Starting /dee2/code/volunteer_pipeline.sh SRR10828691 current disk space = 3087599271936 free memory = 1516571084 SRR10828691 SRAfilesize ac23d4a0d94b032b0cfd41745689cbd4 SRR10828691.sra SRR10828691.sra file validated SRR10828691 is paired end SRR10828691 is conventional basespace SRR10828691 read1 length is 103-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828691_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 103-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4915 37.0 37.0 37.0 37.0 37.0 2 36.408 37.0 37.0 37.0 37.0 37.0 3 36.5435 37.0 37.0 37.0 37.0 37.0 4 36.4425 37.0 37.0 37.0 37.0 37.0 5 36.5165 37.0 37.0 37.0 37.0 37.0 6 36.4645 37.0 37.0 37.0 37.0 37.0 7 36.42925 37.0 37.0 37.0 37.0 37.0 8 36.543 37.0 37.0 37.0 37.0 37.0 9 36.5685 37.0 37.0 37.0 37.0 37.0 10-14 36.534499999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.528 37.0 37.0 37.0 37.0 37.0 20-24 36.4975 37.0 37.0 37.0 37.0 37.0 25-29 36.4201 37.0 37.0 37.0 37.0 37.0 30-34 36.4109 37.0 37.0 37.0 37.0 37.0 35-39 36.3298 37.0 37.0 37.0 37.0 37.0 40-44 36.3555 37.0 37.0 37.0 37.0 37.0 45-49 36.2586 37.0 37.0 37.0 37.0 37.0 50-54 36.2404 37.0 37.0 37.0 37.0 37.0 55-59 36.2355 37.0 37.0 37.0 37.0 37.0 60-64 36.2097 37.0 37.0 37.0 37.0 37.0 65-69 36.1769 37.0 37.0 37.0 37.0 37.0 70-74 36.214800000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.1263 37.0 37.0 37.0 37.0 37.0 80-84 36.084399999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.0707 37.0 37.0 37.0 37.0 37.0 90-94 36.0058 37.0 37.0 37.0 37.0 37.0 95-99 36.0834 37.0 37.0 37.0 37.0 37.0 100-104 36.00674601150287 37.0 37.0 37.0 37.0 37.0 105-109 35.93937448844453 37.0 37.0 37.0 37.0 37.0 110-114 35.92105131414267 37.0 37.0 37.0 37.0 37.0 115-119 35.9101220771107 37.0 37.0 37.0 37.0 37.0 120-124 35.795854616501174 37.0 37.0 37.0 37.0 37.0 125-129 35.84599481203852 37.0 37.0 37.0 37.0 37.0 130-134 35.813776933463586 37.0 37.0 37.0 37.0 37.0 135-139 35.67494213393993 37.0 37.0 37.0 37.0 37.0 140-144 35.582206861675225 37.0 37.0 37.0 37.0 37.0 145-149 35.55576971503045 37.0 37.0 37.0 37.0 37.0 150 35.56692913385827 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 1.0 22 1.0 23 2.0 24 3.0 25 3.0 26 2.0 27 15.0 28 18.0 29 23.0 30 26.0 31 49.0 32 63.0 33 82.0 34 120.0 35 347.0 36 2958.0 37 284.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.55 17.224999999999998 18.35 37.875 2 22.886443221610804 26.413206603301653 36.46823411705853 14.232116058029016 3 21.75 29.975 27.425 20.849999999999998 4 23.575 35.375 21.25 19.8 5 23.549999999999997 36.675000000000004 23.375 16.400000000000002 6 16.975 38.25 24.275 20.5 7 17.179294823705927 16.25406351587897 45.18629657414353 21.380345086271568 8 20.200000000000003 20.175 29.2 30.425 9 20.75 22.8 29.375 27.075 10-14 20.79 28.294999999999998 27.155 23.76 15-19 21.34 27.61 27.900000000000002 23.150000000000002 20-24 21.224999999999998 28.689999999999998 27.02 23.064999999999998 25-29 21.634999999999998 29.62 26.405 22.34 30-34 21.205 29.095 27.16 22.54 35-39 21.37 28.205000000000002 27.825 22.6 40-44 21.525 28.705000000000002 27.229999999999997 22.54 45-49 21.545 27.93 27.595 22.93 50-54 21.785 28.060000000000002 27.605 22.55 55-59 21.81 27.96 27.334999999999997 22.895 60-64 21.4 28.46 27.48 22.66 65-69 21.759999999999998 28.29 26.950000000000003 23.0 70-74 22.155 28.235 26.85 22.759999999999998 75-79 22.025 28.4 27.365000000000002 22.21 80-84 22.225 28.15 27.315 22.31 85-89 22.875 28.345 26.455000000000002 22.325 90-94 21.584999999999997 28.144999999999996 27.76 22.509999999999998 95-99 22.0 27.834999999999997 27.925 22.24 100-104 21.75608780439022 28.57142857142857 27.1963598179909 22.47612380619031 105-109 21.79871948779512 28.171268507402964 27.265906362545017 22.7641056422569 110-114 21.967459324155193 28.370463078848562 27.37922403003755 22.2828535669587 115-119 21.79159781683441 28.34109458715137 27.259526313154076 22.60778128286015 120-124 22.241707585930452 27.848481811804792 27.377492734742958 22.532317867521794 125-129 21.942409952844386 28.05759004715561 27.224841978529145 22.775158021470855 130-134 22.254596604038984 28.498945041695972 27.29830201949161 21.948156334773437 135-139 22.067784660321298 27.627536888754594 28.28725386513572 22.017424585788387 140-144 22.07811869196609 27.629188534517564 27.59890997174001 22.69378280177634 145-149 22.33389168062535 27.86152987158012 27.87675752499873 21.927820922795796 150 21.488442976885956 28.956057912115824 28.244856489712976 21.310642621285243 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 2.0 23 3.0 24 2.5 25 2.5 26 6.0 27 11.0 28 13.0 29 14.0 30 18.5 31 22.0 32 34.5 33 36.5 34 42.5 35 57.0 36 84.0 37 114.0 38 128.5 39 142.5 40 183.5 41 229.5 42 253.0 43 263.5 44 249.0 45 257.5 46 251.0 47 229.5 48 237.0 49 231.5 50 178.0 51 135.0 52 121.5 53 99.0 54 77.0 55 53.5 56 47.0 57 48.5 58 34.5 59 21.5 60 17.0 61 11.0 62 8.5 63 5.0 64 0.5 65 3.0 66 4.0 67 2.5 68 2.0 69 1.0 70 1.0 71 1.5 72 1.5 73 0.5 74 0.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 103 1.0 104 0.0 105 0.0 106 1.0 107 0.0 108 0.0 109 3.0 110 0.0 111 0.0 112 0.0 113 0.0 114 0.0 115 0.0 116 1.0 117 0.0 118 1.0 119 1.0 120 0.0 121 0.0 122 0.0 123 2.0 124 2.0 125 1.0 126 0.0 127 1.0 128 0.0 129 0.0 130 4.0 131 2.0 132 0.0 133 2.0 134 2.0 135 4.0 136 2.0 137 0.0 138 1.0 139 2.0 140 0.0 141 2.0 142 5.0 143 3.0 144 4.0 145 16.0 146 0.0 147 0.0 148 0.0 149 0.0 150 3937.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.125 #Duplication Level Percentage of deduplicated Percentage of total 1 85.25697503671073 72.575 2 12.422907488986784 21.15 3 1.9383259911894273 4.95 4 0.3524229074889868 1.2 5 0.02936857562408223 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAGATTTGAGCTCCAGCCTTGAACCAAACTGACTCACCGAACTTGACAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCTCT 20 0.006139246 28.8 75-79 >>END_MODULE SRR10828691 read2 length is 103-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828691_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 103-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2185 37.0 37.0 37.0 37.0 37.0 2 36.1375 37.0 37.0 37.0 37.0 37.0 3 36.218 37.0 37.0 37.0 37.0 37.0 4 36.201 37.0 37.0 37.0 37.0 37.0 5 36.286 37.0 37.0 37.0 37.0 37.0 6 36.372 37.0 37.0 37.0 37.0 37.0 7 36.4165 37.0 37.0 37.0 37.0 37.0 8 36.424 37.0 37.0 37.0 37.0 37.0 9 36.4875 37.0 37.0 37.0 37.0 37.0 10-14 36.4485 37.0 37.0 37.0 37.0 37.0 15-19 36.3438 37.0 37.0 37.0 37.0 37.0 20-24 36.3463 37.0 37.0 37.0 37.0 37.0 25-29 36.337599999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.3443 37.0 37.0 37.0 37.0 37.0 35-39 36.2629 37.0 37.0 37.0 37.0 37.0 40-44 36.258300000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.2669 37.0 37.0 37.0 37.0 37.0 50-54 36.1877 37.0 37.0 37.0 37.0 37.0 55-59 36.185900000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.1471 37.0 37.0 37.0 37.0 37.0 65-69 36.1103 37.0 37.0 37.0 37.0 37.0 70-74 36.0894 37.0 37.0 37.0 37.0 37.0 75-79 36.00789999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.0197 37.0 37.0 37.0 37.0 37.0 85-89 36.1018 37.0 37.0 37.0 37.0 37.0 90-94 35.883 37.0 37.0 37.0 37.0 37.0 95-99 35.9298 37.0 37.0 37.0 37.0 37.0 100-104 36.0141473368342 37.0 37.0 37.0 37.0 37.0 105-109 35.889949000506746 37.0 37.0 37.0 37.0 37.0 110-114 35.83504380475594 37.0 37.0 37.0 37.0 37.0 115-119 35.76241244938439 37.0 37.0 37.0 37.0 37.0 120-124 35.90469555652659 37.0 37.0 37.0 37.0 37.0 125-129 35.7128537217139 37.0 37.0 37.0 37.0 37.0 130-134 35.66736761531549 37.0 37.0 37.0 37.0 37.0 135-139 35.61665462721429 37.0 37.0 37.0 37.0 37.0 140-144 35.521497422219916 37.0 37.0 37.0 37.0 37.0 145-149 35.657336993904956 37.0 37.0 37.0 37.0 37.0 150 35.42773685547371 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 4.0 24 3.0 25 5.0 26 2.0 27 11.0 28 15.0 29 20.0 30 27.0 31 40.0 32 53.0 33 96.0 34 156.0 35 513.0 36 2828.0 37 227.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.474999999999998 19.400000000000002 18.4 36.725 2 23.599999999999998 27.900000000000002 34.150000000000006 14.35 3 20.925 32.5 25.85 20.724999999999998 4 22.15 36.95 20.349999999999998 20.549999999999997 5 22.375 38.925 21.4 17.299999999999997 6 17.45 36.275 25.0 21.275 7 15.7 17.125 44.0 23.175 8 20.200000000000003 22.2 28.925 28.675 9 21.3 22.325 29.175 27.200000000000003 10-14 21.425 28.89 26.88 22.805 15-19 21.305 27.544999999999998 28.075 23.075000000000003 20-24 20.935000000000002 28.13 28.494999999999997 22.439999999999998 25-29 21.855 28.585 28.110000000000003 21.45 30-34 21.265 28.860000000000003 27.395000000000003 22.48 35-39 21.560000000000002 29.115000000000002 27.255000000000003 22.07 40-44 21.915000000000003 28.585 27.295 22.205 45-49 21.3 28.475 27.884999999999998 22.34 50-54 22.11 27.685 27.99 22.215 55-59 22.065 27.26 28.605000000000004 22.07 60-64 22.12 27.85 27.744999999999997 22.285 65-69 21.475 28.32 28.51 21.695 70-74 21.985 27.439999999999998 27.815 22.759999999999998 75-79 21.87 27.884999999999998 27.96 22.285 80-84 22.15 27.16 28.22 22.470000000000002 85-89 21.634999999999998 27.96 27.265 23.14 90-94 21.990000000000002 28.875 26.889999999999997 22.245 95-99 22.475 27.63 27.584999999999997 22.31 100-104 21.576078803940195 27.92139606980349 28.496424821241064 22.00610030501525 105-109 21.618647458983595 28.131252501000397 28.016206482593038 22.233893557422967 110-114 22.327909887359198 27.449311639549435 28.545682102628284 21.67709637046308 115-119 22.697911972359922 27.299584397376197 27.184417405237593 22.81808622502629 120-124 22.387012726726123 28.209239402745766 27.472692654574605 21.931055215953503 125-129 22.087890037122506 28.494030299989966 27.08939500351159 22.32868465937594 130-134 22.485682708731037 27.524364513212095 27.56957701195619 22.420375766100673 135-139 22.27426096590623 27.763509089993455 28.14624565644357 21.815984287656747 140-144 22.673597093257975 28.007670569236982 27.60900282599919 21.709729511505856 145-149 23.09527435155576 28.049337597076292 27.201664890107104 21.65372316126085 150 21.74244348488697 29.51485902971806 26.79705359410719 21.945643891287784 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.5 24 1.5 25 2.0 26 5.5 27 9.5 28 17.0 29 19.0 30 20.0 31 25.0 32 34.5 33 44.0 34 53.0 35 60.5 36 80.0 37 122.0 38 147.5 39 168.0 40 198.0 41 225.5 42 244.5 43 258.0 44 270.0 45 238.0 46 226.5 47 237.0 48 210.0 49 198.0 50 180.5 51 140.0 52 114.5 53 101.5 54 79.0 55 58.5 56 49.5 57 40.5 58 33.0 59 29.5 60 21.0 61 11.5 62 5.0 63 2.0 64 3.0 65 3.0 66 1.5 67 1.5 68 1.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 103 1.0 104 0.0 105 0.0 106 1.0 107 0.0 108 0.0 109 3.0 110 0.0 111 0.0 112 0.0 113 0.0 114 0.0 115 0.0 116 1.0 117 0.0 118 1.0 119 1.0 120 0.0 121 0.0 122 0.0 123 2.0 124 2.0 125 1.0 126 0.0 127 1.0 128 0.0 129 0.0 130 4.0 131 2.0 132 0.0 133 2.0 134 2.0 135 4.0 136 2.0 137 0.0 138 1.0 139 2.0 140 0.0 141 2.0 142 5.0 143 3.0 144 4.0 145 16.0 146 0.0 147 0.0 148 0.0 149 0.0 150 3937.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.32083211251098 72.8 2 12.569586873718135 21.45 3 1.7286844418400233 4.425 4 0.3515968356284793 1.2 5 0.02929973630237328 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra Read 1190336 spots for SRR10828691.sra Written 1190336 spots for SRR10828691.sra Read 1190333 spots for SRR10828691.sra Written 1190333 spots for SRR10828691.sra SRR ids: ['SRR10828691.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3dcggh8o SRR10828691.sra spots: 23806663 blocks: [[1, 1190333], [1190334, 2380666], [2380667, 3570999], [3571000, 4761332], [4761333, 5951665], [5951666, 7141998], [7141999, 8332331], [8332332, 9522664], [9522665, 10712997], [10712998, 11903330], [11903331, 13093663], [13093664, 14283996], [14283997, 15474329], [15474330, 16664662], [16664663, 17854995], [17854996, 19045328], [19045329, 20235661], [20235662, 21425994], [21425995, 22616327], [22616328, 23806663]] SRR10828691 file size 8009788 SRR10828691 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10828691 SRR10828691_1.fastq SRR10828691_2.fastq Input file: SRR10828691_1.fastq Paired file: SRR10828691_2.fastq trimmed: SRR10828691-trimmed-pair1.fastq, SRR10828691-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:14:32 2025 >> started Thu Feb 13 20:14:57 2025 >> done (25.436s) 23806663 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 3 ( 0.00%) empty read pairs filtered out after trimming by size control 23806659 (100.00%) read pairs available; of these: 67607 ( 0.28%) trimmed read pairs available after processing 23739052 (99.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 2 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 1 0.00% 27 1 0.00% 28 2 0.00% 29 5 0.00% 30 2 0.00% 31 2 0.00% 32 4 0.00% 33 3 0.00% 34 5 0.00% 35 3 0.00% 36 3 0.00% 37 7 0.00% 38 6 0.00% 39 8 0.00% 40 7 0.00% 41 7 0.00% 42 7 0.00% 43 8 0.00% 44 5 0.00% 45 3 0.00% 46 5 0.00% 47 8 0.00% 48 7 0.00% 49 9 0.00% 50 6 0.00% 51 10 0.00% 52 5 0.00% 53 13 0.00% 54 4 0.00% 55 5 0.00% 56 7 0.00% 57 8 0.00% 58 10 0.00% 59 6 0.00% 60 9 0.00% 61 6 0.00% 62 7 0.00% 63 10 0.00% 64 2 0.00% 65 9 0.00% 66 7 0.00% 67 11 0.00% 68 3 0.00% 69 11 0.00% 70 8 0.00% 71 11 0.00% 72 13 0.00% 73 11 0.00% 74 3 0.00% 75 3 0.00% 76 13 0.00% 77 5 0.00% 78 8 0.00% 79 12 0.00% 80 10 0.00% 81 13 0.00% 82 9 0.00% 83 8 0.00% 84 5 0.00% 85 8 0.00% 86 13 0.00% 87 5 0.00% 88 10 0.00% 89 8 0.00% 90 6 0.00% 91 9 0.00% 92 11 0.00% 93 14 0.00% 94 10 0.00% 95 15 0.00% 96 8 0.00% 97 23 0.00% 98 18 0.00% 99 1519 0.01% 100 1704 0.01% 101 1934 0.01% 102 1889 0.01% 103 2182 0.01% 104 2192 0.01% 105 2361 0.01% 106 2519 0.01% 107 2571 0.01% 108 2862 0.01% 109 2993 0.01% 110 3101 0.01% 111 3401 0.01% 112 3483 0.01% 113 3750 0.02% 114 3886 0.02% 115 4034 0.02% 116 4328 0.02% 117 4536 0.02% 118 4689 0.02% 119 5070 0.02% 120 5188 0.02% 121 5358 0.02% 122 5752 0.02% 123 6254 0.03% 124 6409 0.03% 125 6514 0.03% 126 6901 0.03% 127 7307 0.03% 128 7507 0.03% 129 7962 0.03% 130 8217 0.03% 131 8684 0.04% 132 8915 0.04% 133 9365 0.04% 134 9724 0.04% 135 10139 0.04% 136 10874 0.05% 137 81 0.00% 138 11080 0.05% 139 11864 0.05% 140 12182 0.05% 141 12614 0.05% 142 13672 0.06% 143 15100 0.06% 144 20352 0.09% 145 67314 0.28% 146 15582 0.07% 147 15993 0.07% 148 16786 0.07% 149 17532 0.07% 150 23379870 98.21% 23806659 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=30 prefix-density=0.43 prefix-fanout=2.1 sequence=CTCAAGTCTACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=56.20 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.7 sequence=AAAAAAAATCTAAACTGCACCCGCTCATCCAGCAATGGCAGCA criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=35 prefix-density=0.43 prefix-fanout=2.1 sequence=CTCAAGTCTACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=60.59 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.9 sequence=AAAAAAAATCTAAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR10828691 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:16:09 Started mapping on | Feb 13 20:16:12 Finished on | Feb 13 20:19:41 Mapping speed, Million of reads per hour | 410.07 Number of input reads | 23806659 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 21790464 Uniquely mapped reads % | 91.53% Average mapped length | 287.96 Number of splices: Total | 21062989 Number of splices: Annotated (sjdb) | 20512155 Number of splices: GT/AG | 20573449 Number of splices: GC/AG | 361961 Number of splices: AT/AC | 13105 Number of splices: Non-canonical | 114474 Mismatch rate per base, % | 1.19% Deletion rate per base | 0.09% Deletion average length | 3.34 Insertion rate per base | 0.07% Insertion average length | 2.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 971483 % of reads mapped to multiple loci | 4.08% Number of reads mapped to too many loci | 60560 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.01% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1044712 1044712 1044712 N_multimapping 971483 971483 971483 N_noFeature 709639 11082717 11196601 N_ambiguous 394636 87993 86775 UnstrandedReadsAssigned:20686189 PositiveStrandReadsAssigned:10619754 NegativeStrandReadsAssigned:10507088 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR10828691 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR10828691-trimmed-pair1.fastq SRR10828691-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,806,659 reads, 20,171,379 reads pseudoaligned [quant] estimated average fragment length: 242.824 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,255 rounds 52401 SRR10828691.ke.tsv 34699 SRR10828691.se.tsv 87100 total ==> SRR10828691.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.18 889 21.0606 Potri.005G024800.1.v4.1 1035 793.176 190 10.0795 Potri.004G059700.1.v4.1 961 719.181 4 0.234033 Potri.007G009000.2.v4.1 1416 1174.18 0 0 Potri.003G141000.2.v4.1 2943 2701.18 596 9.28428 Potri.016G087400.1.v4.1 270 54.7417 957 735.611 Potri.015G069301.1.v4.1 564 322.42 0 0 Potri.010G195200.1.v4.1 1773 1531.18 52 1.429 Potri.012G127500.1.v4.1 977 735.181 53 3.03345 ==> SRR10828691.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 27 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 300 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR10828691 completed mapping pipeline successfully