999999995 40.0 38.0 41.0 33.0 41.0 46-47 37.866125 40.0 38.0 41.0 33.0 41.0 48-49 37.74525 40.5 38.0 41.0 33.0 41.0 50-51 37.6025 40.0 37.5 41.0 33.0 41.0 52-53 37.466499999999996 40.0 37.0 41.0 33.0 41.0 54-55 37.230375 40.0 37.0 41.0 32.5 41.0 56-57 36.98625 40.0 36.0 41.0 31.5 41.0 58-59 36.80425 39.5 36.0 41.0 32.0 41.0 60-61 36.597375 39.0 35.0 41.0 32.0 41.0 62-63 36.2855 39.0 35.0 41.0 31.5 41.0 64-65 35.745000000000005 38.0 35.0 40.5 30.5 41.0 66-67 35.160375 37.0 35.0 40.0 29.0 41.0 68-69 34.69075 37.0 35.0 39.5 29.0 41.0 70-71 34.313125 36.0 35.0 39.0 28.5 41.0 72-73 33.825874999999996 36.0 34.5 39.0 27.0 40.5 74-75 33.473625 35.0 34.0 37.5 26.5 39.5 76-77 33.167 35.0 34.0 37.0 26.5 39.0 78-79 32.968625 35.0 34.0 37.0 27.5 39.0 80-81 32.6395 35.0 34.0 36.0 27.0 37.5 82-83 32.299 35.0 34.0 36.0 25.5 37.0 84-85 31.993625 35.0 34.0 35.0 25.0 37.0 86-87 31.79 35.0 33.5 35.0 25.0 36.0 88-89 31.6305 35.0 33.5 35.0 25.0 36.0 90-91 31.448 35.0 33.0 35.0 25.0 36.0 92-93 31.24775 35.0 33.0 35.0 23.5 35.5 94-95 31.1045 35.0 33.0 35.0 21.5 35.0 96-97 30.95525 35.0 33.0 35.0 20.0 35.0 98-99 30.799374999999998 35.0 33.0 35.0 18.0 35.0 100 30.72625 35.0 33.0 35.0 18.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 16.0 4 2.0 5 2.0 6 3.0 7 14.0 8 3.0 9 7.0 10 7.0 11 6.0 12 2.0 13 1.0 14 6.0 15 9.0 16 7.0 17 5.0 18 7.0 19 4.0 20 15.0 21 18.0 22 21.0 23 19.0 24 32.0 25 38.0 26 35.0 27 26.0 28 30.0 29 26.0 30 50.0 31 48.0 32 71.0 33 86.0 34 135.0 35 188.0 36 350.0 37 828.0 38 1451.0 39 398.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.1 15.2 15.4 30.3 2 28.325 7.025 20.150000000000002 44.5 3 18.224999999999998 7.725 20.200000000000003 53.849999999999994 4 21.4 6.575 21.275 50.74999999999999 5 24.0 9.700000000000001 22.6 43.7 6 30.38259564891223 12.878219554888723 27.881970492623154 28.857214303575894 7 19.275000000000002 27.224999999999998 34.5 19.0 8 15.825 30.7 34.325 19.15 9 15.375 32.475 31.95 20.200000000000003 10-11 17.95 30.587500000000002 31.15 20.3125 12-13 17.95 28.537499999999998 31.35 22.162499999999998 14-15 17.75 28.212500000000002 31.587500000000002 22.45 16-17 18.5375 28.487499999999997 30.1375 22.8375 18-19 19.075 28.925 30.1875 21.8125 20-21 17.474999999999998 30.425 29.862499999999997 22.237499999999997 22-23 20.7125 29.012500000000003 28.1125 22.162499999999998 24-25 19.375 30.075000000000003 28.487499999999997 22.0625 26-27 18.35 30.887500000000003 28.812500000000004 21.95 28-29 19.7 30.2125 28.225 21.8625 30-31 18.55 28.925 28.775000000000002 23.75 32-33 18.875 28.325 29.362500000000004 23.4375 34-35 20.325 28.1125 28.325 23.2375 36-37 18.2 29.475 29.6375 22.6875 38-39 18.212500000000002 28.6125 30.362499999999997 22.8125 40-41 20.4 28.262500000000003 28.425 22.912499999999998 42-43 19.75 29.4375 28.199999999999996 22.6125 44-45 20.525 29.625 28.15 21.7 46-47 18.25 28.487499999999997 28.825 24.4375 48-49 20.5625 28.237499999999997 28.4 22.8 50-51 19.950000000000003 30.275000000000002 26.950000000000003 22.825 52-53 18.8125 29.912499999999998 27.900000000000002 23.375 54-55 18.8875 29.575000000000003 28.299999999999997 23.2375 56-57 18.2375 30.0 28.787499999999998 22.975 58-59 19.0625 30.4 27.6 22.9375 60-61 19.2 30.587500000000002 26.3125 23.9 62-63 19.537499999999998 29.7375 26.875 23.849999999999998 64-65 20.025000000000002 30.0875 26.4125 23.474999999999998 66-67 18.1625 29.65 28.375 23.8125 68-69 18.5375 30.15 27.900000000000002 23.4125 70-71 18.337500000000002 29.0875 28.9125 23.6625 72-73 20.125 29.6875 26.950000000000003 23.2375 74-75 19.75 29.262500000000003 27.212500000000002 23.775 76-77 19.8625 28.8875 27.737499999999997 23.5125 78-79 20.3875 29.6875 26.5375 23.3875 80-81 19.275000000000002 29.099999999999998 27.825 23.799999999999997 82-83 19.7125 29.312500000000004 26.875 24.099999999999998 84-85 19.15 30.175 26.8375 23.8375 86-87 19.9625 29.049999999999997 26.787499999999998 24.2 88-89 19.375 29.3375 27.0875 24.2 90-91 19.4875 28.825 28.6875 23.0 92-93 20.625 28.349999999999998 27.175 23.849999999999998 94-95 20.9 28.299999999999997 26.937499999999996 23.8625 96-97 20.5375 28.237499999999997 27.224999999999998 24.0 98-99 20.3625 28.537499999999998 27.525 23.575 100 20.349999999999998 29.225 26.325 24.099999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 2.0 14 2.5 15 3.0 16 4.5 17 4.5 18 4.5 19 6.5 20 8.5 21 7.0 22 5.5 23 7.0 24 10.0 25 12.5 26 14.0 27 17.0 28 19.5 29 26.0 30 37.0 31 44.5 32 49.5 33 63.5 34 85.0 35 96.0 36 113.0 37 130.5 38 132.5 39 154.5 40 179.5 41 197.0 42 215.0 43 206.5 44 200.5 45 216.0 46 210.0 47 183.5 48 183.5 49 174.5 50 142.5 51 121.0 52 96.0 53 80.0 54 69.5 55 55.5 56 50.0 57 56.0 58 62.0 59 50.0 60 38.5 61 33.5 62 23.5 63 15.0 64 13.0 65 16.5 66 12.5 67 5.5 68 4.5 69 4.0 70 3.5 71 3.0 72 4.0 73 6.0 74 4.5 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.11334745762711 91.675 2 2.1451271186440675 4.05 3 0.3707627118644068 1.05 4 0.1853813559322034 0.7000000000000001 5 0.0 0.0 6 0.13241525423728812 0.75 7 0.026483050847457626 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026483050847457626 1.6 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 64 1.6 Illumina Single End PCR Primer 1 (100% over 50bp) CCCTTTCAACAATTTCACGTACTGTTTAACTCTCTTTTCAAAGTTCTTTT 7 0.17500000000000002 No Hit GCCCCCAACTATCCCTATTAATCATTACGTCAATCCTAGAAACCAACAAA 6 0.15 No Hit GCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTT 6 0.15 No Hit CCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGG 6 0.15 No Hit GCCCTATAAGAGAAACCGCCCTCAAGAAGGCGATTCAGTTTCAACAGCCA 6 0.15 No Hit TGCCCTATAAGAGAAACCGCCCTCAAGAAGGCGATTCAGTTTCAACAGCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 1.775 0.0 0.0 0.0 0.0 2 1.775 0.0 0.0 0.0 0.0 3 1.775 0.0 0.0 0.0 0.0 4 1.775 0.0 0.0 0.0 0.0 5 1.775 0.0 0.0 0.0 0.0 6 1.775 0.0 0.0 0.0 0.0 7 1.775 0.0 0.0 0.0 0.0 8 1.775 0.0 0.0 0.0 0.0 9 1.775 0.0 0.0 0.0 0.0 10-11 1.7875 0.0 0.0 0.0 0.0 12-13 1.8125 0.0 0.0 0.0 0.0 14-15 1.8625 0.0 0.0 0.0 0.0 16-17 1.8875 0.0 0.0 0.0 0.0 18-19 1.9375 0.0 0.0 0.0 0.0 20-21 1.95 0.0 0.0 0.0 0.0 22-23 1.95 0.0 0.0 0.0 0.0 24-25 1.95 0.0 0.0 0.0 0.0 26-27 1.9875 0.0 0.0 0.0 0.0 28-29 2.0 0.0 0.0 0.0 0.0 30-31 2.0 0.0 0.0 0.0 0.0 32-33 2.0 0.0 0.0 0.0 0.0 34-35 2.0 0.0 0.0 0.0 0.0 36-37 2.0 0.0 0.0 0.0 0.0 38-39 2.0 0.0 0.0 0.0 0.0 40-41 2.0 0.0 0.0 0.0 0.0 42-43 2.0 0.0 0.0 0.0 0.0 44-45 2.0 0.0 0.0 0.0 0.0 46-47 2.0 0.0 0.0 0.0 0.0 48-49 2.0 0.0 0.0 0.0 0.0 50-51 2.0 0.0 0.0 0.0 0.0 52-53 2.0 0.0 0.0 0.0 0.0 54-55 2.025 0.0 0.0 0.0 0.0 56-57 2.025 0.0 0.0 0.0 0.0 58-59 2.025 0.0 0.0 0.0 0.0 60-61 2.025 0.0 0.0 0.0 0.0 62-63 2.025 0.0 0.0 0.0 0.0 64-65 2.05 0.0 0.0 0.0 0.0 66-67 2.05 0.0 0.0 0.0 0.0 68-69 2.0625 0.0 0.0 0.0 0.0 70-71 2.075 0.0 0.0 0.0 0.0 72-73 2.075 0.0 0.0 0.0 0.0 74-75 2.1125 0.0 0.0 0.0 0.0 76-77 2.125 0.0 0.0 0.0 0.0 78-79 2.1875 0.0 0.0 0.0 0.0 80-81 2.2125000000000004 0.0 0.0 0.0 0.0 82-83 2.275 0.0 0.0 0.0 0.0 84-85 2.275 0.0 0.0 0.0 0.0 86-87 2.2874999999999996 0.0 0.0 0.0 0.0 88 2.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCGGA 15 6.4061093E-4 94.0 2 GAAGAGC 15 6.4061093E-4 94.0 7 TCGGAAG 15 6.4061093E-4 94.0 4 CGGAAGA 15 6.4061093E-4 94.0 5 AGAGCGT 15 6.4061093E-4 94.0 9 ATCGGAA 15 6.4061093E-4 94.0 3 GGAAGAG 15 6.4061093E-4 94.0 6 AGATCGG 15 6.4061093E-4 94.0 1 AAGAGCG 20 0.0020083564 70.5 8 >>END_MODULE Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975978 spots for SRR10225143.sra Written 3975978 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra Read 3975962 spots for SRR10225143.sra Written 3975962 spots for SRR10225143.sra SRR ids: ['SRR10225143.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wrfbw_2f SRR10225143.sra spots: 79519256 blocks: [[1, 3975962], [3975963, 7951924], [7951925, 11927886], [11927887, 15903848], [15903849, 19879810], [19879811, 23855772], [23855773, 27831734], [27831735, 31807696], [31807697, 35783658], [35783659, 39759620], [39759621, 43735582], [43735583, 47711544], [47711545, 51687506], [51687507, 55663468], [55663469, 59639430], [59639431, 63615392], [63615393, 67591354], [67591355, 71567316], [71567317, 75543278], [75543279, 79519256]] SRR10225143 file size 21744433 SRR10225143 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10225143 SRR10225143_1.fastq SRR10225143_2.fastq Input file: SRR10225143_1.fastq Paired file: SRR10225143_2.fastq trimmed: SRR10225143-trimmed-pair1.fastq, SRR10225143-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:41:59 2025 >> started Tue Feb 11 23:43:13 2025 >> done (73.838s) 79519256 read pairs processed; of these: 464990 ( 0.58%) short read pairs filtered out after trimming by size control 2250499 ( 2.83%) empty read pairs filtered out after trimming by size control 76803767 (96.59%) read pairs available; of these: 10475519 (13.64%) trimmed read pairs available after processing 66328248 (86.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19012 0.02% 19 11279 0.01% 20 15126 0.02% 21 6690 0.01% 22 4289 0.01% 23 4924 0.01% 24 11199 0.01% 25 11918 0.02% 26 9403 0.01% 27 6929 0.01% 28 4818 0.01% 29 5814 0.01% 30 6042 0.01% 31 4796 0.01% 32 5044 0.01% 33 4119 0.01% 34 3525 0.00% 35 3922 0.01% 36 4006 0.01% 37 4525 0.01% 38 4858 0.01% 39 5358 0.01% 40 6018 0.01% 41 6246 0.01% 42 6647 0.01% 43 7527 0.01% 44 7710 0.01% 45 8144 0.01% 46 8698 0.01% 47 9223 0.01% 48 9898 0.01% 49 10711 0.01% 50 11787 0.02% 51 12626 0.02% 52 13390 0.02% 53 14466 0.02% 54 15646 0.02% 55 18025 0.02% 56 18360 0.02% 57 20016 0.03% 58 21513 0.03% 59 113270 0.15% 60 122259 0.16% 61 80201 0.10% 62 85477 0.11% 63 90562 0.12% 64 92517 0.12% 65 98321 0.13% 66 107362 0.14% 67 110040 0.14% 68 106518 0.14% 69 110751 0.14% 70 112172 0.15% 71 108402 0.14% 72 112576 0.15% 73 128204 0.17% 74 126561 0.16% 75 123471 0.16% 76 132374 0.17% 77 128102 0.17% 78 128129 0.17% 79 129360 0.17% 80 136161 0.18% 81 147225 0.19% 82 154880 0.20% 83 168170 0.22% 84 172057 0.22% 85 172067 0.22% 86 162941 0.21% 87 183383 0.24% 88 194059 0.25% 89 212467 0.28% 90 250717 0.33% 91 379167 0.49% 92 263868 0.34% 93 316173 0.41% 94 328472 0.43% 95 1395344 1.82% 96 436302 0.57% 97 550465 0.72% 98 784870 1.02% 99 1335855 1.74% 100 66328248 86.36% 76803767 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=25 prefix-density=0.94 prefix-fanout=2.0 sequence=GATTCCCCTAGTAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=16.55 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.8 sequence=GATGATGGGAATGTGGGGACAGCAAAGCATTTTGAGTACATGTTTTATATTGATTTTGAAGCATCCATGGCTGAGGTTAGAGCACAGAATGCATTGGATGGATGCCCGGGCATTGAGAAGGAAGGACGCTTTCAAAGGCGAAAGGCCATGGGGAGATACCGTCTGTGATCCATGGATCTCCGATCGGGAAACCGTCTCCAAGCTCCGTGGCGAGTCTGCG criterion=sequence-density sequence-density=1.72 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=20 prefix-density=1.80 prefix-fanout=2.1 sequence=GCTATCGGTCTCTCGCC criterion=fanout-score sequence-density=0.14 sequence-density-rank=15 fanout-score=95.18 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=21.5 sequence=CTTCTTCTTTTT SRR10225143 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:43:49 Started mapping on | Feb 11 23:43:49 Finished on | Feb 11 23:54:45 Mapping speed, Million of reads per hour | 421.48 Number of input reads | 76803767 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 59822981 Uniquely mapped reads % | 77.89% Average mapped length | 195.05 Number of splices: Total | 20380234 Number of splices: Annotated (sjdb) | 19766791 Number of splices: GT/AG | 19943989 Number of splices: GC/AG | 266763 Number of splices: AT/AC | 27036 Number of splices: Non-canonical | 142446 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.04% Deletion average length | 2.45 Insertion rate per base | 0.03% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2688135 % of reads mapped to multiple loci | 3.50% Number of reads mapped to too many loci | 5004205 % of reads mapped to too many loci | 6.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.80% % of reads unmapped: other | 1.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 14606321 14606321 14606321 N_multimapping 2688135 2688135 2688135 N_noFeature 3095209 3753293 58678162 N_ambiguous 935443 441433 14109 UnstrandedReadsAssigned:55792329 PositiveStrandReadsAssigned:55628255 NegativeStrandReadsAssigned:1130710 Dataset is classified positive stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR10225143 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR10225143-trimmed-pair1.fastq SRR10225143-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 76,803,767 reads, 60,009,187 reads pseudoaligned [quant] estimated average fragment length: 245.425 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR10225143.ke.tsv 34699 SRR10225143.se.tsv 87100 total ==> SRR10225143.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.57 15434.6 93.3396 Potri.005G024800.1.v4.1 1035 790.575 7863 106.676 Potri.004G059700.1.v4.1 961 716.579 588 8.80105 Potri.007G009000.2.v4.1 1416 1171.57 0 0 Potri.003G141000.2.v4.1 2943 2698.57 1771 7.0389 Potri.016G087400.1.v4.1 270 65.4148 3566.37 584.752 Potri.015G069301.1.v4.1 564 319.923 0 0 Potri.010G195200.1.v4.1 1773 1528.57 57 0.399953 Potri.012G127500.1.v4.1 977 732.575 6653 97.4061 ==> SRR10225143.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 542 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 31 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 468 SRR10225143 completed mapping pipeline successfully