Starting /dee2/code/volunteer_pipeline.sh SRR10828690 current disk space = 3087392276480 free memory = 1413171832 SRR10828690 SRAfilesize 362321242a3df2786e10b18f4a4aadee SRR10828690.sra SRR10828690.sra file validated SRR10828690 is paired end SRR10828690 is conventional basespace SRR10828690 read1 length is 100-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828690_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.412 37.0 37.0 37.0 37.0 37.0 2 36.46325 37.0 37.0 37.0 37.0 37.0 3 36.5105 37.0 37.0 37.0 37.0 37.0 4 36.488 37.0 37.0 37.0 37.0 37.0 5 36.5725 37.0 37.0 37.0 37.0 37.0 6 36.5915 37.0 37.0 37.0 37.0 37.0 7 36.4835 37.0 37.0 37.0 37.0 37.0 8 36.5485 37.0 37.0 37.0 37.0 37.0 9 36.4975 37.0 37.0 37.0 37.0 37.0 10-14 36.4862 37.0 37.0 37.0 37.0 37.0 15-19 36.493399999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.452600000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.471999999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.3688 37.0 37.0 37.0 37.0 37.0 35-39 36.3985 37.0 37.0 37.0 37.0 37.0 40-44 36.3257 37.0 37.0 37.0 37.0 37.0 45-49 36.2945 37.0 37.0 37.0 37.0 37.0 50-54 36.348 37.0 37.0 37.0 37.0 37.0 55-59 36.2505 37.0 37.0 37.0 37.0 37.0 60-64 36.26460000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.1752 37.0 37.0 37.0 37.0 37.0 70-74 36.2302 37.0 37.0 37.0 37.0 37.0 75-79 36.1571 37.0 37.0 37.0 37.0 37.0 80-84 36.2053 37.0 37.0 37.0 37.0 37.0 85-89 36.1651 37.0 37.0 37.0 37.0 37.0 90-94 36.0198 37.0 37.0 37.0 37.0 37.0 95-99 36.0946 37.0 37.0 37.0 37.0 37.0 100-104 36.03006161604183 37.0 37.0 37.0 37.0 37.0 105-109 36.023954516130054 37.0 37.0 37.0 37.0 37.0 110-114 35.98963326101238 37.0 37.0 37.0 37.0 37.0 115-119 35.90685271821518 37.0 37.0 37.0 37.0 37.0 120-124 35.8131209163283 37.0 37.0 37.0 37.0 37.0 125-129 35.95490260404311 37.0 37.0 37.0 37.0 37.0 130-134 35.86258816170158 37.0 37.0 37.0 37.0 37.0 135-139 35.735605155835444 37.0 37.0 37.0 37.0 37.0 140-144 35.72457984519392 37.0 37.0 37.0 37.0 37.0 145-149 35.69398253454151 37.0 37.0 37.0 37.0 37.0 150 35.6849593495935 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 6.0 26 7.0 27 9.0 28 12.0 29 28.0 30 41.0 31 33.0 32 49.0 33 70.0 34 130.0 35 351.0 36 3001.0 37 261.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.43965948923385 18.477716574862292 18.627941912869304 36.45468202303455 2 21.341005754315738 28.596447335501622 34.95121341005754 15.111333500125093 3 21.675 32.2 25.0 21.125 4 22.875 37.4 20.3 19.425 5 22.425 37.6 21.325 18.65 6 17.4 39.15 23.625 19.825 7 17.474999999999998 15.525 44.1 22.900000000000002 8 18.7 21.224999999999998 30.85 29.225 9 20.474999999999998 23.275000000000002 28.499999999999996 27.750000000000004 10-14 21.435000000000002 29.285 26.66 22.62 15-19 21.77 28.075 27.875 22.28 20-24 21.83 28.345 27.66 22.165000000000003 25-29 21.105 28.645 27.55 22.7 30-34 21.05 28.415000000000003 27.79 22.745 35-39 22.17 29.005 27.02 21.805 40-44 21.584999999999997 28.055000000000003 27.62 22.74 45-49 21.41 28.535 27.245 22.81 50-54 21.34 28.585 27.41 22.665 55-59 21.959999999999997 27.96 27.944999999999997 22.134999999999998 60-64 21.085 28.645 27.32 22.95 65-69 22.295 27.900000000000002 27.405 22.400000000000002 70-74 22.605 27.985 27.265 22.145 75-79 22.225 27.72 28.15 21.905 80-84 22.145 28.475 26.745 22.634999999999998 85-89 22.17 28.16 27.134999999999998 22.535 90-94 22.59 27.605 27.18 22.625 95-99 22.225 28.000000000000004 27.400000000000002 22.375 100-104 22.07051762940735 28.032008002000502 28.192048012003003 21.705426356589147 105-109 21.88297712598228 28.75519295260023 27.108463887081435 22.253366034336054 110-114 22.501628011821868 27.586034163201923 27.806441917547463 22.105895907428742 115-119 22.22778974795811 28.4160946033973 27.258606002906248 22.097509645738338 120-124 22.546365914786968 27.769423558897245 27.859649122807017 21.82456140350877 125-129 22.061700526711814 28.266867318786055 27.42914472034111 22.242287434161025 130-134 22.376884422110553 27.060301507537687 28.251256281407034 22.311557788944725 135-139 22.353711350589183 27.434786987612046 28.265686373250077 21.945815288548694 140-144 22.164401556105695 28.100843732632747 27.403627545091698 22.33112716616986 145-149 21.686135093956324 27.526663280853224 28.501777552056883 22.28542407313357 150 21.544715447154474 27.693089430894307 27.464430894308943 23.297764227642276 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 2.0 21 1.5 22 0.5 23 2.5 24 6.5 25 7.0 26 6.5 27 9.5 28 11.0 29 15.5 30 20.0 31 23.5 32 29.5 33 44.5 34 52.0 35 62.0 36 80.0 37 113.0 38 146.5 39 174.0 40 198.0 41 209.0 42 230.5 43 234.5 44 245.0 45 270.0 46 264.5 47 237.5 48 196.0 49 176.5 50 187.0 51 157.5 52 103.0 53 91.0 54 86.5 55 66.0 56 58.5 57 47.5 58 36.5 59 30.0 60 22.5 61 13.5 62 9.5 63 9.0 64 4.5 65 1.0 66 0.5 67 0.0 68 1.0 69 1.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 1.0 102-103 1.0 104-105 1.0 106-107 1.0 108-109 3.0 110-111 0.0 112-113 1.0 114-115 0.0 116-117 1.0 118-119 0.0 120-121 1.0 122-123 1.0 124-125 2.0 126-127 0.0 128-129 3.0 130-131 6.0 132-133 0.0 134-135 5.0 136-137 3.0 138-139 6.0 140-141 6.0 142-143 5.0 144-145 17.0 146-147 0.0 148-149 0.0 150-151 3936.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.75 #Duplication Level Percentage of deduplicated Percentage of total 1 84.92625368731564 71.975 2 12.56637168141593 21.3 3 2.1533923303834808 5.475 4 0.32448377581120946 1.0999999999999999 5 0.0 0.0 6 0.029498525073746312 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTGACATAGCGCTTGCCAGCTTCCCACCACACCCTCTTGTACTGCAAGTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGTAGC 10 0.007002685 143.8 6 >>END_MODULE SRR10828690 read2 length is 100-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828690_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2565 37.0 37.0 37.0 37.0 37.0 2 36.231 37.0 37.0 37.0 37.0 37.0 3 36.3735 37.0 37.0 37.0 37.0 37.0 4 36.2055 37.0 37.0 37.0 37.0 37.0 5 36.451 37.0 37.0 37.0 37.0 37.0 6 36.351 37.0 37.0 37.0 37.0 37.0 7 36.464 37.0 37.0 37.0 37.0 37.0 8 36.498 37.0 37.0 37.0 37.0 37.0 9 36.4485 37.0 37.0 37.0 37.0 37.0 10-14 36.4162 37.0 37.0 37.0 37.0 37.0 15-19 36.3829 37.0 37.0 37.0 37.0 37.0 20-24 36.41740000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.351299999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.3829 37.0 37.0 37.0 37.0 37.0 35-39 36.3134 37.0 37.0 37.0 37.0 37.0 40-44 36.338100000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.2766 37.0 37.0 37.0 37.0 37.0 50-54 36.221000000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2635 37.0 37.0 37.0 37.0 37.0 60-64 36.1652 37.0 37.0 37.0 37.0 37.0 65-69 36.155199999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.1307 37.0 37.0 37.0 37.0 37.0 75-79 36.0351 37.0 37.0 37.0 37.0 37.0 80-84 35.9597 37.0 37.0 37.0 37.0 37.0 85-89 36.072199999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.904999999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.9225 37.0 37.0 37.0 37.0 37.0 100-104 35.975235105312095 37.0 37.0 37.0 37.0 37.0 105-109 35.925569494812954 37.0 37.0 37.0 37.0 37.0 110-114 35.836342758143374 37.0 37.0 37.0 37.0 37.0 115-119 35.70041963154573 37.0 37.0 37.0 37.0 37.0 120-124 35.83227790863313 37.0 37.0 37.0 37.0 37.0 125-129 35.67358892941058 37.0 37.0 37.0 37.0 37.0 130-134 35.67061634932292 37.0 37.0 37.0 37.0 37.0 135-139 35.61831449226496 37.0 37.0 37.0 37.0 37.0 140-144 35.4727658843016 37.0 37.0 37.0 34.6 37.0 145-149 35.64499606476044 37.0 37.0 37.0 37.0 37.0 150 35.5604674796748 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 2.0 24 1.0 25 9.0 26 4.0 27 12.0 28 14.0 29 16.0 30 31.0 31 33.0 32 45.0 33 82.0 34 166.0 35 519.0 36 2784.0 37 278.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.674999999999997 18.0 20.575 34.75 2 22.811405702851424 27.313656828414207 34.417208604302154 15.457728864432216 3 20.925 32.375 26.924999999999997 19.775000000000002 4 23.799999999999997 37.2 20.424999999999997 18.575 5 21.475 37.325 22.875 18.325 6 17.03351675837919 38.24412206103052 23.936968484242122 20.785392696348172 7 16.475 16.900000000000002 42.075 24.55 8 20.060030015007506 20.985492746373186 29.064532266133064 29.889944972486244 9 20.335167583791897 23.186593296648326 29.789894947473737 26.688344172086044 10-14 20.88626587976393 28.498549564869464 27.673301990597178 22.94188256476943 15-19 20.754150830166033 28.080616123224644 28.300660132026405 22.86457291458292 20-24 21.415 28.499999999999996 28.050000000000004 22.035 25-29 21.735 28.365000000000002 27.534999999999997 22.365 30-34 21.255 29.2 27.455000000000002 22.09 35-39 21.354270854170835 28.545709141828368 27.260452090418084 22.839567913582716 40-44 20.945 28.655 27.35 23.05 45-49 21.09 29.330000000000002 27.065 22.515 50-54 21.6 28.975 27.375 22.05 55-59 21.45 27.994999999999997 28.050000000000004 22.505 60-64 21.465 28.199999999999996 27.24 23.095 65-69 21.9 28.410000000000004 27.29 22.400000000000002 70-74 22.02 27.51 27.700000000000003 22.770000000000003 75-79 22.045 27.975 28.255000000000003 21.725 80-84 22.235 27.845 27.529999999999998 22.39 85-89 22.48 28.355000000000004 26.57 22.595000000000002 90-94 21.834999999999997 27.834999999999997 27.750000000000004 22.58 95-99 21.67 27.79 27.97 22.57 100-104 22.490622655663916 27.656914228557138 27.526881720430108 22.325581395348838 105-109 22.345697552185012 28.07228312559443 26.775792160985134 22.80622716123542 110-114 21.695136001602965 28.066923809046735 27.791414116114808 22.446526073235486 115-119 22.56351154983214 27.985168111439595 27.694543268026255 21.75677707070201 120-124 22.015037593984964 28.60651629072682 27.839598997493738 21.538847117794486 125-129 22.478053674441938 28.04614998745924 27.579633809882115 21.896162528216703 130-134 21.889447236180903 27.673366834170853 27.643216080402013 22.79396984924623 135-139 22.237889011985093 27.832611541947827 28.064256219156007 21.86524322691107 140-144 22.338436663129706 27.446819261280382 28.03799706937497 22.176747006214946 145-149 22.199085830370745 27.638395124428644 28.105637379380394 22.056881665820214 150 21.443089430894307 28.429878048780488 28.20121951219512 21.92581300813008 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.5 22 1.5 23 0.5 24 3.0 25 3.5 26 4.0 27 7.0 28 14.5 29 19.5 30 24.5 31 31.0 32 34.0 33 45.5 34 61.0 35 79.0 36 99.5 37 119.5 38 146.0 39 150.5 40 153.0 41 206.0 42 254.5 43 261.5 44 251.0 45 238.0 46 248.5 47 230.0 48 212.5 49 206.0 50 171.0 51 148.0 52 124.5 53 89.5 54 73.5 55 72.0 56 54.0 57 35.5 58 29.0 59 29.0 60 22.0 61 12.5 62 7.5 63 6.0 64 3.0 65 0.5 66 0.0 67 2.5 68 3.5 69 1.0 70 1.0 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.05 9 0.05 10-14 0.03 15-19 0.02 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.010010511036588418 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.010104582428131158 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 1.0 102-103 1.0 104-105 1.0 106-107 1.0 108-109 3.0 110-111 0.0 112-113 1.0 114-115 0.0 116-117 1.0 118-119 0.0 120-121 1.0 122-123 1.0 124-125 2.0 126-127 0.0 128-129 3.0 130-131 6.0 132-133 0.0 134-135 5.0 136-137 3.0 138-139 6.0 140-141 6.0 142-143 5.0 144-145 17.0 146-147 0.0 148-149 0.0 150-151 3936.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.0 #Duplication Level Percentage of deduplicated Percentage of total 1 85.23529411764706 72.45 2 12.352941176470589 21.0 3 2.0294117647058822 5.175 4 0.3235294117647059 1.0999999999999999 5 0.02941176470588235 0.125 6 0.02941176470588235 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTGGAGGAGTGTTGCTTGGAAACAGTATATGCTTCCGCAAAACACAGCAG 6 0.15 No Hit CATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245046 spots for SRR10828690.sra Written 1245046 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra Read 1245041 spots for SRR10828690.sra Written 1245041 spots for SRR10828690.sra SRR ids: ['SRR10828690.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_44n8qmbp SRR10828690.sra spots: 24900825 blocks: [[1, 1245041], [1245042, 2490082], [2490083, 3735123], [3735124, 4980164], [4980165, 6225205], [6225206, 7470246], [7470247, 8715287], [8715288, 9960328], [9960329, 11205369], [11205370, 12450410], [12450411, 13695451], [13695452, 14940492], [14940493, 16185533], [16185534, 17430574], [17430575, 18675615], [18675616, 19920656], [19920657, 21165697], [21165698, 22410738], [22410739, 23655779], [23655780, 24900825]] SRR10828690 file size 8376759 SRR10828690 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10828690 SRR10828690_1.fastq SRR10828690_2.fastq Input file: SRR10828690_1.fastq Paired file: SRR10828690_2.fastq trimmed: SRR10828690-trimmed-pair1.fastq, SRR10828690-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:38:49 2025 >> started Thu Feb 13 19:39:18 2025 >> done (29.311s) 24900825 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 18 ( 0.00%) empty read pairs filtered out after trimming by size control 24900807 (100.00%) read pairs available; of these: 86170 ( 0.35%) trimmed read pairs available after processing 24814637 (99.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 5 0.00% 27 10 0.00% 28 0 0.00% 29 3 0.00% 30 3 0.00% 31 3 0.00% 32 4 0.00% 33 1 0.00% 34 7 0.00% 35 0 0.00% 36 3 0.00% 37 7 0.00% 38 10 0.00% 39 5 0.00% 40 6 0.00% 41 4 0.00% 42 6 0.00% 43 9 0.00% 44 8 0.00% 45 6 0.00% 46 6 0.00% 47 11 0.00% 48 7 0.00% 49 7 0.00% 50 3 0.00% 51 5 0.00% 52 14 0.00% 53 11 0.00% 54 7 0.00% 55 15 0.00% 56 10 0.00% 57 8 0.00% 58 12 0.00% 59 3 0.00% 60 4 0.00% 61 8 0.00% 62 5 0.00% 63 10 0.00% 64 10 0.00% 65 12 0.00% 66 10 0.00% 67 5 0.00% 68 8 0.00% 69 8 0.00% 70 7 0.00% 71 6 0.00% 72 7 0.00% 73 10 0.00% 74 10 0.00% 75 6 0.00% 76 15 0.00% 77 5 0.00% 78 8 0.00% 79 5 0.00% 80 8 0.00% 81 5 0.00% 82 11 0.00% 83 9 0.00% 84 8 0.00% 85 6 0.00% 86 4 0.00% 87 5 0.00% 88 4 0.00% 89 9 0.00% 90 8 0.00% 91 8 0.00% 92 6 0.00% 93 12 0.00% 94 12 0.00% 95 10 0.00% 96 14 0.00% 97 10 0.00% 98 14 0.00% 99 1962 0.01% 100 1998 0.01% 101 2153 0.01% 102 2333 0.01% 103 2574 0.01% 104 2653 0.01% 105 2760 0.01% 106 2943 0.01% 107 3182 0.01% 108 3360 0.01% 109 3647 0.01% 110 3701 0.01% 111 4160 0.02% 112 4163 0.02% 113 4451 0.02% 114 4596 0.02% 115 5210 0.02% 116 5155 0.02% 117 5411 0.02% 118 5670 0.02% 119 6226 0.03% 120 6249 0.03% 121 6814 0.03% 122 6964 0.03% 123 7416 0.03% 124 7741 0.03% 125 8074 0.03% 126 8373 0.03% 127 8962 0.04% 128 9265 0.04% 129 9739 0.04% 130 10487 0.04% 131 10718 0.04% 132 11030 0.04% 133 11822 0.05% 134 12303 0.05% 135 12733 0.05% 136 13362 0.05% 137 95 0.00% 138 14264 0.06% 139 14857 0.06% 140 15517 0.06% 141 15986 0.06% 142 17227 0.07% 143 18856 0.08% 144 24312 0.10% 145 73286 0.29% 146 19815 0.08% 147 20747 0.08% 148 21389 0.09% 149 22512 0.09% 150 24381035 97.91% 24900807 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=33 prefix-density=0.41 prefix-fanout=2.1 sequence=CTCAAGTCTACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=44.21 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.2 sequence=AAAAAAAATCTAAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=33 prefix-density=0.41 prefix-fanout=2.1 sequence=CTCAAGTCTACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=53.08 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.2 sequence=AAAAAAAATCTAAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR10828690 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:40:08 Started mapping on | Feb 13 19:40:08 Finished on | Feb 13 19:44:29 Mapping speed, Million of reads per hour | 343.46 Number of input reads | 24900807 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22902822 Uniquely mapped reads % | 91.98% Average mapped length | 295.81 Number of splices: Total | 22885347 Number of splices: Annotated (sjdb) | 22296448 Number of splices: GT/AG | 22360976 Number of splices: GC/AG | 388236 Number of splices: AT/AC | 14418 Number of splices: Non-canonical | 121717 Mismatch rate per base, % | 1.18% Deletion rate per base | 0.09% Deletion average length | 3.35 Insertion rate per base | 0.07% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1029069 % of reads mapped to multiple loci | 4.13% Number of reads mapped to too many loci | 127912 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 968916 968916 968916 N_multimapping 1029069 1029069 1029069 N_noFeature 711515 11597250 11762909 N_ambiguous 426197 86951 85996 UnstrandedReadsAssigned:21765110 PositiveStrandReadsAssigned:11218621 NegativeStrandReadsAssigned:11053917 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR10828690 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR10828690-trimmed-pair1.fastq SRR10828690-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,900,807 reads, 21,087,206 reads pseudoaligned [quant] estimated average fragment length: 242.239 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR10828690.ke.tsv 34699 SRR10828690.se.tsv 87100 total ==> SRR10828690.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.76 995 20.0788 Potri.005G024800.1.v4.1 1035 793.761 248 11.2022 Potri.004G059700.1.v4.1 961 719.761 12 0.597772 Potri.007G009000.2.v4.1 1416 1174.76 0 0 Potri.003G141000.2.v4.1 2943 2701.76 598.322 7.94019 Potri.016G087400.1.v4.1 270 53.342 1126 756.854 Potri.015G069301.1.v4.1 564 322.919 0 0 Potri.010G195200.1.v4.1 1773 1531.76 64 1.49807 Potri.012G127500.1.v4.1 977 735.761 88 4.28834 ==> SRR10828690.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 100 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 435 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR10828690 completed mapping pipeline successfully