Starting /dee2/code/volunteer_pipeline.sh SRR10828688 current disk space = 3087321309184 free memory = 1402629100 SRR10828688 SRAfilesize eb111cfcceb167bc454da3ffa9b9c36b SRR10828688.sra SRR10828688.sra file validated SRR10828688 is paired end SRR10828688 is conventional basespace SRR10828688 read1 length is 100-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828688_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.417 37.0 37.0 37.0 37.0 37.0 2 36.4365 37.0 37.0 37.0 37.0 37.0 3 36.41 37.0 37.0 37.0 37.0 37.0 4 36.4085 37.0 37.0 37.0 37.0 37.0 5 36.499 37.0 37.0 37.0 37.0 37.0 6 36.371 37.0 37.0 37.0 37.0 37.0 7 36.433 37.0 37.0 37.0 37.0 37.0 8 36.4965 37.0 37.0 37.0 37.0 37.0 9 36.4455 37.0 37.0 37.0 37.0 37.0 10-14 36.4163 37.0 37.0 37.0 37.0 37.0 15-19 36.3471 37.0 37.0 37.0 37.0 37.0 20-24 36.344100000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.30069999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.1975 37.0 37.0 37.0 37.0 37.0 35-39 36.1581 37.0 37.0 37.0 37.0 37.0 40-44 36.1035 37.0 37.0 37.0 37.0 37.0 45-49 36.104699999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.1172 37.0 37.0 37.0 37.0 37.0 55-59 36.130100000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.029999999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.0193 37.0 37.0 37.0 37.0 37.0 70-74 36.0312 37.0 37.0 37.0 37.0 37.0 75-79 35.970600000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.937 37.0 37.0 37.0 37.0 37.0 85-89 35.8701 37.0 37.0 37.0 37.0 37.0 90-94 35.818 37.0 37.0 37.0 37.0 37.0 95-99 35.8127 37.0 37.0 37.0 37.0 37.0 100-104 35.81292732883132 37.0 37.0 37.0 37.0 37.0 105-109 35.72917328957018 37.0 37.0 37.0 37.0 37.0 110-114 35.73306360176448 37.0 37.0 37.0 37.0 37.0 115-119 35.64874927151678 37.0 37.0 37.0 37.0 37.0 120-124 35.494412455953054 37.0 37.0 37.0 37.0 37.0 125-129 35.60174433941207 37.0 37.0 37.0 37.0 37.0 130-134 35.48889208794328 37.0 37.0 37.0 37.0 37.0 135-139 35.4970350362179 37.0 37.0 37.0 37.0 37.0 140-144 35.47552482244445 37.0 37.0 37.0 37.0 37.0 145-149 35.32518903279528 37.0 37.0 37.0 34.6 37.0 150 35.03753910323253 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 5.0 24 9.0 25 7.0 26 6.0 27 20.0 28 25.0 29 32.0 30 45.0 31 50.0 32 74.0 33 92.0 34 147.0 35 345.0 36 2970.0 37 170.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.175000000000004 15.925 15.049999999999999 32.85 2 26.275 23.225 25.650000000000002 24.85 3 25.6 30.975 22.75 20.674999999999997 4 27.375 34.925 19.425 18.275 5 24.175 36.825 22.275 16.725 6 15.625 40.400000000000006 24.8 19.175 7 19.075 20.599999999999998 41.575 18.75 8 20.05 23.775 29.075 27.1 9 19.35 22.675 34.925 23.05 10-14 21.125 29.73 27.11 22.035 15-19 21.560000000000002 28.725 27.915 21.8 20-24 21.015 29.360000000000003 27.235 22.39 25-29 21.375 28.46 27.775 22.39 30-34 21.005 29.330000000000002 27.93 21.735 35-39 21.135 28.815 27.675 22.375 40-44 21.69 28.225 28.139999999999997 21.945 45-49 21.285 28.205000000000002 28.325 22.185 50-54 21.795 28.775000000000002 27.834999999999997 21.595 55-59 21.75 28.24 27.605 22.405 60-64 20.915 29.145 27.72 22.220000000000002 65-69 21.26 28.52 27.97 22.25 70-74 21.29 28.155 28.315 22.24 75-79 21.6 28.499999999999996 27.639999999999997 22.259999999999998 80-84 22.03 28.74 27.495000000000005 21.735 85-89 22.305 28.07 27.810000000000002 21.815 90-94 21.560000000000002 28.71 27.68 22.05 95-99 21.515 28.794999999999998 28.244999999999997 21.445 100-104 22.122653316645806 27.879849812265334 27.924906132665832 22.072590738423028 105-109 22.090165989669526 27.917356200792337 27.786971566120055 22.205506243418082 110-114 22.192526851898542 27.80999445312894 27.235136906862994 22.762341788109524 115-119 22.404537627874 27.91957864884027 28.086701104021067 21.589182619264662 120-124 22.293317083079423 27.224253503961 27.93520211253301 22.54722730042657 125-129 21.555544236744257 27.372281363011258 28.30438547343758 22.767788926806904 130-134 21.679217253214485 27.89303826648225 28.400184416781926 22.02756006352134 135-139 22.4317362184441 27.913446676970633 27.939206594538895 21.715610510046368 140-144 21.833496976900417 27.068368559764355 28.489483747609945 22.608650715725283 145-149 21.624296728485103 27.92769326943113 27.886017920400086 22.561992081683684 150 21.949947862356623 28.415015641293014 27.267987486965588 22.367049009384775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.5 15 2.5 16 1.5 17 0.0 18 0.0 19 0.0 20 1.5 21 2.5 22 2.0 23 3.0 24 4.5 25 5.5 26 8.5 27 12.5 28 12.5 29 17.0 30 27.5 31 29.0 32 41.0 33 53.0 34 63.0 35 68.0 36 95.0 37 125.0 38 127.0 39 156.5 40 195.5 41 233.0 42 243.0 43 245.5 44 261.5 45 256.0 46 272.0 47 267.0 48 217.0 49 178.0 50 146.0 51 133.0 52 109.5 53 78.5 54 63.5 55 46.0 56 35.0 57 28.0 58 26.5 59 26.5 60 19.0 61 13.0 62 11.0 63 7.5 64 4.0 65 4.5 66 4.0 67 1.5 68 0.5 69 1.0 70 2.0 71 1.5 72 1.0 73 1.0 74 0.5 75 1.0 76 1.5 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 6.0 102-103 3.0 104-105 0.0 106-107 3.0 108-109 11.0 110-111 11.0 112-113 8.0 114-115 7.0 116-117 4.0 118-119 5.0 120-121 3.0 122-123 4.0 124-125 4.0 126-127 7.0 128-129 9.0 130-131 9.0 132-133 12.0 134-135 10.0 136-137 4.0 138-139 6.0 140-141 1.0 142-143 9.0 144-145 28.0 146-147 0.0 148-149 0.0 150-151 3836.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.1 #Duplication Level Percentage of deduplicated Percentage of total 1 88.08172531214528 77.60000000000001 2 10.47105561861521 18.45 3 1.3053348467650396 3.45 4 0.14188422247446084 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0125 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 130-131 0.0 0.0 0.0 0.025 0.0 132-133 0.0 0.0 0.0 0.025 0.0 134-135 0.0 0.0 0.0 0.025 0.0 136-137 0.0 0.0 0.0 0.025 0.0 138 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGATCT 10 0.007146589 142.825 3 >>END_MODULE SRR10828688 read2 length is 100-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828688_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.253 37.0 37.0 37.0 37.0 37.0 2 35.993 37.0 37.0 37.0 37.0 37.0 3 36.013 37.0 37.0 37.0 37.0 37.0 4 36.153 37.0 37.0 37.0 37.0 37.0 5 36.291 37.0 37.0 37.0 37.0 37.0 6 36.1365 37.0 37.0 37.0 37.0 37.0 7 36.2495 37.0 37.0 37.0 37.0 37.0 8 36.1955 37.0 37.0 37.0 37.0 37.0 9 36.2125 37.0 37.0 37.0 37.0 37.0 10-14 36.167699999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.1609 37.0 37.0 37.0 37.0 37.0 20-24 36.157799999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.097699999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.045500000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.075399999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.0121 37.0 37.0 37.0 37.0 37.0 45-49 36.031800000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.9143 37.0 37.0 37.0 37.0 37.0 55-59 35.9345 37.0 37.0 37.0 37.0 37.0 60-64 35.885200000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.887 37.0 37.0 37.0 37.0 37.0 70-74 35.7839 37.0 37.0 37.0 37.0 37.0 75-79 35.7606 37.0 37.0 37.0 37.0 37.0 80-84 35.6974 37.0 37.0 37.0 37.0 37.0 85-89 35.678399999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.5527 37.0 37.0 37.0 37.0 37.0 95-99 35.618100000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.45077383109957 37.0 37.0 37.0 37.0 37.0 105-109 35.53680733907076 37.0 37.0 37.0 37.0 37.0 110-114 35.374636793292865 37.0 37.0 37.0 34.6 37.0 115-119 35.27624374985267 37.0 37.0 37.0 29.8 37.0 120-124 35.296166316222106 37.0 37.0 37.0 34.6 37.0 125-129 35.176437721284245 37.0 37.0 37.0 27.4 37.0 130-134 35.26490637827335 37.0 37.0 37.0 29.8 37.0 135-139 35.178050513077636 37.0 37.0 37.0 27.4 37.0 140-144 35.155894602184 37.0 37.0 37.0 27.4 37.0 145-149 34.70754377017424 37.0 37.0 37.0 25.0 37.0 150 34.93482794577685 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 1.0 20 2.0 21 2.0 22 1.0 23 6.0 24 1.0 25 10.0 26 18.0 27 15.0 28 15.0 29 27.0 30 39.0 31 49.0 32 73.0 33 103.0 34 241.0 35 801.0 36 2481.0 37 113.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.15 14.325 15.8 36.725 2 27.500000000000004 23.775 24.45 24.275 3 26.325 31.05 22.025 20.599999999999998 4 27.675 33.550000000000004 18.475 20.3 5 24.55 37.775 21.0 16.675 6 16.725 40.125 23.45 19.7 7 18.475 20.1 40.425 21.0 8 18.0 23.45 30.7 27.85 9 20.349999999999998 22.45 31.900000000000002 25.3 10-14 20.84 30.635 26.52 22.005 15-19 21.59 28.549999999999997 28.134999999999998 21.725 20-24 21.255 29.255 27.12 22.37 25-29 21.07 28.95 27.845 22.134999999999998 30-34 21.834999999999997 28.95 27.295 21.92 35-39 21.065 29.685 27.63 21.62 40-44 21.63 29.099999999999998 26.674999999999997 22.595000000000002 45-49 21.52 28.115000000000002 27.994999999999997 22.37 50-54 22.015 28.555000000000003 27.560000000000002 21.87 55-59 21.365000000000002 28.625 27.47 22.54 60-64 22.05 28.575 26.755000000000003 22.62 65-69 22.03 28.634999999999998 27.084999999999997 22.25 70-74 22.185 28.775000000000002 27.265 21.775 75-79 21.725 29.154999999999998 26.77 22.35 80-84 21.88 28.42 27.61 22.09 85-89 21.790000000000003 28.425 27.51 22.275 90-94 21.735 28.17 28.18 21.915000000000003 95-99 21.385 28.13 28.13 22.355 100-104 21.987484355444305 28.220275344180223 27.394242803504383 22.39799749687109 105-109 22.571586179228724 27.847149089814955 27.756882804272603 21.824381926683717 110-114 21.97065200948011 28.410065049669708 27.325903887852355 22.29337905299783 115-119 21.837334143624027 28.51716803403221 27.468854451534487 22.17664337080928 120-124 21.673776152752385 28.75279301239082 27.249644525695714 22.323786309161083 125-129 21.479142260479804 28.635460703916877 27.351907502674067 22.533489532929252 130-134 22.268326417704014 28.195276881307308 28.190154192920446 21.346242508068233 135-139 21.823802163833076 27.913446676970633 28.09891808346213 22.163833075734157 140-144 22.520799958658465 28.504986822386442 27.35259159733347 21.62162162162162 145-149 22.687018128776828 28.505938737236924 27.370285476140864 21.436757657845384 150 21.741397288842546 27.00729927007299 28.623566214807088 22.62773722627737 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 2.0 21 4.5 22 4.0 23 3.5 24 4.0 25 5.5 26 7.5 27 9.5 28 12.0 29 20.5 30 24.0 31 25.0 32 39.0 33 48.5 34 58.5 35 74.5 36 83.0 37 102.5 38 136.5 39 162.0 40 195.5 41 221.0 42 220.0 43 222.5 44 256.0 45 277.5 46 265.5 47 237.0 48 227.0 49 204.5 50 160.5 51 133.5 52 116.0 53 100.0 54 69.0 55 59.0 56 53.5 57 37.5 58 28.0 59 21.5 60 15.0 61 9.5 62 6.5 63 4.0 64 5.0 65 5.5 66 2.0 67 2.5 68 2.5 69 0.5 70 2.0 71 3.5 72 1.5 73 0.0 74 1.0 75 1.0 76 0.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 6.0 102-103 3.0 104-105 0.0 106-107 3.0 108-109 11.0 110-111 11.0 112-113 8.0 114-115 7.0 116-117 4.0 118-119 5.0 120-121 3.0 122-123 4.0 124-125 4.0 126-127 7.0 128-129 9.0 130-131 9.0 132-133 12.0 134-135 10.0 136-137 4.0 138-139 6.0 140-141 1.0 142-143 9.0 144-145 28.0 146-147 0.0 148-149 0.0 150-151 3836.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.275 #Duplication Level Percentage of deduplicated Percentage of total 1 88.1053525913339 77.775 2 10.59190031152648 18.7 3 1.2177853299348627 3.225 4 0.08496176720475786 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTACGA 10 0.007146589 142.825 2 >>END_MODULE Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292744 spots for SRR10828688.sra Written 1292744 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra Read 1292729 spots for SRR10828688.sra Written 1292729 spots for SRR10828688.sra SRR ids: ['SRR10828688.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uyu65css SRR10828688.sra spots: 25854595 blocks: [[1, 1292729], [1292730, 2585458], [2585459, 3878187], [3878188, 5170916], [5170917, 6463645], [6463646, 7756374], [7756375, 9049103], [9049104, 10341832], [10341833, 11634561], [11634562, 12927290], [12927291, 14220019], [14220020, 15512748], [15512749, 16805477], [16805478, 18098206], [18098207, 19390935], [19390936, 20683664], [20683665, 21976393], [21976394, 23269122], [23269123, 24561851], [24561852, 25854595]] SRR10828688 file size 8672231 SRR10828688 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10828688 SRR10828688_1.fastq SRR10828688_2.fastq Input file: SRR10828688_1.fastq Paired file: SRR10828688_2.fastq trimmed: SRR10828688-trimmed-pair1.fastq, SRR10828688-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:34:51 2025 >> started Thu Feb 13 19:35:19 2025 >> done (28.677s) 25854595 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 87 ( 0.00%) empty read pairs filtered out after trimming by size control 25854507 (100.00%) read pairs available; of these: 115998 ( 0.45%) trimmed read pairs available after processing 25738509 (99.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 0 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 3 0.00% 27 7 0.00% 28 4 0.00% 29 6 0.00% 30 2 0.00% 31 8 0.00% 32 5 0.00% 33 9 0.00% 34 10 0.00% 35 3 0.00% 36 11 0.00% 37 10 0.00% 38 10 0.00% 39 9 0.00% 40 8 0.00% 41 11 0.00% 42 12 0.00% 43 15 0.00% 44 9 0.00% 45 12 0.00% 46 12 0.00% 47 12 0.00% 48 11 0.00% 49 8 0.00% 50 16 0.00% 51 17 0.00% 52 18 0.00% 53 14 0.00% 54 9 0.00% 55 21 0.00% 56 20 0.00% 57 18 0.00% 58 15 0.00% 59 22 0.00% 60 21 0.00% 61 16 0.00% 62 17 0.00% 63 17 0.00% 64 15 0.00% 65 20 0.00% 66 27 0.00% 67 15 0.00% 68 15 0.00% 69 21 0.00% 70 27 0.00% 71 17 0.00% 72 22 0.00% 73 15 0.00% 74 23 0.00% 75 25 0.00% 76 21 0.00% 77 28 0.00% 78 15 0.00% 79 21 0.00% 80 29 0.00% 81 31 0.00% 82 33 0.00% 83 19 0.00% 84 21 0.00% 85 15 0.00% 86 29 0.00% 87 29 0.00% 88 31 0.00% 89 23 0.00% 90 21 0.00% 91 29 0.00% 92 30 0.00% 93 46 0.00% 94 57 0.00% 95 60 0.00% 96 62 0.00% 97 64 0.00% 98 42 0.00% 99 9249 0.04% 100 10053 0.04% 101 10900 0.04% 102 12180 0.05% 103 12694 0.05% 104 12604 0.05% 105 12591 0.05% 106 12236 0.05% 107 12645 0.05% 108 12633 0.05% 109 12903 0.05% 110 14060 0.05% 111 15086 0.06% 112 15970 0.06% 113 16706 0.06% 114 17199 0.07% 115 17082 0.07% 116 16401 0.06% 117 15881 0.06% 118 16246 0.06% 119 17004 0.07% 120 17473 0.07% 121 18517 0.07% 122 19653 0.08% 123 20730 0.08% 124 21151 0.08% 125 21327 0.08% 126 20345 0.08% 127 19711 0.08% 128 19503 0.08% 129 19893 0.08% 130 20883 0.08% 131 22034 0.09% 132 23928 0.09% 133 25148 0.10% 134 25534 0.10% 135 25342 0.10% 136 24890 0.10% 137 303 0.00% 138 23363 0.09% 139 22902 0.09% 140 23129 0.09% 141 24048 0.09% 142 25944 0.10% 143 28587 0.11% 144 36296 0.14% 145 91165 0.35% 146 29421 0.11% 147 27859 0.11% 148 26665 0.10% 149 26192 0.10% 150 24808790 95.96% 25854507 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=40 prefix-density=0.15 prefix-fanout=2.0 sequence=CCGGGAGGTGGCTTCTTTCCGGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=385.05 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=31.1 sequence=TCATCATCACCGTTCTATAGAACACAAGAATACTGCCTGCTGCCCTACTGGGAAGCACTCTCCTTTTC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=41 prefix-density=0.15 prefix-fanout=2.0 sequence=CCGGGAGGTGGCTTCTTTCCGGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=384.57 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=30.5 sequence=TCATCATCACCGTTCTATAGAACACAAGAATACTGCCTGCTGCCCTACTGGGAAGCACTCTCCTTTTC SRR10828688 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:36:09 Started mapping on | Feb 13 19:36:09 Finished on | Feb 13 19:40:42 Mapping speed, Million of reads per hour | 340.94 Number of input reads | 25854507 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 22376755 Uniquely mapped reads % | 86.55% Average mapped length | 293.56 Number of splices: Total | 20009094 Number of splices: Annotated (sjdb) | 19387890 Number of splices: GT/AG | 19589254 Number of splices: GC/AG | 260086 Number of splices: AT/AC | 27625 Number of splices: Non-canonical | 132129 Mismatch rate per base, % | 1.24% Deletion rate per base | 0.10% Deletion average length | 3.24 Insertion rate per base | 0.07% Insertion average length | 3.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1075368 % of reads mapped to multiple loci | 4.16% Number of reads mapped to too many loci | 186004 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.22% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2402384 2402384 2402384 N_multimapping 1075368 1075368 1075368 N_noFeature 803962 11509258 11560413 N_ambiguous 289644 89971 89892 UnstrandedReadsAssigned:21283149 PositiveStrandReadsAssigned:10777526 NegativeStrandReadsAssigned:10726450 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR10828688 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR10828688-trimmed-pair1.fastq SRR10828688-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,854,507 reads, 21,150,421 reads pseudoaligned [quant] estimated average fragment length: 278.182 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR10828688.ke.tsv 34699 SRR10828688.se.tsv 87100 total ==> SRR10828688.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.82 1758 44.5503 Potri.005G024800.1.v4.1 1035 757.818 11474 667.936 Potri.004G059700.1.v4.1 961 683.823 39 2.51597 Potri.007G009000.2.v4.1 1416 1138.82 0 0 Potri.003G141000.2.v4.1 2943 2665.82 1175.1 19.4459 Potri.016G087400.1.v4.1 270 65.9101 872.211 583.787 Potri.015G069301.1.v4.1 564 287.834 0 0 Potri.010G195200.1.v4.1 1773 1495.82 81 2.38886 Potri.012G127500.1.v4.1 977 699.823 9602 605.283 ==> SRR10828688.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 121 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 703 SRR10828688 completed mapping pipeline successfully