Starting /dee2/code/volunteer_pipeline.sh SRR1030352 current disk space = 3058745389056 free memory = 1545813788 SRR1030352 SRAfilesize 5cd499cc29e3e383c38f8b710349b9a2 SRR1030352.sra SRR1030352.sra file validated SRR1030352 is paired end SRR1030352 is conventional basespace SRR1030352 read1 length is 90 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1030352_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 90 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.16375 39.0 33.0 39.0 2.0 39.0 2 34.116 39.0 33.0 39.0 21.0 39.0 3 34.08075 39.0 33.0 39.0 21.0 39.0 4 33.97175 39.0 32.0 39.0 21.0 39.0 5 33.8625 39.0 32.0 39.0 20.0 39.0 6 34.8965 39.0 33.0 39.0 24.0 39.0 7 34.914 39.0 33.0 39.0 24.0 39.0 8 34.866 39.0 33.0 39.0 24.0 39.0 9 34.83175 39.0 32.0 39.0 24.0 39.0 10-11 35.823125000000005 39.0 34.0 39.0 29.0 39.0 12-13 36.81175 39.0 35.0 39.0 33.5 39.0 14-15 36.719750000000005 39.0 35.0 39.0 33.0 39.0 16-17 36.596 39.0 35.0 39.0 33.0 39.0 18-19 36.484625 39.0 35.0 39.0 31.5 39.0 20-21 36.363625 39.0 35.0 39.0 31.0 39.0 22-23 36.38575 39.0 35.0 39.0 31.0 39.0 24-25 36.25975 38.0 35.0 39.0 31.0 39.0 26-27 36.186 38.0 35.0 39.0 31.0 39.0 28-29 36.080749999999995 38.0 35.0 39.0 31.0 39.0 30-31 35.903125 38.0 35.0 39.0 31.0 39.0 32-33 35.69 38.0 35.0 39.0 30.0 39.0 34-35 35.5405 38.0 35.0 39.0 29.5 39.0 36-37 35.461124999999996 38.0 35.0 39.0 29.5 39.0 38-39 35.472624999999994 37.5 35.0 39.0 29.0 39.0 40-41 35.7335 38.0 35.0 39.0 30.5 39.0 42-43 35.7385 38.0 35.0 39.0 31.0 39.0 44-45 35.674625 38.0 35.0 39.0 30.5 39.0 46-47 35.6035 38.0 35.0 39.0 30.5 39.0 48-49 35.477000000000004 37.0 35.0 39.0 30.0 39.0 50-51 35.210875 37.0 35.0 39.0 29.5 39.0 52-53 34.95425 37.0 35.0 39.0 28.0 39.0 54-55 34.789500000000004 37.0 35.0 39.0 28.5 39.0 56-57 34.684375 37.0 35.0 39.0 27.5 39.0 58-59 34.6065 37.0 35.0 39.0 28.0 39.0 60-61 34.448750000000004 37.0 34.5 39.0 27.5 39.0 62-63 34.206375 36.5 34.0 39.0 27.0 39.0 64-65 34.019875 36.0 34.0 39.0 27.0 39.0 66-67 33.76325 36.0 33.5 39.0 26.0 39.0 68-69 33.451 36.0 33.0 39.0 25.5 39.0 70-71 33.093625 36.0 31.5 39.0 25.0 39.0 72-73 32.544375 35.5 31.0 38.5 23.0 39.0 74-75 32.128125 35.0 31.0 37.5 21.5 39.0 76-77 32.610875 36.0 31.0 39.0 22.0 39.0 78-79 32.361125 36.0 31.0 39.0 21.0 39.0 80-81 32.43075 36.0 31.5 39.0 21.0 39.0 82-83 32.476375000000004 36.0 31.0 39.0 21.0 39.0 84-85 32.10275 36.0 31.0 39.0 19.5 39.0 86-87 31.580875 36.0 30.5 39.0 2.0 39.0 88-89 31.267625000000002 35.0 30.0 39.0 2.0 39.0 90 30.93975 35.0 30.0 39.0 2.0 39.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 0.0 4 2.0 5 2.0 6 2.0 7 4.0 8 0.0 9 4.0 10 3.0 11 3.0 12 10.0 13 7.0 14 7.0 15 9.0 16 7.0 17 13.0 18 18.0 19 13.0 20 17.0 21 18.0 22 24.0 23 30.0 24 38.0 25 42.0 26 46.0 27 69.0 28 74.0 29 97.0 30 160.0 31 214.0 32 268.0 33 182.0 34 129.0 35 176.0 36 312.0 37 534.0 38 1451.0 39 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.38223938223938 10.907335907335908 12.87001287001287 36.84041184041184 2 28.225 17.349999999999998 30.7 23.724999999999998 3 24.325 17.9 26.1 31.674999999999997 4 27.175 21.6 25.2 26.025 5 26.525 24.175 28.775000000000002 20.525 6 23.25 31.275 25.1 20.375 7 18.8 21.425 38.775 21.0 8 20.025000000000002 25.724999999999998 31.2 23.05 9 21.75 25.025 31.65 21.575 10-11 22.237499999999997 32.25 25.2125 20.3 12-13 21.4375 27.6875 28.999999999999996 21.875 14-15 21.75 28.262500000000003 28.799999999999997 21.1875 16-17 21.675 28.000000000000004 28.7375 21.587500000000002 18-19 21.55 29.2375 28.15 21.0625 20-21 22.8375 27.975 27.712500000000002 21.475 22-23 21.675 27.425 27.950000000000003 22.95 24-25 22.5625 28.000000000000004 26.950000000000003 22.4875 26-27 21.3875 29.549999999999997 26.987499999999997 22.075 28-29 22.6125 27.9125 27.3875 22.0875 30-31 22.575 28.012500000000003 27.462500000000002 21.95 32-33 22.287499999999998 28.6375 26.687499999999996 22.3875 34-35 22.35 28.025 27.212500000000002 22.412499999999998 36-37 22.2125 27.650000000000002 27.800000000000004 22.3375 38-39 22.3625 27.6875 28.0875 21.8625 40-41 22.3875 27.212500000000002 28.075 22.325 42-43 21.45 29.125 27.0 22.425 44-45 22.787499999999998 28.349999999999998 26.8625 22.0 46-47 22.112499999999997 27.35 28.1 22.4375 48-49 21.425 28.95 27.125 22.5 50-51 22.7625 28.249999999999996 27.487499999999997 21.5 52-53 22.15 28.962500000000002 26.237500000000004 22.650000000000002 54-55 22.0875 28.5625 27.5625 21.7875 56-57 22.7125 28.462500000000002 27.0 21.825 58-59 22.650000000000002 27.200000000000003 27.075 23.075000000000003 60-61 21.987499999999997 28.375 26.9125 22.725 62-63 23.3375 28.275 26.1 22.287499999999998 64-65 22.650000000000002 28.199999999999996 26.85 22.3 66-67 22.825 27.474999999999998 27.5875 22.112499999999997 68-69 23.3 27.462500000000002 27.200000000000003 22.037499999999998 70-71 22.8125 28.5625 26.775 21.85 72-73 22.0 28.000000000000004 27.925 22.075 74-75 21.337500000000002 28.6375 27.175 22.85 76-77 23.2125 28.125 27.275 21.3875 78-79 22.15 28.925 26.450000000000003 22.475 80-81 22.425 27.925 27.1125 22.537499999999998 82-83 23.1 27.6875 26.575 22.6375 84-85 22.662499999999998 27.875 27.875 21.587500000000002 86-87 23.525 27.325 27.3125 21.837500000000002 88-89 22.7125 27.5125 27.650000000000002 22.125 90 21.925 28.299999999999997 26.85 22.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 3.5 26 5.0 27 5.0 28 9.0 29 18.0 30 23.0 31 25.5 32 34.0 33 49.0 34 66.5 35 82.0 36 98.5 37 123.5 38 155.0 39 182.5 40 194.0 41 215.0 42 258.5 43 283.5 44 286.0 45 282.0 46 292.5 47 278.0 48 235.0 49 204.5 50 188.0 51 178.0 52 143.0 53 120.0 54 100.5 55 72.5 56 56.0 57 39.5 58 25.5 59 14.5 60 11.0 61 13.5 62 12.0 63 6.5 64 5.0 65 4.0 66 4.5 67 4.0 68 2.0 69 1.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 22.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 90 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3188698284561 98.425 2 0.5045408678102926 1.0 3 0.12613521695257315 0.375 4 0.050454086781029264 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0125 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR1030352 read2 length is 90 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1030352_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 90 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.666 39.0 36.0 39.0 23.0 39.0 2 36.5805 39.0 37.0 39.0 29.0 39.0 3 36.61525 39.0 37.0 39.0 30.0 39.0 4 36.51925 39.0 37.0 39.0 30.0 39.0 5 36.403 39.0 37.0 39.0 29.0 39.0 6 36.879 39.0 37.0 39.0 31.0 39.0 7 36.80775 39.0 37.0 39.0 31.0 39.0 8 36.80325 39.0 37.0 39.0 31.0 39.0 9 36.78475 39.0 37.0 39.0 30.0 39.0 10-11 37.002625 39.0 37.0 39.0 32.5 39.0 12-13 37.230875 39.0 37.0 39.0 34.0 39.0 14-15 37.24725 39.0 37.0 39.0 34.5 39.0 16-17 37.1245 39.0 37.0 39.0 34.0 39.0 18-19 37.032624999999996 39.0 37.0 39.0 33.0 39.0 20-21 36.974875 39.0 36.5 39.0 33.0 39.0 22-23 36.820875 39.0 36.0 39.0 33.0 39.0 24-25 36.769999999999996 39.0 36.0 39.0 33.0 39.0 26-27 36.53425 39.0 36.0 39.0 32.0 39.0 28-29 36.488875 39.0 36.0 39.0 31.5 39.0 30-31 36.339875 39.0 36.0 39.0 31.5 39.0 32-33 36.014624999999995 38.0 35.5 39.0 31.0 39.0 34-35 35.992625000000004 38.0 35.0 39.0 31.0 39.0 36-37 35.858125 38.0 35.0 39.0 30.0 39.0 38-39 35.860375000000005 38.0 35.0 39.0 30.5 39.0 40-41 36.11575 38.5 35.5 39.0 31.0 39.0 42-43 36.196375 39.0 35.5 39.0 31.5 39.0 44-45 36.002250000000004 38.0 35.0 39.0 31.0 39.0 46-47 35.653625 37.0 35.0 39.0 30.0 39.0 48-49 35.519625 37.0 35.0 39.0 30.0 39.0 50-51 35.786249999999995 38.0 35.5 39.0 30.5 39.0 52-53 35.930499999999995 38.5 36.0 39.0 30.5 39.0 54-55 35.786 38.0 36.0 39.0 30.0 39.0 56-57 36.00575 39.0 36.0 39.0 31.0 39.0 58-59 35.9285 39.0 36.0 39.0 31.0 39.0 60-61 35.735875 39.0 35.5 39.0 30.0 39.0 62-63 35.526624999999996 39.0 35.0 39.0 30.0 39.0 64-65 35.381375 38.0 35.0 39.0 29.0 39.0 66-67 35.211749999999995 38.0 35.0 39.0 29.0 39.0 68-69 34.937875000000005 38.0 35.0 39.0 28.0 39.0 70-71 34.825125 38.0 35.0 39.0 28.0 39.0 72-73 34.628249999999994 37.0 35.0 39.0 27.5 39.0 74-75 34.380125 37.0 34.5 39.0 27.0 39.0 76-77 34.108125 37.0 34.0 39.0 26.0 39.0 78-79 33.77475 37.0 33.5 39.0 25.0 39.0 80-81 33.434250000000006 37.0 33.0 39.0 24.0 39.0 82-83 33.160124999999994 37.0 33.0 39.0 23.0 39.0 84-85 32.8 37.0 32.5 39.0 22.0 39.0 86-87 32.283249999999995 36.0 31.5 39.0 19.5 39.0 88-89 31.771124999999998 36.0 31.0 39.0 14.0 39.0 90 31.61275 36.0 31.0 39.0 2.0 39.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 0.0 4 1.0 5 1.0 6 4.0 7 2.0 8 4.0 9 1.0 10 4.0 11 7.0 12 7.0 13 5.0 14 10.0 15 6.0 16 5.0 17 9.0 18 14.0 19 10.0 20 12.0 21 12.0 22 20.0 23 20.0 24 28.0 25 34.0 26 36.0 27 36.0 28 33.0 29 68.0 30 78.0 31 96.0 32 154.0 33 156.0 34 167.0 35 225.0 36 382.0 37 662.0 38 1681.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.28183993618718 8.136134006913055 12.443499069396436 39.138526987503326 2 27.875 17.275 29.475 25.374999999999996 3 23.95 18.95 25.45 31.65 4 28.275 21.2 24.775 25.75 5 26.775 24.125 28.025 21.075 6 23.674999999999997 30.525000000000002 26.200000000000003 19.6 7 19.975 21.725 38.15 20.150000000000002 8 20.575 25.674999999999997 29.725 24.025 9 20.5 22.825 34.449999999999996 22.225 10-11 22.3875 31.674999999999997 25.2375 20.7 12-13 22.037499999999998 26.900000000000002 29.312500000000004 21.75 14-15 21.825 27.700000000000003 28.349999999999998 22.125 16-17 22.5125 27.3875 28.1 22.0 18-19 22.4625 28.749999999999996 28.0625 20.724999999999998 20-21 22.675 27.35 27.962500000000002 22.0125 22-23 22.05 28.1875 27.375 22.3875 24-25 23.075000000000003 27.0625 27.5125 22.35 26-27 21.762500000000003 27.737499999999997 27.1 23.400000000000002 28-29 22.1875 28.9875 26.887499999999996 21.9375 30-31 21.6875 28.237499999999997 27.962500000000002 22.112499999999997 32-33 21.975 27.3875 28.5625 22.075 34-35 22.275 27.650000000000002 27.275 22.8 36-37 21.825 28.625 26.424999999999997 23.125 38-39 22.2125 27.725 27.037499999999998 23.025000000000002 40-41 22.075 27.450000000000003 27.750000000000004 22.725 42-43 23.200000000000003 27.125 27.3375 22.3375 44-45 22.7 27.712500000000002 27.3125 22.275 46-47 21.8875 28.3125 28.487499999999997 21.3125 48-49 22.1875 28.025 27.3625 22.425 50-51 21.837500000000002 28.3625 27.3375 22.4625 52-53 21.875 28.7375 26.8 22.5875 54-55 21.9375 27.5875 27.425 23.05 56-57 21.825 26.875 28.050000000000004 23.25 58-59 22.8 27.55 27.3125 22.3375 60-61 21.625 27.650000000000002 27.900000000000002 22.825 62-63 22.4875 27.925 27.275 22.3125 64-65 22.625 27.150000000000002 27.875 22.35 66-67 21.075 28.125 27.425 23.375 68-69 21.6875 28.325 27.1 22.8875 70-71 22.975 26.937499999999996 27.650000000000002 22.4375 72-73 22.25 27.6 27.5125 22.6375 74-75 22.9875 27.575 26.75 22.6875 76-77 22.25 28.1375 27.325 22.287499999999998 78-79 21.975 27.0 29.1375 21.8875 80-81 22.725 26.987499999999997 27.8375 22.45 82-83 22.5875 27.450000000000003 27.5875 22.375 84-85 22.7375 26.937499999999996 28.3125 22.0125 86-87 22.400000000000002 26.2625 28.050000000000004 23.2875 88-89 21.912499999999998 27.575 27.4125 23.1 90 22.5 28.075 26.625 22.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 1.0 22 0.5 23 0.5 24 1.0 25 2.0 26 2.0 27 4.0 28 8.0 29 14.5 30 19.0 31 21.0 32 28.0 33 42.0 34 50.0 35 63.5 36 101.0 37 135.0 38 160.5 39 180.5 40 186.0 41 216.0 42 248.5 43 263.0 44 275.5 45 294.0 46 290.5 47 255.5 48 234.5 49 212.5 50 198.0 51 184.5 52 152.0 53 125.0 54 101.0 55 86.0 56 69.5 57 44.0 58 32.5 59 27.5 60 26.0 61 24.5 62 17.5 63 7.5 64 3.5 65 4.5 66 3.5 67 1.0 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 1.5 75 1.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 90 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37027707808565 98.625 2 0.5037783375314862 1.0 3 0.12594458438287154 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272131 spots for SRR1030352.sra Written 3272131 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra Read 3272121 spots for SRR1030352.sra Written 3272121 spots for SRR1030352.sra SRR ids: ['SRR1030352.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_10j9mxj8 SRR1030352.sra spots: 65442430 blocks: [[1, 3272121], [3272122, 6544242], [6544243, 9816363], [9816364, 13088484], [13088485, 16360605], [16360606, 19632726], [19632727, 22904847], [22904848, 26176968], [26176969, 29449089], [29449090, 32721210], [32721211, 35993331], [35993332, 39265452], [39265453, 42537573], [42537574, 45809694], [45809695, 49081815], [49081816, 52353936], [52353937, 55626057], [55626058, 58898178], [58898179, 62170299], [62170300, 65442430]] SRR1030352 file size 14293831 SRR1030352 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1030352 SRR1030352_1.fastq SRR1030352_2.fastq Input file: SRR1030352_1.fastq Paired file: SRR1030352_2.fastq trimmed: SRR1030352-trimmed-pair1.fastq, SRR1030352-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:00:26 2025 >> started Mon Feb 10 13:01:26 2025 >> done (59.658s) 65442430 read pairs processed; of these: 184495 ( 0.28%) short read pairs filtered out after trimming by size control 146909 ( 0.22%) empty read pairs filtered out after trimming by size control 65111026 (99.49%) read pairs available; of these: 12610180 (19.37%) trimmed read pairs available after processing 52500846 (80.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 2 0.00% 27 0 0.00% 28 2 0.00% 29 1 0.00% 30 2 0.00% 31 0 0.00% 32 2 0.00% 33 0 0.00% 34 3 0.00% 35 2 0.00% 36 1 0.00% 37 1 0.00% 38 3 0.00% 39 3 0.00% 40 2 0.00% 41 5 0.00% 42 1 0.00% 43 3 0.00% 44 3 0.00% 45 6277 0.01% 46 12770 0.02% 47 20632 0.03% 48 15808 0.02% 49 24877 0.04% 50 22399 0.03% 51 25770 0.04% 52 35366 0.05% 53 25450 0.04% 54 77612 0.12% 55 86006 0.13% 56 78391 0.12% 57 164206 0.25% 58 66972 0.10% 59 126736 0.19% 60 134230 0.21% 61 95794 0.15% 62 196953 0.30% 63 79326 0.12% 64 135786 0.21% 65 143530 0.22% 66 121206 0.19% 67 253633 0.39% 68 102605 0.16% 69 208465 0.32% 70 231432 0.36% 71 148920 0.23% 72 333890 0.51% 73 140581 0.22% 74 286828 0.44% 75 335955 0.52% 76 229424 0.35% 77 529836 0.81% 78 201189 0.31% 79 435112 0.67% 80 521828 0.80% 81 360561 0.55% 82 820766 1.26% 83 285240 0.44% 84 632007 0.97% 85 782456 1.20% 86 585674 0.90% 87 1657088 2.55% 88 501142 0.77% 89 1329412 2.04% 90 52500846 80.63% 65111026 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.16 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=56.67 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.2 sequence=GAAGAGATTGACCTCCCCTACTCATGCAGGGCTGGCTCATGCTCTTCATGTCTTGGCAAGATTGTGAAGGGGACTGTGGATCAGTCTGATGCTAGCTTCCTTGATGATGACCAGATAGAGGAAGGCTGGGTTCTCACCTGTGTTGCTTATCCTACGTCTGATGTTGTCATCGAGACACACAAAGAGGAAGAGTTTAGCGGTTAAATAAG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.16 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=39.14 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.0 sequence=TTGCTCCTGCTTTCATGGACAAGCTTGTTGTTCACATCTCCAAGAACTTCATGAGCCTGCCTAATATCAAGGTTCCTCTCATCTTGGGTGTTTGGGGAGGCAAAGGCCAAGGAAAATCCTTCCAGTGTGAACTTGTCTTTGCCAAGATGGGAATTAACCCAATCATGATGAGTGCTGGAGAATTGGAAAGTGGGAACGCTGGTGAACCCGCAAAGCTTATCAGGCAAAGGTACCGTGAGGCGGCTGATATAATCAAGAAGAAGGGAAAGATGTGCTGCCTCTTCATCAACGATCTTGATGCCGGAGCTGGTAGACTTGGTGGAACTACCCAATACACCGTCAACAACCAGATGGTTAATGCTACCCTCATGAACATTGCTGACAACCCAACAAATGTGCAACTTCCCGGCATGTACAACAAGGA SRR1030352 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:01:58 Started mapping on | Feb 10 13:01:58 Finished on | Feb 10 13:03:50 Mapping speed, Million of reads per hour | 2092.85 Number of input reads | 65111026 Average input read length | 175 UNIQUE READS: Uniquely mapped reads number | 62113391 Uniquely mapped reads % | 95.40% Average mapped length | 175.02 Number of splices: Total | 33034139 Number of splices: Annotated (sjdb) | 32510500 Number of splices: GT/AG | 32326657 Number of splices: GC/AG | 610509 Number of splices: AT/AC | 44089 Number of splices: Non-canonical | 52884 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.97 Insertion rate per base | 0.01% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1893148 % of reads mapped to multiple loci | 2.91% Number of reads mapped to too many loci | 288371 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.23% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1169150 1169150 1169150 N_multimapping 1893148 1893148 1893148 N_noFeature 1974994 31099757 32520820 N_ambiguous 799416 170275 162621 UnstrandedReadsAssigned:59338981 PositiveStrandReadsAssigned:30843359 NegativeStrandReadsAssigned:29429950 Dataset is classified unstranded MeadianReadLen=90 20thPercentileLength=90 echo kmer=85 SRR1030352 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1030352-trimmed-pair1.fastq SRR1030352-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 65,111,026 reads, 61,523,176 reads pseudoaligned [quant] estimated average fragment length: 186.275 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,233 rounds 52401 SRR1030352.ke.tsv 34699 SRR1030352.se.tsv 87100 total ==> SRR1030352.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1832.73 3377 22.5144 Potri.005G024800.1.v4.1 1035 849.725 1279 18.3916 Potri.004G059700.1.v4.1 961 775.725 368 5.79651 Potri.007G009000.2.v4.1 1416 1230.73 1 0.00992809 Potri.003G141000.2.v4.1 2943 2757.73 3624.54 16.0594 Potri.016G087400.1.v4.1 270 84.8838 3224 464.084 Potri.015G069301.1.v4.1 564 378.749 0 0 Potri.010G195200.1.v4.1 1773 1587.73 198 1.52376 Potri.012G127500.1.v4.1 977 791.725 681 10.5099 ==> SRR1030352.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1149 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1179 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 53 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 38 SRR1030352 completed mapping pipeline successfully