Starting /dee2/code/volunteer_pipeline.sh SRR10828689 current disk space = 3087450988544 free memory = 1417261420 SRR10828689 SRAfilesize f1e81a27ed990b14b5f3ecb029033176 SRR10828689.sra SRR10828689.sra file validated SRR10828689 is paired end SRR10828689 is conventional basespace SRR10828689 read1 length is 100-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828689_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.38625 37.0 37.0 37.0 37.0 37.0 2 36.5265 37.0 37.0 37.0 37.0 37.0 3 36.56 37.0 37.0 37.0 37.0 37.0 4 36.4545 37.0 37.0 37.0 37.0 37.0 5 36.521 37.0 37.0 37.0 37.0 37.0 6 36.5185 37.0 37.0 37.0 37.0 37.0 7 36.3615 37.0 37.0 37.0 37.0 37.0 8 36.585 37.0 37.0 37.0 37.0 37.0 9 36.5555 37.0 37.0 37.0 37.0 37.0 10-14 36.491 37.0 37.0 37.0 37.0 37.0 15-19 36.5059 37.0 37.0 37.0 37.0 37.0 20-24 36.432900000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4471 37.0 37.0 37.0 37.0 37.0 30-34 36.3951 37.0 37.0 37.0 37.0 37.0 35-39 36.3712 37.0 37.0 37.0 37.0 37.0 40-44 36.287 37.0 37.0 37.0 37.0 37.0 45-49 36.2767 37.0 37.0 37.0 37.0 37.0 50-54 36.2603 37.0 37.0 37.0 37.0 37.0 55-59 36.23909999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.242399999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.1882 37.0 37.0 37.0 37.0 37.0 70-74 36.1953 37.0 37.0 37.0 37.0 37.0 75-79 36.1612 37.0 37.0 37.0 37.0 37.0 80-84 36.165099999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.09259999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.0378 37.0 37.0 37.0 37.0 37.0 95-99 36.015100000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.03426912484865 37.0 37.0 37.0 37.0 37.0 105-109 35.952855907476504 37.0 37.0 37.0 37.0 37.0 110-114 35.95630418209706 37.0 37.0 37.0 37.0 37.0 115-119 35.92001473942128 37.0 37.0 37.0 37.0 37.0 120-124 35.87542280766785 37.0 37.0 37.0 37.0 37.0 125-129 35.92453061341821 37.0 37.0 37.0 37.0 37.0 130-134 35.73131904694243 37.0 37.0 37.0 37.0 37.0 135-139 35.61512729568917 37.0 37.0 37.0 37.0 37.0 140-144 35.65512800614989 37.0 37.0 37.0 37.0 37.0 145-149 35.63822996644467 37.0 37.0 37.0 37.0 37.0 150 35.65191965420799 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 1.0 23 2.0 24 1.0 25 5.0 26 6.0 27 10.0 28 20.0 29 22.0 30 36.0 31 36.0 32 59.0 33 76.0 34 126.0 35 333.0 36 3000.0 37 264.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.734668335419272 17.521902377972467 18.122653316645806 36.62077596996245 2 24.425 26.450000000000003 33.95 15.174999999999999 3 23.025000000000002 32.0 25.224999999999998 19.75 4 22.975 38.574999999999996 19.650000000000002 18.8 5 22.45 37.125 23.275000000000002 17.150000000000002 6 15.950000000000001 38.675 23.575 21.8 7 16.325 16.45 44.65 22.575 8 20.200000000000003 21.725 28.849999999999998 29.225 9 21.275 22.725 29.349999999999998 26.650000000000002 10-14 21.560000000000002 29.054999999999996 26.840000000000003 22.545 15-19 21.145 28.139999999999997 28.134999999999998 22.58 20-24 21.27 28.655 27.49 22.585 25-29 22.009999999999998 28.93 27.224999999999998 21.834999999999997 30-34 21.63 28.53 27.860000000000003 21.98 35-39 20.665 28.485 28.349999999999998 22.5 40-44 21.2 28.375 28.34 22.085 45-49 21.13 28.410000000000004 27.615000000000002 22.845 50-54 21.36 28.384999999999998 28.08 22.175 55-59 21.310000000000002 28.625 28.07 21.995 60-64 21.55 28.675 27.644999999999996 22.13 65-69 22.115000000000002 27.615000000000002 28.285 21.985 70-74 22.205 27.79 27.589999999999996 22.415 75-79 22.06 28.155 27.33 22.455 80-84 21.795 28.470000000000002 27.88 21.855 85-89 22.16 27.875 27.839999999999996 22.125 90-94 21.72 27.57 28.249999999999996 22.46 95-99 21.57 28.105000000000004 28.025 22.3 100-104 22.064929218148166 28.127657445850634 27.092191486168776 22.715221849832425 105-109 22.114903413071765 27.950155139625664 28.305474927434695 21.629466519867883 110-114 22.080328525641026 27.879607371794872 27.939703525641026 22.100360576923077 115-119 21.78207892493607 27.794213508499222 28.215413929699647 22.208293636865065 120-124 22.069969382121165 27.771921899312353 27.962656226471914 22.195452492094564 125-129 22.560209160842675 27.960178993413443 27.56800241339434 21.91160943234954 130-134 21.689842805320435 27.96251511487304 28.28496573962112 22.06267634018541 135-139 22.380904319741624 27.982438433589017 27.462656439241016 22.17400080742834 140-144 21.743527508090615 27.851941747572816 28.873381877022652 21.531148867313917 145-149 22.46505717916137 28.106734434561627 28.543837357052098 20.884371029224905 150 21.942537503178237 27.45995423340961 28.019323671497588 22.578184591914567 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 2.5 22 3.0 23 1.0 24 3.5 25 5.5 26 5.5 27 6.5 28 9.0 29 16.5 30 16.0 31 18.0 32 30.5 33 37.0 34 58.0 35 86.0 36 97.5 37 113.0 38 141.0 39 163.5 40 196.5 41 240.0 42 253.5 43 272.0 44 285.0 45 274.5 46 262.0 47 237.0 48 203.5 49 181.5 50 156.5 51 130.0 52 108.5 53 81.0 54 61.5 55 58.5 56 52.0 57 35.0 58 22.5 59 12.5 60 11.5 61 10.0 62 8.0 63 8.0 64 6.0 65 2.5 66 1.0 67 0.5 68 1.5 69 2.0 70 2.0 71 1.5 72 1.0 73 0.5 74 0.0 75 1.0 76 1.5 77 0.5 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 2.0 102-103 1.0 104-105 0.0 106-107 1.0 108-109 1.0 110-111 0.0 112-113 5.0 114-115 0.0 116-117 2.0 118-119 1.0 120-121 3.0 122-123 1.0 124-125 5.0 126-127 2.0 128-129 2.0 130-131 6.0 132-133 1.0 134-135 3.0 136-137 2.0 138-139 2.0 140-141 5.0 142-143 7.0 144-145 15.0 146-147 0.0 148-149 0.0 150-151 3933.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.14959928762245 70.875 2 13.446126447016917 22.650000000000002 3 2.0480854853072126 5.175 4 0.23745918670228555 0.8 5 0.11872959335114278 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAGGAACTCAACTGATCTCTTCCGAAGTTTTGGATTTGATACACAGCCAG 5 0.125 No Hit TTATTGTAGGAAAGGTGCTTCCTTCGGAAGCTGATGCACATCCAACCTGA 5 0.125 No Hit AGAGTAACCTAGCAGTATAATCCTTTCGAGGATGCTCTTTGATGAAAATT 5 0.125 No Hit ATTTTCTGATAAAACAAAGTTGCTGGATAAATCCCACAGCTCCACCACCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTCTT 10 0.006973645 144.0 8 GCAAAAC 10 0.006973645 144.0 1 AAGATAG 10 0.006973645 144.0 5 CCAAGAT 10 0.006973645 144.0 3 AGATAGC 10 0.006973645 144.0 6 CAAGATA 20 3.687869E-4 108.0 4 >>END_MODULE SRR10828689 read2 length is 100-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828689_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8435 37.0 37.0 37.0 37.0 37.0 2 35.79 37.0 37.0 37.0 37.0 37.0 3 35.938 37.0 37.0 37.0 37.0 37.0 4 35.769 37.0 37.0 37.0 37.0 37.0 5 36.16 37.0 37.0 37.0 37.0 37.0 6 36.1635 37.0 37.0 37.0 37.0 37.0 7 36.053 37.0 37.0 37.0 37.0 37.0 8 36.177 37.0 37.0 37.0 37.0 37.0 9 36.1465 37.0 37.0 37.0 37.0 37.0 10-14 36.2196 37.0 37.0 37.0 37.0 37.0 15-19 36.0807 37.0 37.0 37.0 37.0 37.0 20-24 36.154799999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.156600000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.1467 37.0 37.0 37.0 37.0 37.0 35-39 36.069599999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.131800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.023900000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.017900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.006 37.0 37.0 37.0 37.0 37.0 60-64 35.920100000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.904999999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.9498 37.0 37.0 37.0 37.0 37.0 75-79 35.7958 37.0 37.0 37.0 37.0 37.0 80-84 35.6896 37.0 37.0 37.0 37.0 37.0 85-89 35.806799999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.5142 37.0 37.0 37.0 37.0 37.0 95-99 35.6638 37.0 37.0 37.0 37.0 37.0 100-104 35.71201517320274 37.0 37.0 37.0 37.0 37.0 105-109 35.682393891181235 37.0 37.0 37.0 37.0 37.0 110-114 35.515302427049576 37.0 37.0 37.0 37.0 37.0 115-119 35.42997732366316 37.0 37.0 37.0 34.6 37.0 120-124 35.586444877836136 37.0 37.0 37.0 34.6 37.0 125-129 35.38202883245903 37.0 37.0 37.0 34.6 37.0 130-134 35.40049268703224 37.0 37.0 37.0 34.6 37.0 135-139 35.339005549963126 37.0 37.0 37.0 32.2 37.0 140-144 35.211178081595406 37.0 37.0 37.0 29.8 37.0 145-149 35.37649296783771 37.0 37.0 37.0 34.6 37.0 150 35.34477498093059 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 6.0 23 5.0 24 4.0 25 10.0 26 14.0 27 19.0 28 20.0 29 27.0 30 30.0 31 43.0 32 70.0 33 87.0 34 213.0 35 765.0 36 2508.0 37 179.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.900000000000002 19.025 19.25 34.825 2 23.65 26.474999999999998 35.4 14.475 3 20.849999999999998 32.975 25.124999999999996 21.05 4 23.175 37.275000000000006 20.8 18.75 5 22.175 38.35 22.3 17.175 6 17.349999999999998 38.375 23.35 20.925 7 15.475 17.25 42.575 24.7 8 19.400000000000002 21.9 30.049999999999997 28.65 9 20.150000000000002 23.200000000000003 29.975 26.674999999999997 10-14 20.95 29.335 27.305 22.41 15-19 21.275 28.375 27.49 22.86 20-24 22.145 28.015 27.755000000000003 22.085 25-29 21.42 29.349999999999998 27.05 22.18 30-34 20.315 28.22 28.62 22.845 35-39 21.560000000000002 28.804999999999996 27.49 22.145 40-44 21.265 28.89 27.205000000000002 22.64 45-49 21.14 28.77 27.98 22.11 50-54 21.675 29.04 27.015 22.27 55-59 22.145 28.744999999999997 26.71 22.400000000000002 60-64 21.425 28.625 27.33 22.62 65-69 21.775 28.884999999999998 27.275 22.065 70-74 21.615000000000002 28.645 27.765 21.975 75-79 21.775 28.675 27.034999999999997 22.515 80-84 21.805 28.845 27.36 21.990000000000002 85-89 21.84 28.68 27.49 21.990000000000002 90-94 21.445 29.154999999999998 26.93 22.470000000000002 95-99 21.92 28.110000000000003 27.58 22.39 100-104 22.485118303236458 27.51738282227002 27.927567405332397 22.069931469161123 105-109 22.00980882794515 28.050245220698628 27.334601141026926 22.6053448103293 110-114 22.435897435897438 27.954727564102566 27.689302884615387 21.920072115384613 115-119 21.731936017650302 29.067843353557638 27.282755854184426 21.91746477460763 120-124 21.713597349796718 27.90744365808362 28.198564473221904 22.180394518897756 125-129 22.208255819799888 28.40766252702499 27.87973251546081 21.504349137714314 130-134 22.203748488512694 27.866787585650947 27.655179363160016 22.274284562676343 135-139 22.542389987888576 28.20448122729108 27.614049253128787 21.639079531691564 140-144 22.299757281553397 27.609223300970875 28.393001618122977 21.69801779935275 145-149 21.799237611181702 28.335451080050827 27.756035578144854 22.109275730622617 150 22.527332824815662 29.112636664124082 27.307398932112893 21.052631578947366 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.5 25 3.0 26 5.5 27 12.0 28 13.0 29 15.0 30 20.5 31 19.0 32 32.5 33 47.5 34 56.0 35 75.0 36 101.0 37 125.0 38 145.0 39 165.0 40 184.0 41 224.5 42 246.0 43 257.0 44 269.5 45 273.0 46 276.0 47 256.0 48 228.5 49 185.5 50 154.5 51 128.0 52 97.5 53 76.5 54 64.0 55 52.5 56 41.5 57 39.5 58 30.5 59 26.0 60 19.5 61 9.0 62 4.5 63 2.5 64 1.5 65 2.0 66 1.5 67 0.5 68 1.5 69 1.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 2.0 102-103 1.0 104-105 0.0 106-107 1.0 108-109 1.0 110-111 0.0 112-113 5.0 114-115 0.0 116-117 2.0 118-119 1.0 120-121 3.0 122-123 1.0 124-125 5.0 126-127 2.0 128-129 2.0 130-131 6.0 132-133 1.0 134-135 3.0 136-137 2.0 138-139 2.0 140-141 5.0 142-143 7.0 144-145 15.0 146-147 0.0 148-149 0.0 150-151 3933.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.70830878020035 71.875 2 13.111373011196228 22.25 3 1.8562168532704773 4.725 4 0.26517383618149676 0.8999999999999999 5 0.05892751915144372 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCTTTTCAAAGGGCTGGAACTATTATACCCAGGAAAGACCGGCTTCG 5 0.125 No Hit GGTGAAGGTTTCCATCACTGGTGGAGGAAGTGAAAACCTGATTGTTTTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATGA 10 0.006973645 144.0 5 GAATGCT 10 0.006973645 144.0 4 AAGAATG 10 0.006973645 144.0 2 AATGCTA 10 0.006973645 144.0 5 >>END_MODULE Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150653 spots for SRR10828689.sra Written 1150653 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra Read 1150634 spots for SRR10828689.sra Written 1150634 spots for SRR10828689.sra SRR ids: ['SRR10828689.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3hi8xlya SRR10828689.sra spots: 23012699 blocks: [[1, 1150634], [1150635, 2301268], [2301269, 3451902], [3451903, 4602536], [4602537, 5753170], [5753171, 6903804], [6903805, 8054438], [8054439, 9205072], [9205073, 10355706], [10355707, 11506340], [11506341, 12656974], [12656975, 13807608], [13807609, 14958242], [14958243, 16108876], [16108877, 17259510], [17259511, 18410144], [18410145, 19560778], [19560779, 20711412], [20711413, 21862046], [21862047, 23012699]] SRR10828689 file size 7739855 SRR10828689 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10828689 SRR10828689_1.fastq SRR10828689_2.fastq Input file: SRR10828689_1.fastq Paired file: SRR10828689_2.fastq trimmed: SRR10828689-trimmed-pair1.fastq, SRR10828689-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:51:10 2025 >> started Thu Feb 13 19:51:39 2025 >> done (28.918s) 23012699 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 15 ( 0.00%) empty read pairs filtered out after trimming by size control 23012683 (100.00%) read pairs available; of these: 76356 ( 0.33%) trimmed read pairs available after processing 22936327 (99.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 4 0.00% 24 2 0.00% 25 5 0.00% 26 2 0.00% 27 2 0.00% 28 0 0.00% 29 1 0.00% 30 2 0.00% 31 3 0.00% 32 4 0.00% 33 8 0.00% 34 2 0.00% 35 5 0.00% 36 2 0.00% 37 5 0.00% 38 4 0.00% 39 6 0.00% 40 3 0.00% 41 1 0.00% 42 5 0.00% 43 4 0.00% 44 6 0.00% 45 6 0.00% 46 7 0.00% 47 2 0.00% 48 7 0.00% 49 5 0.00% 50 9 0.00% 51 4 0.00% 52 6 0.00% 53 2 0.00% 54 8 0.00% 55 6 0.00% 56 3 0.00% 57 9 0.00% 58 7 0.00% 59 5 0.00% 60 4 0.00% 61 7 0.00% 62 8 0.00% 63 4 0.00% 64 5 0.00% 65 10 0.00% 66 7 0.00% 67 7 0.00% 68 5 0.00% 69 9 0.00% 70 6 0.00% 71 5 0.00% 72 9 0.00% 73 10 0.00% 74 7 0.00% 75 8 0.00% 76 7 0.00% 77 6 0.00% 78 7 0.00% 79 1 0.00% 80 10 0.00% 81 8 0.00% 82 11 0.00% 83 6 0.00% 84 14 0.00% 85 5 0.00% 86 4 0.00% 87 2 0.00% 88 4 0.00% 89 5 0.00% 90 8 0.00% 91 6 0.00% 92 11 0.00% 93 8 0.00% 94 7 0.00% 95 12 0.00% 96 15 0.00% 97 10 0.00% 98 7 0.00% 99 1766 0.01% 100 1905 0.01% 101 2082 0.01% 102 2315 0.01% 103 2375 0.01% 104 2559 0.01% 105 2717 0.01% 106 2934 0.01% 107 2950 0.01% 108 3196 0.01% 109 3291 0.01% 110 3565 0.02% 111 3913 0.02% 112 3864 0.02% 113 4216 0.02% 114 4529 0.02% 115 4615 0.02% 116 5059 0.02% 117 4981 0.02% 118 5465 0.02% 119 5546 0.02% 120 5835 0.03% 121 6182 0.03% 122 6537 0.03% 123 6960 0.03% 124 7389 0.03% 125 7372 0.03% 126 7996 0.03% 127 8484 0.04% 128 8451 0.04% 129 8766 0.04% 130 9373 0.04% 131 9811 0.04% 132 10388 0.05% 133 10820 0.05% 134 11276 0.05% 135 11764 0.05% 136 12126 0.05% 137 104 0.00% 138 12713 0.06% 139 13487 0.06% 140 13843 0.06% 141 14820 0.06% 142 15393 0.07% 143 16399 0.07% 144 22406 0.10% 145 69761 0.30% 146 17731 0.08% 147 18303 0.08% 148 18685 0.08% 149 19896 0.09% 150 22535321 97.93% 23012683 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=32 prefix-density=0.43 prefix-fanout=2.0 sequence=CATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCTGCAGATGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAGTAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=22.36 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=5.7 sequence=CAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCAGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCGGAGACCTTTGCCAAGAACCGTGAGCTTGAAGTCATCCATTC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=32 prefix-density=0.44 prefix-fanout=2.1 sequence=CATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCTGCAGATGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAGTAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=25.81 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=8.8 sequence=CCATCTTCTTCATCTATATATAGATTTCAATCACAACAGAGCTTAGTAGGCGTAGTTCTTGACGAACATTCCTTTC SRR10828689 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:52:27 Started mapping on | Feb 13 19:52:28 Finished on | Feb 13 19:56:24 Mapping speed, Million of reads per hour | 351.04 Number of input reads | 23012683 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21176048 Uniquely mapped reads % | 92.02% Average mapped length | 295.60 Number of splices: Total | 21605766 Number of splices: Annotated (sjdb) | 20988524 Number of splices: GT/AG | 21112233 Number of splices: GC/AG | 351573 Number of splices: AT/AC | 16423 Number of splices: Non-canonical | 125537 Mismatch rate per base, % | 1.21% Deletion rate per base | 0.10% Deletion average length | 3.52 Insertion rate per base | 0.07% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1021430 % of reads mapped to multiple loci | 4.44% Number of reads mapped to too many loci | 54946 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.17% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 815205 815205 815205 N_multimapping 1021430 1021430 1021430 N_noFeature 647157 10741633 10874761 N_ambiguous 361607 78255 77407 UnstrandedReadsAssigned:20167284 PositiveStrandReadsAssigned:10356160 NegativeStrandReadsAssigned:10223880 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR10828689 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR10828689-trimmed-pair1.fastq SRR10828689-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,012,683 reads, 19,604,637 reads pseudoaligned [quant] estimated average fragment length: 245.151 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR10828689.ke.tsv 34699 SRR10828689.se.tsv 87100 total ==> SRR10828689.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.85 1288 27.6154 Potri.005G024800.1.v4.1 1035 790.849 453 21.785 Potri.004G059700.1.v4.1 961 716.849 1 0.0530548 Potri.007G009000.2.v4.1 1416 1171.85 0 0 Potri.003G141000.2.v4.1 2943 2698.85 843.393 11.8851 Potri.016G087400.1.v4.1 270 52.5049 1404 1017 Potri.015G069301.1.v4.1 564 320.046 0 0 Potri.010G195200.1.v4.1 1773 1528.85 72 1.7911 Potri.012G127500.1.v4.1 977 732.849 21 1.08983 ==> SRR10828689.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 340 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 46 SRR10828689 completed mapping pipeline successfully