Starting /dee2/code/volunteer_pipeline.sh SRR10828686 current disk space = 3087382876160 free memory = 1536714240 SRR10828686 SRAfilesize 430a1fa08e3d1f884ffb4b11e8ff360d SRR10828686.sra SRR10828686.sra file validated SRR10828686 is paired end SRR10828686 is conventional basespace SRR10828686 read1 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828686_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43425 37.0 37.0 37.0 37.0 37.0 2 36.4275 37.0 37.0 37.0 37.0 37.0 3 36.5585 37.0 37.0 37.0 37.0 37.0 4 36.4685 37.0 37.0 37.0 37.0 37.0 5 36.5645 37.0 37.0 37.0 37.0 37.0 6 36.5175 37.0 37.0 37.0 37.0 37.0 7 36.47 37.0 37.0 37.0 37.0 37.0 8 36.58 37.0 37.0 37.0 37.0 37.0 9 36.5425 37.0 37.0 37.0 37.0 37.0 10-14 36.5322 37.0 37.0 37.0 37.0 37.0 15-19 36.525099999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.4606 37.0 37.0 37.0 37.0 37.0 25-29 36.4478 37.0 37.0 37.0 37.0 37.0 30-34 36.410399999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.3036 37.0 37.0 37.0 37.0 37.0 40-44 36.328799999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.3274 37.0 37.0 37.0 37.0 37.0 50-54 36.2993 37.0 37.0 37.0 37.0 37.0 55-59 36.291399999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.2588 37.0 37.0 37.0 37.0 37.0 65-69 36.2753 37.0 37.0 37.0 37.0 37.0 70-74 36.1859 37.0 37.0 37.0 37.0 37.0 75-79 36.1616 37.0 37.0 37.0 37.0 37.0 80-84 36.180899999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.110299999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.0824 37.0 37.0 37.0 37.0 37.0 95-99 36.083999999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.0477641630974 37.0 37.0 37.0 37.0 37.0 105-109 35.94200617229375 37.0 37.0 37.0 37.0 37.0 110-114 35.965291339001574 37.0 37.0 37.0 37.0 37.0 115-119 35.95523860421054 37.0 37.0 37.0 37.0 37.0 120-124 35.855507374933985 37.0 37.0 37.0 37.0 37.0 125-129 35.90807826298773 37.0 37.0 37.0 37.0 37.0 130-134 35.83134091410672 37.0 37.0 37.0 37.0 37.0 135-139 35.710889019869775 37.0 37.0 37.0 37.0 37.0 140-144 35.67063669402246 37.0 37.0 37.0 37.0 37.0 145-149 35.68176913877795 37.0 37.0 37.0 37.0 37.0 150 35.79023646071701 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 2.0 26 10.0 27 9.0 28 16.0 29 29.0 30 37.0 31 41.0 32 51.0 33 68.0 34 104.0 35 301.0 36 3054.0 37 274.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.594946209657245 18.21366024518389 18.513885414060546 36.67750813109832 2 23.011505752876438 27.41370685342671 35.692846423211606 13.881940970485243 3 21.55 32.65 26.75 19.05 4 22.8 37.2 19.975 20.025000000000002 5 21.3 37.675 22.7 18.325 6 17.424999999999997 38.324999999999996 23.575 20.674999999999997 7 16.2 15.950000000000001 44.15 23.7 8 19.5 21.349999999999998 29.15 30.0 9 21.2 23.075000000000003 28.4 27.325 10-14 21.525 29.335 26.61 22.53 15-19 21.43 27.785 28.24 22.545 20-24 21.26 28.675 27.295 22.770000000000003 25-29 21.37 28.285 27.800000000000004 22.545 30-34 20.880000000000003 28.205000000000002 28.405 22.509999999999998 35-39 20.955 28.884999999999998 27.694999999999997 22.465 40-44 21.135 29.5 27.13 22.235 45-49 21.525 28.439999999999998 27.495000000000005 22.54 50-54 21.845 28.515 27.625 22.015 55-59 21.755 27.905 28.000000000000004 22.34 60-64 21.935 28.52 27.389999999999997 22.155 65-69 21.47 28.15 27.98 22.400000000000002 70-74 21.375 28.315 27.894999999999996 22.415 75-79 21.515 27.93 28.050000000000004 22.505 80-84 21.85 27.975 27.439999999999998 22.735 85-89 21.725 28.139999999999997 27.265 22.869999999999997 90-94 22.065 27.865000000000002 27.48 22.59 95-99 21.78 27.82 28.395 22.005 100-104 21.619052384049635 28.348426477210186 27.622954920698454 22.409566218041725 105-109 21.639623397435898 28.21514423076923 27.794471153846157 22.350761217948715 110-114 21.915543755948505 27.014977708761208 27.89159945899915 23.177879076291138 115-119 21.8128039304156 27.93903845189753 28.179676141775705 22.068481475911163 120-124 22.00531941586792 27.38495508606413 28.514076378782555 22.09564911928539 125-129 21.672526368658964 28.18181818181818 27.985936715218486 22.15971873430437 130-134 21.015585721468074 27.928607340372047 28.099547511312217 22.956259426847662 135-139 22.333031127228768 28.019542661428424 27.666968872771232 21.980457338571572 140-144 22.422159320663162 28.285483218762636 27.471694298422968 21.820663162151234 145-149 22.635564364486456 27.499110636784064 27.992071962189357 21.87325303654012 150 22.19679633867277 27.815916603101957 27.7904907195525 22.19679633867277 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 1.5 24 3.5 25 4.5 26 4.0 27 5.0 28 9.0 29 16.0 30 20.5 31 23.5 32 38.5 33 53.5 34 57.5 35 71.0 36 91.0 37 110.5 38 144.0 39 167.5 40 203.5 41 229.0 42 228.0 43 242.0 44 249.0 45 260.0 46 263.5 47 242.0 48 229.5 49 207.5 50 165.0 51 138.0 52 116.5 53 94.5 54 81.0 55 60.5 56 36.0 57 30.0 58 26.5 59 18.5 60 17.5 61 14.5 62 8.5 63 4.0 64 1.5 65 1.0 66 1.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 1.0 100-101 2.0 102-103 1.0 104-105 2.0 106-107 1.0 108-109 0.0 110-111 0.0 112-113 1.0 114-115 1.0 116-117 3.0 118-119 2.0 120-121 1.0 122-123 0.0 124-125 3.0 126-127 0.0 128-129 1.0 130-131 3.0 132-133 4.0 134-135 1.0 136-137 4.0 138-139 3.0 140-141 10.0 142-143 7.0 144-145 16.0 146-147 0.0 148-149 0.0 150-151 3933.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.25 #Duplication Level Percentage of deduplicated Percentage of total 1 85.60117302052785 72.975 2 11.994134897360704 20.45 3 1.994134897360704 5.1 4 0.3519061583577713 1.2 5 0.02932551319648094 0.125 6 0.02932551319648094 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTC 6 0.15 No Hit CATGCCCATCCCATGGGGTACTGGAAAGCAGGATTTGAGTAGTTGCCATA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATATT 10 0.006991776 143.875 2 AATATTC 10 0.006991776 143.875 3 CAAATAT 10 0.006991776 143.875 1 >>END_MODULE SRR10828686 read2 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828686_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9545 37.0 37.0 37.0 37.0 37.0 2 35.7505 37.0 37.0 37.0 37.0 37.0 3 35.956 37.0 37.0 37.0 37.0 37.0 4 35.825 37.0 37.0 37.0 37.0 37.0 5 36.1595 37.0 37.0 37.0 37.0 37.0 6 36.0335 37.0 37.0 37.0 37.0 37.0 7 36.183 37.0 37.0 37.0 37.0 37.0 8 36.303 37.0 37.0 37.0 37.0 37.0 9 36.224 37.0 37.0 37.0 37.0 37.0 10-14 36.2384 37.0 37.0 37.0 37.0 37.0 15-19 36.1201 37.0 37.0 37.0 37.0 37.0 20-24 36.1548 37.0 37.0 37.0 37.0 37.0 25-29 36.1764 37.0 37.0 37.0 37.0 37.0 30-34 36.1613 37.0 37.0 37.0 37.0 37.0 35-39 36.121500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.1005 37.0 37.0 37.0 37.0 37.0 45-49 36.020700000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.99130000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.9723 37.0 37.0 37.0 37.0 37.0 60-64 35.9225 37.0 37.0 37.0 37.0 37.0 65-69 35.8587 37.0 37.0 37.0 37.0 37.0 70-74 35.9204 37.0 37.0 37.0 37.0 37.0 75-79 35.7572 37.0 37.0 37.0 37.0 37.0 80-84 35.730599999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.8147 37.0 37.0 37.0 37.0 37.0 90-94 35.604099999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.7193 37.0 37.0 37.0 37.0 37.0 100-104 35.71386832463838 37.0 37.0 37.0 37.0 37.0 105-109 35.63840737314336 37.0 37.0 37.0 37.0 37.0 110-114 35.47536957210188 37.0 37.0 37.0 34.6 37.0 115-119 35.377932556321284 37.0 37.0 37.0 32.2 37.0 120-124 35.53615143592284 37.0 37.0 37.0 37.0 37.0 125-129 35.40150878464034 37.0 37.0 37.0 34.6 37.0 130-134 35.3675677389892 37.0 37.0 37.0 32.2 37.0 135-139 35.287014575582425 37.0 37.0 37.0 29.8 37.0 140-144 35.181955614226055 37.0 37.0 37.0 29.8 37.0 145-149 35.34379390919575 37.0 37.0 37.0 32.2 37.0 150 35.302568014238496 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 3.0 22 1.0 23 4.0 24 6.0 25 7.0 26 14.0 27 16.0 28 17.0 29 25.0 30 32.0 31 36.0 32 52.0 33 89.0 34 244.0 35 804.0 36 2482.0 37 166.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.05 18.15 18.025 36.775000000000006 2 23.200000000000003 27.474999999999998 34.849999999999994 14.475 3 22.425 32.7 25.724999999999998 19.15 4 22.425 36.35 20.625 20.599999999999998 5 20.549999999999997 38.15 22.2 19.1 6 16.325 37.1 24.625 21.95 7 16.175 16.125 43.55 24.15 8 20.025000000000002 21.425 30.175 28.375 9 19.975 24.099999999999998 29.299999999999997 26.625 10-14 21.02 29.304999999999996 26.985 22.689999999999998 15-19 21.51 27.355 28.26 22.875 20-24 21.185000000000002 28.575 27.950000000000003 22.29 25-29 21.59 29.635 27.139999999999997 21.634999999999998 30-34 21.52 28.765 27.744999999999997 21.97 35-39 21.46 28.125 28.305000000000003 22.11 40-44 21.065 28.549999999999997 27.3 23.085 45-49 20.905 28.63 27.96 22.505 50-54 21.64 27.97 28.63 21.759999999999998 55-59 21.665 28.43 27.675 22.23 60-64 21.195 28.439999999999998 27.939999999999998 22.425 65-69 21.855 28.68 27.555000000000003 21.91 70-74 21.05 28.194999999999997 28.235 22.52 75-79 22.055 28.49 27.265 22.189999999999998 80-84 21.775 28.000000000000004 27.615000000000002 22.61 85-89 21.875 28.535 27.785 21.805 90-94 21.64 28.095 28.27 21.995 95-99 22.3 27.48 27.800000000000004 22.42 100-104 21.909241006654327 28.383449242007302 27.943163055986393 21.76414669535198 105-109 21.900040064102562 28.41045673076923 27.609174679487182 22.080328525641026 110-114 22.401442668937534 28.10699794620047 27.53093222461554 21.960627160246457 115-119 22.188800320850252 28.771243796059558 27.357497368025268 21.682458515064923 120-124 22.416821398103075 27.580669443468658 28.27821548652582 21.724293671902444 125-129 22.466097438473128 28.528377699648416 27.388247112004017 21.617277749874436 130-134 22.790346907993968 28.22021116138763 27.430869783810962 21.558572146807442 135-139 22.358214969275714 28.402337060541953 27.515865820489573 21.723582149692756 140-144 21.6841892438334 28.002426202992314 27.977153255155677 22.3362312980186 145-149 22.35096813538649 27.783706865884028 27.865020074198306 22.00030492453118 150 21.586575133485887 28.400711924739387 28.1210272056954 21.891685736079328 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.0 23 0.5 24 3.5 25 4.5 26 5.5 27 12.0 28 12.5 29 13.5 30 18.0 31 21.5 32 35.0 33 50.0 34 59.5 35 73.5 36 96.0 37 128.0 38 154.0 39 162.5 40 183.0 41 229.5 42 261.0 43 262.0 44 251.5 45 251.5 46 241.5 47 233.5 48 242.0 49 210.0 50 161.0 51 125.5 52 105.0 53 94.5 54 75.5 55 53.5 56 40.0 57 39.5 58 30.0 59 17.5 60 14.5 61 9.0 62 5.0 63 3.0 64 1.5 65 0.5 66 0.0 67 1.0 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 1.0 100-101 2.0 102-103 1.0 104-105 2.0 106-107 1.0 108-109 0.0 110-111 0.0 112-113 1.0 114-115 1.0 116-117 3.0 118-119 2.0 120-121 1.0 122-123 0.0 124-125 3.0 126-127 0.0 128-129 1.0 130-131 3.0 132-133 4.0 134-135 1.0 136-137 4.0 138-139 3.0 140-141 10.0 142-143 7.0 144-145 16.0 146-147 0.0 148-149 0.0 150-151 3933.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.625 #Duplication Level Percentage of deduplicated Percentage of total 1 85.8978102189781 73.55000000000001 2 11.824817518248175 20.25 3 1.9562043795620438 5.025 4 0.2627737226277372 0.8999999999999999 5 0.029197080291970805 0.125 6 0.029197080291970805 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATTACATAAAGAAGAAGCTACTGAGCAACCATGAACAAAAAGTAGCTAT 6 0.15 No Hit GAGAGACCCTAAAAATCTCTCTCGATAGCCTCCTCCAGTCTCTCACACGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATAC 10 0.006991776 143.875 4 >>END_MODULE Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254768 spots for SRR10828686.sra Written 1254768 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra Read 1254767 spots for SRR10828686.sra Written 1254767 spots for SRR10828686.sra SRR ids: ['SRR10828686.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gz57cjn_ SRR10828686.sra spots: 25095341 blocks: [[1, 1254767], [1254768, 2509534], [2509535, 3764301], [3764302, 5019068], [5019069, 6273835], [6273836, 7528602], [7528603, 8783369], [8783370, 10038136], [10038137, 11292903], [11292904, 12547670], [12547671, 13802437], [13802438, 15057204], [15057205, 16311971], [16311972, 17566738], [17566739, 18821505], [18821506, 20076272], [20076273, 21331039], [21331040, 22585806], [22585807, 23840573], [23840574, 25095341]] SRR10828686 file size 8445668 SRR10828686 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10828686 SRR10828686_1.fastq SRR10828686_2.fastq Input file: SRR10828686_1.fastq Paired file: SRR10828686_2.fastq trimmed: SRR10828686-trimmed-pair1.fastq, SRR10828686-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:19:01 2025 >> started Thu Feb 13 19:19:28 2025 >> done (27.083s) 25095341 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 8 ( 0.00%) empty read pairs filtered out after trimming by size control 25095333 (100.00%) read pairs available; of these: 66608 ( 0.27%) trimmed read pairs available after processing 25028725 (99.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 24 5 0.00% 25 2 0.00% 26 1 0.00% 27 3 0.00% 28 5 0.00% 29 3 0.00% 30 2 0.00% 31 3 0.00% 32 0 0.00% 33 4 0.00% 34 5 0.00% 35 4 0.00% 36 2 0.00% 37 6 0.00% 38 5 0.00% 39 7 0.00% 40 7 0.00% 41 5 0.00% 42 7 0.00% 43 5 0.00% 44 4 0.00% 45 6 0.00% 46 6 0.00% 47 8 0.00% 48 3 0.00% 49 10 0.00% 50 8 0.00% 51 4 0.00% 52 10 0.00% 53 9 0.00% 54 6 0.00% 55 6 0.00% 56 10 0.00% 57 10 0.00% 58 8 0.00% 59 6 0.00% 60 6 0.00% 61 13 0.00% 62 7 0.00% 63 8 0.00% 64 4 0.00% 65 5 0.00% 66 4 0.00% 67 9 0.00% 68 8 0.00% 69 6 0.00% 70 7 0.00% 71 6 0.00% 72 10 0.00% 73 8 0.00% 74 9 0.00% 75 11 0.00% 76 9 0.00% 77 7 0.00% 78 8 0.00% 79 9 0.00% 80 6 0.00% 81 5 0.00% 82 8 0.00% 83 10 0.00% 84 8 0.00% 85 8 0.00% 86 5 0.00% 87 5 0.00% 88 10 0.00% 89 13 0.00% 90 12 0.00% 91 9 0.00% 92 7 0.00% 93 4 0.00% 94 7 0.00% 95 9 0.00% 96 13 0.00% 97 7 0.00% 98 17 0.00% 99 1460 0.01% 100 1618 0.01% 101 1720 0.01% 102 1945 0.01% 103 2041 0.01% 104 2148 0.01% 105 2221 0.01% 106 2467 0.01% 107 2532 0.01% 108 2725 0.01% 109 2806 0.01% 110 2875 0.01% 111 3142 0.01% 112 3392 0.01% 113 3338 0.01% 114 3723 0.01% 115 3956 0.02% 116 3972 0.02% 117 4337 0.02% 118 4480 0.02% 119 4713 0.02% 120 5046 0.02% 121 5299 0.02% 122 5566 0.02% 123 5789 0.02% 124 6031 0.02% 125 6432 0.03% 126 6612 0.03% 127 7034 0.03% 128 7085 0.03% 129 7481 0.03% 130 7948 0.03% 131 8289 0.03% 132 8788 0.04% 133 9253 0.04% 134 9486 0.04% 135 9922 0.04% 136 10536 0.04% 137 83 0.00% 138 10836 0.04% 139 11533 0.05% 140 12082 0.05% 141 12447 0.05% 142 13111 0.05% 143 14720 0.06% 144 20523 0.08% 145 70074 0.28% 146 15220 0.06% 147 16057 0.06% 148 16398 0.07% 149 17220 0.07% 150 24676309 98.33% 25095333 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=33 prefix-density=0.44 prefix-fanout=2.0 sequence=CTCAAGTCTACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=31.04 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=3.5 sequence=CTGCATTTGCTAGCTAGAAGTCACTCTACCCTTTGCATTACTTCCTCAATCAACCACTGCTGTTTGATCATGGCAGCAACCATCTCAACCGTTGGAGCTGTCAACACAGCACCGCTGGCTTTGAATGGCTCTGGCGCTGGATCCACAGTCCCAA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=35 prefix-density=0.45 prefix-fanout=2.0 sequence=CTCAAGTCTACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=60.92 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.1 sequence=AAAAAAAATCTAAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCC SRR10828686 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 13 19:35:41 Started mapping on | Feb 13 19:35:44 Finished on | Feb 13 19:39:01 Mapping speed, Million of reads per hour | 458.59 Number of input reads | 25095288 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 22905736 Uniquely mapped reads % | 91.28% Average mapped length | 276.10 Number of splices: Total | 21644004 Number of splices: Annotated (sjdb) | 21074171 Number of splices: GT/AG | 21144707 Number of splices: GC/AG | 373336 Number of splices: AT/AC | 13313 Number of splices: Non-canonical | 112648 Mismatch rate per base, % | 1.20% Deletion rate per base | 0.09% Deletion average length | 3.40 Insertion rate per base | 0.07% Insertion average length | 2.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 964679 % of reads mapped to multiple loci | 3.84% Number of reads mapped to too many loci | 58705 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.54% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1224886 1224886 1224886 N_multimapping 964679 964679 964679 N_noFeature 743537 11646144 11782970 N_ambiguous 399140 91020 88936 UnstrandedReadsAssigned:21763059 PositiveStrandReadsAssigned:11168572 NegativeStrandReadsAssigned:11033830 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR10828686 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR10828686-trimmed-pair1.fastq SRR10828686-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,095,288 reads, 21,360,911 reads pseudoaligned [quant] estimated average fragment length: 232.056 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR10828686.ke.tsv 34699 SRR10828686.se.tsv 87100 total ==> SRR10828686.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.94 1053 23.7935 Potri.005G024800.1.v4.1 1035 803.944 297 14.9167 Potri.004G059700.1.v4.1 961 729.948 1 0.0553158 Potri.007G009000.2.v4.1 1416 1184.94 0 0 Potri.003G141000.2.v4.1 2943 2711.94 613.342 9.13195 Potri.016G087400.1.v4.1 270 60.1728 829 556.283 Potri.015G069301.1.v4.1 564 333.183 0 0 Potri.010G195200.1.v4.1 1773 1541.94 42 1.09982 Potri.012G127500.1.v4.1 977 745.944 27 1.4615 ==> SRR10828686.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 421 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR10828686 completed mapping pipeline successfully