Starting /dee2/code/volunteer_pipeline.sh SRR10828687
    current disk space = 3087387447296
    free memory = 1488190288 
SRR10828687 SRAfilesize
89ab54aebb1d5676ef91dbacc906d288  SRR10828687.sra
SRR10828687.sra file validated
SRR10828687 is paired end
SRR10828687 is conventional basespace
SRR10828687 read1 length is 102-150 nt
##FastQC	0.11.5
>>Basic Statistics	pass
#Measure	Value
Filename	SRR10828687_1.fastq
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	4000
Sequences flagged as poor quality	0
Sequence length	102-150
%GC	43
>>END_MODULE
>>Per base sequence quality	pass
#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
1	36.42825	37.0	37.0	37.0	37.0	37.0
2	36.3665	37.0	37.0	37.0	37.0	37.0
3	36.5415	37.0	37.0	37.0	37.0	37.0
4	36.4125	37.0	37.0	37.0	37.0	37.0
5	36.463	37.0	37.0	37.0	37.0	37.0
6	36.488	37.0	37.0	37.0	37.0	37.0
7	36.371	37.0	37.0	37.0	37.0	37.0
8	36.5385	37.0	37.0	37.0	37.0	37.0
9	36.557	37.0	37.0	37.0	37.0	37.0
10-14	36.474399999999996	37.0	37.0	37.0	37.0	37.0
15-19	36.4285	37.0	37.0	37.0	37.0	37.0
20-24	36.4534	37.0	37.0	37.0	37.0	37.0
25-29	36.3853	37.0	37.0	37.0	37.0	37.0
30-34	36.368399999999994	37.0	37.0	37.0	37.0	37.0
35-39	36.2726	37.0	37.0	37.0	37.0	37.0
40-44	36.267399999999995	37.0	37.0	37.0	37.0	37.0
45-49	36.2453	37.0	37.0	37.0	37.0	37.0
50-54	36.2435	37.0	37.0	37.0	37.0	37.0
55-59	36.218500000000006	37.0	37.0	37.0	37.0	37.0
60-64	36.1623	37.0	37.0	37.0	37.0	37.0
65-69	36.14829999999999	37.0	37.0	37.0	37.0	37.0
70-74	36.1776	37.0	37.0	37.0	37.0	37.0
75-79	36.1451	37.0	37.0	37.0	37.0	37.0
80-84	36.0557	37.0	37.0	37.0	37.0	37.0
85-89	36.0658	37.0	37.0	37.0	37.0	37.0
90-94	36.0107	37.0	37.0	37.0	37.0	37.0
95-99	35.9984	37.0	37.0	37.0	37.0	37.0
100-104	35.972590045022514	37.0	37.0	37.0	37.0	37.0
105-109	35.90842919583385	37.0	37.0	37.0	37.0	37.0
110-114	35.87008097503966	37.0	37.0	37.0	37.0	37.0
115-119	35.846892272724205	37.0	37.0	37.0	37.0	37.0
120-124	35.8052190447846	37.0	37.0	37.0	37.0	37.0
125-129	35.862725494457614	37.0	37.0	37.0	37.0	37.0
130-134	35.77099158232157	37.0	37.0	37.0	37.0	37.0
135-139	35.60438665254094	37.0	37.0	37.0	37.0	37.0
140-144	35.58876258646476	37.0	37.0	37.0	37.0	37.0
145-149	35.643177664684444	37.0	37.0	37.0	37.0	37.0
150	35.59500764136526	37.0	37.0	37.0	37.0	37.0
>>END_MODULE
>>Per sequence quality scores	pass
#Quality	Count
23	2.0
24	3.0
25	5.0
26	9.0
27	8.0
28	26.0
29	31.0
30	30.0
31	52.0
32	62.0
33	74.0
34	126.0
35	338.0
36	2975.0
37	259.0
>>END_MODULE
>>Per base sequence content	fail
#Base	G	A	T	C
1	28.632158039509875	18.6046511627907	18.02950737684421	34.733683420855215
2	21.735867933966986	27.538769384692348	35.36768384192096	15.35767883941971
3	21.75	31.674999999999997	26.8	19.775000000000002
4	22.125	35.9	20.8	21.175
5	20.525	38.65	22.75	18.075
6	16.3	38.175	24.675	20.849999999999998
7	16.525000000000002	16.25	44.800000000000004	22.425
8	18.625	22.400000000000002	30.075000000000003	28.9
9	20.225	23.575	29.375	26.825
10-14	20.9	29.599999999999998	26.919999999999998	22.58
15-19	20.979999999999997	28.975	27.700000000000003	22.345000000000002
20-24	21.925	28.515	27.305	22.255
25-29	21.68	28.910000000000004	27.0	22.41
30-34	20.96	29.075	27.96	22.005
35-39	21.154999999999998	28.26	28.515	22.07
40-44	21.595	28.470000000000002	27.82	22.115000000000002
45-49	21.32	27.725	28.255000000000003	22.7
50-54	20.8	28.265	28.26	22.675
55-59	21.765	28.46	27.815	21.959999999999997
60-64	21.475	28.849999999999998	27.61	22.065
65-69	21.795	27.839999999999996	27.63	22.735
70-74	22.189999999999998	28.275	27.439999999999998	22.095000000000002
75-79	22.25	28.405	27.63	21.715
80-84	21.875	27.685	27.800000000000004	22.64
85-89	21.685	28.07	27.779999999999998	22.465
90-94	22.08	28.915000000000003	27.87	21.135
95-99	21.65	28.485	27.375	22.49
100-104	21.844368873774755	28.595719143828767	27.250450090018003	22.309461892378476
105-109	21.44286571943166	27.901741044626778	28.62717630578347	22.028216930158095
110-114	21.674926165089854	28.237473094058167	27.92711618361115	22.160484557240828
115-119	22.288552222333703	28.323467442560453	27.395404835958665	21.992575499147186
120-124	21.48602453247537	28.55921978684898	28.202292378845765	21.75246330182988
125-129	22.132178990285396	27.543162027482758	28.313283334172247	22.011375648059598
130-134	21.854671978215926	27.63854571126015	28.50083203065907	22.00595027986486
135-139	22.030815862591563	28.21419550391513	28.05253851982824	21.702450113665066
140-144	22.366756086450373	27.5649137014729	28.076124917750672	21.992205294326062
145-149	22.257292674235096	27.928524156187954	28.320521305299597	21.49366186427735
150	23.509933774834437	26.84666327050433	27.254202750891494	22.38920020376974
>>END_MODULE
>>Per sequence GC content	pass
#GC Content	Count
0	0.0
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10	0.5
11	0.5
12	0.0
13	0.0
14	0.0
15	0.0
16	0.0
17	0.0
18	0.0
19	0.0
20	0.0
21	0.0
22	0.5
23	1.0
24	3.0
25	3.5
26	3.5
27	5.5
28	13.5
29	23.0
30	24.0
31	27.5
32	36.0
33	42.5
34	53.0
35	78.0
36	100.0
37	120.5
38	156.0
39	188.5
40	192.0
41	218.0
42	252.0
43	247.0
44	265.0
45	266.5
46	243.0
47	235.5
48	226.5
49	190.5
50	157.5
51	139.5
52	104.0
53	73.0
54	69.5
55	66.5
56	51.5
57	40.5
58	23.5
59	16.0
60	13.5
61	7.5
62	7.5
63	6.0
64	2.0
65	0.5
66	0.5
67	0.5
68	0.0
69	0.5
70	1.0
71	1.0
72	1.0
73	0.5
74	0.0
75	0.0
76	0.0
77	0.0
78	0.0
79	0.0
80	0.0
81	0.0
82	0.0
83	0.0
84	0.0
85	0.0
86	0.0
87	0.0
88	0.0
89	0.0
90	0.0
91	0.0
92	0.0
93	0.0
94	0.0
95	0.0
96	0.0
97	0.0
98	0.0
99	0.0
100	0.0
>>END_MODULE
>>Per base N content	pass
#Base	N-Count
1	0.025
2	0.05
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10-14	0.0
15-19	0.0
20-24	0.0
25-29	0.0
30-34	0.0
35-39	0.0
40-44	0.0
45-49	0.0
50-54	0.0
55-59	0.0
60-64	0.0
65-69	0.0
70-74	0.0
75-79	0.0
80-84	0.0
85-89	0.0
90-94	0.0
95-99	0.0
100-104	0.0
105-109	0.0
110-114	0.0
115-119	0.0
120-124	0.0
125-129	0.0
130-134	0.0
135-139	0.0
140-144	0.0
145-149	0.0
150	0.0
>>END_MODULE
>>Sequence Length Distribution	warn
#Length	Count
102	2.0
103	0.0
104	0.0
105	0.0
106	0.0
107	1.0
108	0.0
109	1.0
110	0.0
111	0.0
112	0.0
113	3.0
114	1.0
115	1.0
116	4.0
117	3.0
118	4.0
119	1.0
120	0.0
121	0.0
122	1.0
123	1.0
124	0.0
125	1.0
126	2.0
127	3.0
128	2.0
129	0.0
130	1.0
131	2.0
132	2.0
133	0.0
134	3.0
135	0.0
136	3.0
137	0.0
138	1.0
139	3.0
140	0.0
141	0.0
142	4.0
143	5.0
144	6.0
145	13.0
146	0.0
147	0.0
148	0.0
149	0.0
150	3926.0
>>END_MODULE
>>Sequence Duplication Levels	pass
#Total Deduplicated Percentage	84.775
#Duplication Level	Percentage of deduplicated	Percentage of total
1	84.81273960483632	71.89999999999999
2	12.79858448835152	21.7
3	2.005308168681805	5.1
4	0.383367738130345	1.3
5	0.0	0.0
6	0.0	0.0
7	0.0	0.0
8	0.0	0.0
9	0.0	0.0
>10	0.0	0.0
>50	0.0	0.0
>100	0.0	0.0
>500	0.0	0.0
>1k	0.0	0.0
>5k	0.0	0.0
>10k+	0.0	0.0
>>END_MODULE
>>Overrepresented sequences	pass
>>END_MODULE
>>Adapter Content	pass
#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
1	0.0	0.0	0.0	0.0	0.0
2	0.0	0.0	0.0	0.0	0.0
3	0.0	0.0	0.0	0.0	0.0
4	0.0	0.0	0.0	0.0	0.0
5	0.0	0.0	0.0	0.0	0.0
6	0.0	0.0	0.0	0.0	0.0
7	0.0	0.0	0.0	0.0	0.0
8	0.0	0.0	0.0	0.0	0.0
9	0.0	0.0	0.0	0.0	0.0
10-11	0.0	0.0	0.0	0.0	0.0
12-13	0.0	0.0	0.0	0.0	0.0
14-15	0.0	0.0	0.0	0.0	0.0
16-17	0.0	0.0	0.0	0.0	0.0
18-19	0.0	0.0	0.0	0.0	0.0
20-21	0.0	0.0	0.0	0.0	0.0
22-23	0.0	0.0	0.0	0.0	0.0
24-25	0.0	0.0	0.0	0.0	0.0
26-27	0.0	0.0	0.0	0.0	0.0
28-29	0.0	0.0	0.0	0.0	0.0
30-31	0.0	0.0	0.0	0.0	0.0
32-33	0.0	0.0	0.0	0.0	0.0
34-35	0.0	0.0	0.0	0.0	0.0
36-37	0.0	0.0	0.0	0.0	0.0
38-39	0.0	0.0	0.0	0.0	0.0
40-41	0.0	0.0	0.0	0.0	0.0
42-43	0.0	0.0	0.0	0.0	0.0
44-45	0.0	0.0	0.0	0.0	0.0
46-47	0.0	0.0	0.0	0.0	0.0
48-49	0.0	0.0	0.0	0.0	0.0
50-51	0.0	0.0	0.0	0.0	0.0
52-53	0.0	0.0	0.0	0.0	0.0
54-55	0.0	0.0	0.0	0.0	0.0
56-57	0.0	0.0	0.0	0.0	0.0
58-59	0.0	0.0	0.0	0.0	0.0
60-61	0.0	0.0	0.0	0.0	0.0
62-63	0.0	0.0	0.0	0.0	0.0
64-65	0.0	0.0	0.0	0.0	0.0
66-67	0.0	0.0	0.0	0.0	0.0
68-69	0.0	0.0	0.0	0.0	0.0
70-71	0.0	0.0	0.0	0.0	0.0
72-73	0.0	0.0	0.0	0.0	0.0
74-75	0.0	0.0	0.0	0.0	0.0
76-77	0.0	0.0	0.0	0.0	0.0
78-79	0.0	0.0	0.0	0.0	0.0
80-81	0.0	0.0	0.0	0.0	0.0
82-83	0.0	0.0	0.0	0.0	0.0
84-85	0.0	0.0	0.0	0.0	0.0
86-87	0.0	0.0	0.0	0.0	0.0
88-89	0.0	0.0	0.0	0.0	0.0
90-91	0.0	0.0	0.0	0.0	0.0
92-93	0.0	0.0	0.0	0.0	0.0
94-95	0.0	0.0	0.0	0.0	0.0
96-97	0.0	0.0	0.0	0.0	0.0
98-99	0.0	0.0	0.0	0.0	0.0
100-101	0.0	0.0	0.0	0.0	0.0
102-103	0.0	0.0	0.0	0.0	0.0
104-105	0.0	0.0	0.0	0.0	0.0
106-107	0.0	0.0	0.0	0.0	0.0
108-109	0.0	0.0	0.0	0.0	0.0
110-111	0.0	0.0	0.0	0.0	0.0
112-113	0.0	0.0	0.0	0.0	0.0
114-115	0.0	0.0	0.0	0.0	0.0
116-117	0.0	0.0	0.0	0.0	0.0
118-119	0.0	0.0	0.0	0.0	0.0
120-121	0.0	0.0	0.0	0.0	0.0
122-123	0.0	0.0	0.0	0.0	0.0
124-125	0.0	0.0	0.0	0.0	0.0
126-127	0.0	0.0	0.0	0.0	0.0
128-129	0.0	0.0	0.0	0.0	0.0
130-131	0.0	0.0	0.0	0.0	0.0
132-133	0.0	0.0	0.0	0.0	0.0
134-135	0.0	0.0	0.0	0.0	0.0
136-137	0.0	0.0	0.0	0.0	0.0
138	0.0	0.0	0.0	0.0	0.0
>>END_MODULE
>>Kmer Content	warn
#Sequence	Count	PValue	Obs/Exp Max	Max Obs/Exp Position
TAATAAG	10	0.007066775	143.3625	9
>>END_MODULE
SRR10828687 read2 length is 102-150 nt
##FastQC	0.11.5
>>Basic Statistics	pass
#Measure	Value
Filename	SRR10828687_2.fastq
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	4000
Sequences flagged as poor quality	0
Sequence length	102-150
%GC	43
>>END_MODULE
>>Per base sequence quality	pass
#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
1	36.2155	37.0	37.0	37.0	37.0	37.0
2	36.1165	37.0	37.0	37.0	37.0	37.0
3	36.3455	37.0	37.0	37.0	37.0	37.0
4	36.194	37.0	37.0	37.0	37.0	37.0
5	36.3715	37.0	37.0	37.0	37.0	37.0
6	36.33425	37.0	37.0	37.0	37.0	37.0
7	36.368	37.0	37.0	37.0	37.0	37.0
8	36.492	37.0	37.0	37.0	37.0	37.0
9	36.326	37.0	37.0	37.0	37.0	37.0
10-14	36.419599999999996	37.0	37.0	37.0	37.0	37.0
15-19	36.388600000000004	37.0	37.0	37.0	37.0	37.0
20-24	36.361000000000004	37.0	37.0	37.0	37.0	37.0
25-29	36.305499999999995	37.0	37.0	37.0	37.0	37.0
30-34	36.2406	37.0	37.0	37.0	37.0	37.0
35-39	36.293	37.0	37.0	37.0	37.0	37.0
40-44	36.268299999999996	37.0	37.0	37.0	37.0	37.0
45-49	36.253099999999996	37.0	37.0	37.0	37.0	37.0
50-54	36.2044	37.0	37.0	37.0	37.0	37.0
55-59	36.1741	37.0	37.0	37.0	37.0	37.0
60-64	36.108000000000004	37.0	37.0	37.0	37.0	37.0
65-69	36.0822	37.0	37.0	37.0	37.0	37.0
70-74	36.1241	37.0	37.0	37.0	37.0	37.0
75-79	36.0173	37.0	37.0	37.0	37.0	37.0
80-84	35.9459	37.0	37.0	37.0	37.0	37.0
85-89	36.0683	37.0	37.0	37.0	37.0	37.0
90-94	35.8142	37.0	37.0	37.0	37.0	37.0
95-99	35.9088	37.0	37.0	37.0	37.0	37.0
100-104	35.932283691845925	37.0	37.0	37.0	37.0	37.0
105-109	35.86831083793085	37.0	37.0	37.0	37.0	37.0
110-114	35.759743815942166	37.0	37.0	37.0	37.0	37.0
115-119	35.73081017960128	37.0	37.0	37.0	37.0	37.0
120-124	35.81269626381221	37.0	37.0	37.0	37.0	37.0
125-129	35.64065054859723	37.0	37.0	37.0	37.0	37.0
130-134	35.63716712051503	37.0	37.0	37.0	37.0	37.0
135-139	35.64611537928698	37.0	37.0	37.0	37.0	37.0
140-144	35.42125391767077	37.0	37.0	37.0	32.2	37.0
145-149	35.61232100795408	37.0	37.0	37.0	37.0	37.0
150	35.522669383596536	37.0	37.0	37.0	37.0	37.0
>>END_MODULE
>>Per sequence quality scores	pass
#Quality	Count
17	1.0
18	0.0
19	1.0
20	0.0
21	0.0
22	0.0
23	0.0
24	3.0
25	6.0
26	10.0
27	11.0
28	6.0
29	11.0
30	29.0
31	42.0
32	59.0
33	100.0
34	184.0
35	553.0
36	2731.0
37	253.0
>>END_MODULE
>>Per base sequence content	fail
#Base	G	A	T	C
1	28.125	18.5	18.275	35.099999999999994
2	21.96098049024512	29.389694847423716	34.79239619809905	13.856928464232116
3	21.875	32.725	24.725	20.674999999999997
4	22.55	36.525	20.05	20.875
5	20.95	38.7	22.975	17.375
6	17.35433858464616	39.0847711927982	23.53088272068017	20.030007501875467
7	16.375	17.325	43.25	23.05
8	18.684342171085543	22.98649324662331	30.21510755377689	28.114057028514257
9	20.710355177588795	23.23661830915458	28.789394697348676	27.263631815907953
10-14	21.04710471047105	29.672967296729674	26.717671767176714	22.562256225622562
15-19	21.925	28.125	28.199999999999996	21.75
20-24	21.584999999999997	28.555000000000003	27.685	22.175
25-29	21.44	29.020000000000003	27.46	22.08
30-34	21.11	28.23	27.894999999999996	22.765
35-39	21.649329865973193	28.075615123024605	27.840568113622727	22.434486897379475
40-44	21.584999999999997	29.01	27.73	21.675
45-49	21.325	28.67	27.555000000000003	22.45
50-54	21.285	29.080000000000002	27.665	21.97
55-59	21.555	28.560000000000002	27.639999999999997	22.245
60-64	21.48	29.360000000000003	27.145000000000003	22.015
65-69	21.63	28.92	27.04	22.41
70-74	21.085	27.655	28.785	22.475
75-79	21.92	28.075	27.715	22.29
80-84	21.695	29.110000000000003	26.97	22.225
85-89	21.59	28.535	27.805000000000003	22.07
90-94	22.285	27.839999999999996	27.685	22.189999999999998
95-99	21.560000000000002	28.705000000000002	27.275	22.46
100-104	22.274454890978195	28.325665133026607	28.185637127425483	21.214242848569715
105-109	21.605123586510558	27.284098869208446	29.15040528369859	21.96037226058241
110-114	21.94023126595585	28.482755168443713	27.97216799319217	21.60484557240827
115-119	22.012641717668306	27.74656366007826	28.21310324069429	22.027691381559144
120-124	21.807761914337423	28.353106776593606	27.971043635632416	21.868087673436555
125-129	22.34861831177329	28.283082498615798	27.79986912971259	21.568430059898326
130-134	21.82441631788614	27.966315364832838	28.32938328879028	21.879885028490747
135-139	21.995453397322557	28.178833038646122	27.673654963374588	22.152058600656733
140-144	21.668269474110442	28.253277319431085	28.157108872804574	21.921344333653895
145-149	22.562744998218196	28.488520083490304	27.735071017665327	21.21366390062618
150	21.115639327559858	29.77585328578706	26.897605705552724	22.210901681100356
>>END_MODULE
>>Per sequence GC content	pass
#GC Content	Count
0	0.0
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.5
10	0.5
11	0.0
12	0.0
13	0.0
14	0.0
15	0.0
16	0.0
17	0.0
18	0.0
19	0.5
20	1.5
21	2.0
22	2.0
23	2.5
24	3.0
25	6.0
26	7.5
27	5.0
28	11.5
29	14.5
30	16.5
31	25.0
32	35.0
33	53.5
34	60.5
35	84.0
36	107.5
37	109.5
38	132.5
39	155.0
40	186.5
41	231.0
42	246.5
43	261.0
44	287.0
45	287.0
46	263.0
47	237.0
48	212.0
49	176.5
50	160.5
51	143.5
52	102.5
53	77.0
54	67.5
55	59.5
56	42.5
57	35.0
58	28.5
59	19.5
60	15.0
61	8.5
62	7.5
63	4.5
64	1.5
65	1.5
66	1.0
67	0.0
68	0.0
69	0.0
70	0.0
71	0.0
72	0.0
73	0.0
74	0.0
75	0.0
76	0.0
77	0.0
78	0.0
79	0.0
80	0.0
81	0.0
82	0.0
83	0.0
84	0.0
85	0.0
86	0.0
87	0.0
88	0.0
89	0.0
90	0.0
91	0.0
92	0.0
93	0.0
94	0.0
95	0.0
96	0.0
97	0.0
98	0.5
99	0.5
100	0.0
>>END_MODULE
>>Per base N content	pass
#Base	N-Count
1	0.0
2	0.05
3	0.0
4	0.0
5	0.0
6	0.025
7	0.0
8	0.05
9	0.05
10-14	0.01
15-19	0.0
20-24	0.0
25-29	0.0
30-34	0.0
35-39	0.02
40-44	0.0
45-49	0.0
50-54	0.0
55-59	0.0
60-64	0.0
65-69	0.0
70-74	0.0
75-79	0.0
80-84	0.0
85-89	0.0
90-94	0.0
95-99	0.0
100-104	0.0
105-109	0.010006003602161296
110-114	0.0
115-119	0.0
120-124	0.0
125-129	0.0
130-134	0.0
135-139	0.0
140-144	0.0
145-149	0.0
150	0.0
>>END_MODULE
>>Sequence Length Distribution	warn
#Length	Count
102	2.0
103	0.0
104	0.0
105	0.0
106	0.0
107	1.0
108	0.0
109	1.0
110	0.0
111	0.0
112	0.0
113	3.0
114	1.0
115	1.0
116	4.0
117	3.0
118	4.0
119	1.0
120	0.0
121	0.0
122	1.0
123	1.0
124	0.0
125	1.0
126	2.0
127	3.0
128	2.0
129	0.0
130	1.0
131	2.0
132	2.0
133	0.0
134	3.0
135	0.0
136	3.0
137	0.0
138	1.0
139	3.0
140	0.0
141	0.0
142	4.0
143	5.0
144	6.0
145	13.0
146	0.0
147	0.0
148	0.0
149	0.0
150	3926.0
>>END_MODULE
>>Sequence Duplication Levels	pass
#Total Deduplicated Percentage	84.875
#Duplication Level	Percentage of deduplicated	Percentage of total
1	84.88954344624447	72.05
2	12.724594992636229	21.6
3	2.0618556701030926	5.25
4	0.3240058910162003	1.0999999999999999
5	0.0	0.0
6	0.0	0.0
7	0.0	0.0
8	0.0	0.0
9	0.0	0.0
>10	0.0	0.0
>50	0.0	0.0
>100	0.0	0.0
>500	0.0	0.0
>1k	0.0	0.0
>5k	0.0	0.0
>10k+	0.0	0.0
>>END_MODULE
>>Overrepresented sequences	pass
>>END_MODULE
>>Adapter Content	pass
#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
1	0.0	0.0	0.0	0.0	0.0
2	0.0	0.0	0.0	0.0	0.0
3	0.0	0.0	0.0	0.0	0.0
4	0.0	0.0	0.0	0.0	0.0
5	0.0	0.0	0.0	0.0	0.0
6	0.0	0.0	0.0	0.0	0.0
7	0.0	0.0	0.0	0.0	0.0
8	0.0	0.0	0.0	0.0	0.0
9	0.0	0.0	0.0	0.0	0.0
10-11	0.0	0.0	0.0	0.0	0.0
12-13	0.0	0.0	0.0	0.0	0.0
14-15	0.0	0.0	0.0	0.0	0.0
16-17	0.0	0.0	0.0	0.0	0.0
18-19	0.0	0.0	0.0	0.0	0.0
20-21	0.0	0.0	0.0	0.0	0.0
22-23	0.0	0.0	0.0	0.0	0.0
24-25	0.0	0.0	0.0	0.0	0.0
26-27	0.0	0.0	0.0	0.0	0.0
28-29	0.0	0.0	0.0	0.0	0.0
30-31	0.0	0.0	0.0	0.0	0.0
32-33	0.0	0.0	0.0	0.0	0.0
34-35	0.0	0.0	0.0	0.0	0.0
36-37	0.0	0.0	0.0	0.0	0.0
38-39	0.0	0.0	0.0	0.0	0.0
40-41	0.0	0.0	0.0	0.0	0.0
42-43	0.0	0.0	0.0	0.0	0.0
44-45	0.0	0.0	0.0	0.0	0.0
46-47	0.0	0.0	0.0	0.0	0.0
48-49	0.0	0.0	0.0	0.0	0.0
50-51	0.0	0.0	0.0	0.0	0.0
52-53	0.0	0.0	0.0	0.0	0.0
54-55	0.0	0.0	0.0	0.0	0.0
56-57	0.0	0.0	0.0	0.0	0.0
58-59	0.0	0.0	0.0	0.0	0.0
60-61	0.0	0.0	0.0	0.0	0.0
62-63	0.0	0.0	0.0	0.0	0.0
64-65	0.0	0.0	0.0	0.0	0.0
66-67	0.0	0.0	0.0	0.0	0.0
68-69	0.0	0.0	0.0	0.0	0.0
70-71	0.0	0.0	0.0	0.0	0.0
72-73	0.0	0.0	0.0	0.0	0.0
74-75	0.0	0.0	0.0	0.0	0.0
76-77	0.0	0.0	0.0	0.0	0.0
78-79	0.0	0.0	0.0	0.0	0.0
80-81	0.0	0.0	0.0	0.0	0.0
82-83	0.0	0.0	0.0	0.0	0.0
84-85	0.0	0.0	0.0	0.0	0.0
86-87	0.0	0.0	0.0	0.0	0.0
88-89	0.0	0.0	0.0	0.0	0.0
90-91	0.0	0.0	0.0	0.0	0.0
92-93	0.0	0.0	0.0	0.0	0.0
94-95	0.0	0.0	0.0	0.0	0.0
96-97	0.0	0.0	0.0	0.0	0.0
98-99	0.0	0.0	0.0	0.0	0.0
100-101	0.0	0.0	0.0	0.0	0.0
102-103	0.0	0.0	0.0	0.0	0.0
104-105	0.0	0.0	0.0	0.0	0.0
106-107	0.0	0.0	0.0	0.0	0.0
108-109	0.0	0.0	0.0	0.0	0.0
110-111	0.0	0.0	0.0	0.0	0.0
112-113	0.0	0.0	0.0	0.0	0.0
114-115	0.0	0.0	0.0	0.0	0.0
116-117	0.0	0.0	0.0	0.0	0.0
118-119	0.0	0.0	0.0	0.0	0.0
120-121	0.0	0.0	0.0	0.0	0.0
122-123	0.0	0.0	0.0	0.0	0.0
124-125	0.0	0.0	0.0	0.0	0.0
126-127	0.0	0.0	0.0	0.0	0.0
128-129	0.0	0.0	0.0	0.0	0.0
130-131	0.0	0.0	0.0	0.0	0.0
132-133	0.0	0.0	0.0	0.0	0.0
134-135	0.0	0.0	0.0	0.0	0.0
136-137	0.0	0.0	0.0	0.0	0.0
138	0.0	0.0	0.0	0.0	0.0
>>END_MODULE
>>Kmer Content	warn
#Sequence	Count	PValue	Obs/Exp Max	Max Obs/Exp Position
AAATTTA	10	0.007066775	143.3625	4
GAACAAG	10	0.007066775	143.3625	4
AGAAGAA	40	0.005879785	53.760937	7
>>END_MODULE
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140024 spots for SRR10828687.sra
Written 1140024 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
Read 1140010 spots for SRR10828687.sra
Written 1140010 spots for SRR10828687.sra
SRR ids: ['SRR10828687.sra']
extra args: ['--split-files', '--defline-qual', '+']
tempdir: /tmp/pfd_hjvco_qp
SRR10828687.sra spots: 22800214
blocks: [[1, 1140010], [1140011, 2280020], [2280021, 3420030], [3420031, 4560040], [4560041, 5700050], [5700051, 6840060], [6840061, 7980070], [7980071, 9120080], [9120081, 10260090], [10260091, 11400100], [11400101, 12540110], [12540111, 13680120], [13680121, 14820130], [14820131, 15960140], [15960141, 17100150], [17100151, 18240160], [18240161, 19380170], [19380171, 20520180], [20520181, 21660190], [21660191, 22800214]]
SRR10828687 file size 7665086
SRR10828687 completed basic pipeline successfully
skewer v0.2.2 [April 4, 2016]
COMMAND LINE:	skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10828687 SRR10828687_1.fastq SRR10828687_2.fastq
Input file:	SRR10828687_1.fastq
Paired file:	SRR10828687_2.fastq
trimmed:	SRR10828687-trimmed-pair1.fastq, SRR10828687-trimmed-pair2.fastq

Parameters used:
-- 3' end adapter sequence (-x):	AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
-- paired 3' end adapter sequence (-y):	AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
-- maximum error ratio allowed (-r):	0.100
-- maximum indel error ratio allowed (-d):	0.030
-- end quality threshold (-q):		10
-- minimum read length allowed after trimming (-l):	18
-- file format (-f):		Sanger/Illumina 1.8+ FASTQ 
-- number of concurrent threads (-t):	20
Thu Feb 13 19:42:30 2025 >> started

Thu Feb 13 19:42:56 2025 >> done (25.239s)
22800214 read pairs processed; of these:
       1 ( 0.00%) short read pairs filtered out after trimming by size control
      16 ( 0.00%) empty read pairs filtered out after trimming by size control
22800197 (100.00%) read pairs available; of these:
   93565 ( 0.41%) trimmed read pairs available after processing
22706632 (99.59%) untrimmed read pairs available after processing

Length distribution of reads after trimming:
length	count	percentage
 18	       1	  0.00%
 19	       0	  0.00%
 20	       0	  0.00%
 21	       1	  0.00%
 22	       1	  0.00%
 23	       1	  0.00%
 24	       1	  0.00%
 25	       0	  0.00%
 26	       1	  0.00%
 27	       3	  0.00%
 28	       6	  0.00%
 29	       5	  0.00%
 30	       2	  0.00%
 31	       5	  0.00%
 32	       0	  0.00%
 33	       4	  0.00%
 34	       5	  0.00%
 35	       2	  0.00%
 36	       5	  0.00%
 37	       3	  0.00%
 38	       2	  0.00%
 39	       7	  0.00%
 40	       9	  0.00%
 41	       8	  0.00%
 42	       6	  0.00%
 43	       9	  0.00%
 44	       8	  0.00%
 45	       3	  0.00%
 46	       9	  0.00%
 47	      12	  0.00%
 48	       7	  0.00%
 49	       8	  0.00%
 50	       7	  0.00%
 51	       5	  0.00%
 52	       4	  0.00%
 53	       1	  0.00%
 54	       8	  0.00%
 55	      13	  0.00%
 56	       7	  0.00%
 57	       7	  0.00%
 58	      12	  0.00%
 59	       6	  0.00%
 60	       5	  0.00%
 61	       5	  0.00%
 62	       8	  0.00%
 63	      10	  0.00%
 64	       6	  0.00%
 65	       7	  0.00%
 66	       8	  0.00%
 67	       6	  0.00%
 68	       6	  0.00%
 69	      11	  0.00%
 70	      15	  0.00%
 71	       7	  0.00%
 72	      10	  0.00%
 73	       8	  0.00%
 74	       7	  0.00%
 75	       4	  0.00%
 76	       6	  0.00%
 77	       7	  0.00%
 78	       9	  0.00%
 79	       7	  0.00%
 80	       3	  0.00%
 81	       7	  0.00%
 82	       9	  0.00%
 83	       6	  0.00%
 84	      14	  0.00%
 85	      11	  0.00%
 86	      10	  0.00%
 87	       7	  0.00%
 88	       6	  0.00%
 89	      10	  0.00%
 90	      13	  0.00%
 91	      10	  0.00%
 92	       7	  0.00%
 93	       7	  0.00%
 94	      11	  0.00%
 95	       5	  0.00%
 96	      12	  0.00%
 97	      10	  0.00%
 98	      19	  0.00%
 99	    2049	  0.01%
100	    2310	  0.01%
101	    2481	  0.01%
102	    2563	  0.01%
103	    2942	  0.01%
104	    2959	  0.01%
105	    3191	  0.01%
106	    3275	  0.01%
107	    3452	  0.02%
108	    3854	  0.02%
109	    3897	  0.02%
110	    4330	  0.02%
111	    4424	  0.02%
112	    4664	  0.02%
113	    4995	  0.02%
114	    5438	  0.02%
115	    5651	  0.02%
116	    5892	  0.03%
117	    6426	  0.03%
118	    6780	  0.03%
119	    7019	  0.03%
120	    7306	  0.03%
121	    7780	  0.03%
122	    8062	  0.04%
123	    8419	  0.04%
124	    8811	  0.04%
125	    9151	  0.04%
126	    9657	  0.04%
127	   10267	  0.05%
128	   10606	  0.05%
129	   11172	  0.05%
130	   11700	  0.05%
131	   12183	  0.05%
132	   12684	  0.06%
133	   13343	  0.06%
134	   13677	  0.06%
135	   14465	  0.06%
136	   15231	  0.07%
137	     136	  0.00%
138	   15653	  0.07%
139	   16623	  0.07%
140	   17306	  0.08%
141	   17731	  0.08%
142	   19062	  0.08%
143	   20590	  0.09%
144	   26466	  0.12%
145	   72906	  0.32%
146	   21511	  0.09%
147	   22511	  0.10%
148	   23313	  0.10%
149	   24232	  0.11%
150	22228518	 97.49%
22800197 reads passed initial QC


criterion=sequence-density
sequence-density=0.38
sequence-density-rank=1
fanout-score=2.10
fanout-score-rank=29
prefix-density=0.38
prefix-fanout=2.1
sequence=CATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCTGCAGATGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAGTAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAG


criterion=fanout-score
sequence-density=0.03
sequence-density-rank=31
fanout-score=64.31
fanout-score-rank=1
prefix-density=0.27
prefix-fanout=7.8
sequence=TCATCACCAGTCCTTGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTATCCGGTGCCGCTCCACCGCCCCTTCT


criterion=sequence-density
sequence-density=0.40
sequence-density-rank=1
fanout-score=2.08
fanout-score-rank=26
prefix-density=0.40
prefix-fanout=2.1
sequence=CATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCTGCAGATGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAGTAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAG


criterion=fanout-score
sequence-density=0.14
sequence-density-rank=15
fanout-score=18.03
fanout-score-rank=1
prefix-density=0.77
prefix-fanout=3.2
sequence=TGCAAGTGCAGTTAGCGCCGCACTTGCA
SRR10828687 testing PE reads STAR mapping to Ensembl genome
                                 Started job on |	Feb 13 19:43:41
                             Started mapping on |	Feb 13 19:43:42
                                    Finished on |	Feb 13 19:47:37
       Mapping speed, Million of reads per hour |	349.28

                          Number of input reads |	22800197
                      Average input read length |	299
                                    UNIQUE READS:
                   Uniquely mapped reads number |	20963348
                        Uniquely mapped reads % |	91.94%
                          Average mapped length |	295.30
                       Number of splices: Total |	21187758
            Number of splices: Annotated (sjdb) |	20566197
                       Number of splices: GT/AG |	20702642
                       Number of splices: GC/AG |	343127
                       Number of splices: AT/AC |	15817
               Number of splices: Non-canonical |	126172
                      Mismatch rate per base, % |	1.21%
                         Deletion rate per base |	0.10%
                        Deletion average length |	3.50
                        Insertion rate per base |	0.07%
                       Insertion average length |	2.78
                             MULTI-MAPPING READS:
        Number of reads mapped to multiple loci |	1006278
             % of reads mapped to multiple loci |	4.41%
        Number of reads mapped to too many loci |	62176
             % of reads mapped to too many loci |	0.27%
                                  UNMAPPED READS:
       % of reads unmapped: too many mismatches |	0.00%
                 % of reads unmapped: too short |	3.23%
                     % of reads unmapped: other |	0.14%
                                  CHIMERIC READS:
                       Number of chimeric reads |	0
                            % of chimeric reads |	0.00%
N_unmapped	830571	830571	830571
N_multimapping	1006278	1006278	1006278
N_noFeature	717257	10665338	10830541
N_ambiguous	338645	77607	77135
UnstrandedReadsAssigned:19907446 PositiveStrandReadsAssigned:10220403 NegativeStrandReadsAssigned:10055672
Dataset is classified unstranded
MeadianReadLen=150 20thPercentileLength=150 echo kmer=145
SRR10828687 Starting Kallisto paired end mapping to ensembl reference transcriptome

[quant] fragment length distribution will be estimated from the data
[index] k-mer length: 31
[index] number of targets: 52,400
[index] number of k-mers: 62,057,036
[index] number of equivalence classes: 130,681
[quant] running in paired-end mode
[quant] will process pair 1: SRR10828687-trimmed-pair1.fastq
                             SRR10828687-trimmed-pair2.fastq
[quant] finding pseudoalignments for the reads ... done
[quant] processed 22,800,197 reads, 19,387,301 reads pseudoaligned
[quant] estimated average fragment length: 242.123
[   em] quantifying the abundances ... done
[   em] the Expectation-Maximization algorithm ran for 1,128 rounds

  52401 SRR10828687.ke.tsv
  34699 SRR10828687.se.tsv
  87100 total
==> SRR10828687.ke.tsv <==
target_id	length	eff_length	est_counts	tpm
Potri.005G200100.1.v4.1	2018	1776.88	1348	30.7791
Potri.005G024800.1.v4.1	1035	793.877	495	25.2974
Potri.004G059700.1.v4.1	961	719.887	2	0.112717
Potri.007G009000.2.v4.1	1416	1174.88	0	0
Potri.003G141000.2.v4.1	2943	2701.88	774	11.6225
Potri.016G087400.1.v4.1	270	55.0198	1297.65	956.893
Potri.015G069301.1.v4.1	564	323.031	0	0
Potri.010G195200.1.v4.1	1773	1531.88	84	2.22474
Potri.012G127500.1.v4.1	977	735.887	17	0.937262

==> SRR10828687.se.tsv <==
Potri.001G166300.v4.1	1
Potri.001G448400.v4.1	10
Potri.001G233950.v4.1	0
Potri.001G122700.v4.1	345
Potri.001G212900.v4.1	0
Potri.001G182400.v4.1	0
Potri.001G256600.v4.1	0
Potri.001G040500.v4.1	3
Potri.001G416900.v4.1	0
Potri.001G452600.v4.1	59
SRR10828687 completed mapping pipeline successfully
