Starting /dee2/code/volunteer_pipeline.sh SRR10828692 current disk space = 3087628161024 free memory = 1569292860 SRR10828692 SRAfilesize 6170546ab72474b2eb17799f0cfc98c2 SRR10828692.sra SRR10828692.sra file validated SRR10828692 is paired end SRR10828692 is conventional basespace SRR10828692 read1 length is 100-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828692_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.425 37.0 37.0 37.0 37.0 37.0 2 36.49275 37.0 37.0 37.0 37.0 37.0 3 36.5295 37.0 37.0 37.0 37.0 37.0 4 36.458 37.0 37.0 37.0 37.0 37.0 5 36.542 37.0 37.0 37.0 37.0 37.0 6 36.469 37.0 37.0 37.0 37.0 37.0 7 36.506 37.0 37.0 37.0 37.0 37.0 8 36.582 37.0 37.0 37.0 37.0 37.0 9 36.4575 37.0 37.0 37.0 37.0 37.0 10-14 36.4859 37.0 37.0 37.0 37.0 37.0 15-19 36.518299999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.449400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4564 37.0 37.0 37.0 37.0 37.0 30-34 36.3842 37.0 37.0 37.0 37.0 37.0 35-39 36.4122 37.0 37.0 37.0 37.0 37.0 40-44 36.349 37.0 37.0 37.0 37.0 37.0 45-49 36.2956 37.0 37.0 37.0 37.0 37.0 50-54 36.2642 37.0 37.0 37.0 37.0 37.0 55-59 36.2159 37.0 37.0 37.0 37.0 37.0 60-64 36.244 37.0 37.0 37.0 37.0 37.0 65-69 36.193599999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.198499999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.1177 37.0 37.0 37.0 37.0 37.0 80-84 36.1299 37.0 37.0 37.0 37.0 37.0 85-89 36.111900000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.04129999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.009100000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.096054948044596 37.0 37.0 37.0 37.0 37.0 105-109 36.01671751135006 37.0 37.0 37.0 37.0 37.0 110-114 35.936233765662585 37.0 37.0 37.0 37.0 37.0 115-119 35.94373270150523 37.0 37.0 37.0 37.0 37.0 120-124 35.80187086600053 37.0 37.0 37.0 37.0 37.0 125-129 35.92704112877654 37.0 37.0 37.0 37.0 37.0 130-134 35.85284091973223 37.0 37.0 37.0 37.0 37.0 135-139 35.74458277900771 37.0 37.0 37.0 37.0 37.0 140-144 35.7383569445396 37.0 37.0 37.0 37.0 37.0 145-149 35.66691336696758 37.0 37.0 37.0 37.0 37.0 150 35.59370238699848 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 6.0 26 5.0 27 13.0 28 19.0 29 30.0 30 28.0 31 44.0 32 57.0 33 52.0 34 134.0 35 336.0 36 2993.0 37 280.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.37737737737738 19.594594594594593 16.616616616616618 36.41141141141141 2 21.501877346683354 28.510638297872344 36.67083854818523 13.316645807259073 3 20.875 31.45 28.1 19.575 4 21.125 38.3 20.275000000000002 20.3 5 21.7 37.1 22.625 18.575 6 16.125 37.65 25.0 21.224999999999998 7 16.2 17.075000000000003 43.525000000000006 23.200000000000003 8 19.675 21.75 29.95 28.625 9 20.65 23.775 28.225 27.35 10-14 21.215 28.849999999999998 26.740000000000002 23.195 15-19 21.185000000000002 28.549999999999997 27.265 23.0 20-24 20.745 28.185 28.000000000000004 23.07 25-29 21.42 28.68 27.189999999999998 22.71 30-34 21.39 28.655 27.48 22.475 35-39 21.48 28.794999999999998 27.065 22.66 40-44 21.665 28.199999999999996 27.54 22.595000000000002 45-49 21.404999999999998 28.54 27.150000000000002 22.905 50-54 22.085 28.199999999999996 27.089999999999996 22.625 55-59 21.865000000000002 27.88 27.51 22.745 60-64 21.965 28.110000000000003 27.525 22.400000000000002 65-69 22.015 28.23 26.825 22.93 70-74 21.965 27.58 27.66 22.795 75-79 22.24 27.97 27.310000000000002 22.48 80-84 21.8 28.225 27.325 22.650000000000002 85-89 22.615 27.98 26.974999999999998 22.43 90-94 21.765 28.24 27.43 22.564999999999998 95-99 22.2 28.68 27.279999999999998 21.84 100-104 21.853111867120273 27.98178907344407 27.80168100860516 22.363418050830496 105-109 22.1348427168904 28.055499899819676 27.439390903626524 22.370266479663396 110-114 22.137557649889715 28.33366753559254 27.150591537998796 22.378183276518946 115-119 21.715145436308926 28.00401203610832 27.07121364092277 23.20962888665998 120-124 22.21497390606182 27.91047771979125 27.56423123243677 22.310317141710158 125-129 22.338928535531206 26.92732937983717 27.98773746105136 22.74600462358026 130-134 22.080796900940786 27.72551189817377 27.88650198722141 22.30718921366403 135-139 22.42863615768011 27.860846800584 27.342294718823943 22.368222322911947 140-144 22.33892143001414 27.630781660270653 27.736820844273886 22.293476065441325 145-149 22.20417280064978 27.295801817351133 27.859282197065845 22.640743184933246 150 22.117826307770443 27.196546470289483 27.78059928897918 22.905027932960895 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 3.0 24 4.0 25 2.0 26 2.5 27 7.5 28 13.0 29 15.5 30 18.0 31 22.0 32 34.0 33 44.5 34 62.0 35 77.0 36 90.5 37 106.5 38 114.0 39 154.5 40 199.5 41 212.5 42 239.0 43 252.0 44 250.5 45 255.5 46 245.5 47 238.0 48 219.5 49 205.0 50 170.5 51 149.0 52 140.5 53 103.5 54 77.5 55 67.0 56 54.0 57 31.5 58 22.5 59 25.0 60 19.5 61 13.5 62 11.0 63 5.0 64 3.5 65 2.5 66 3.0 67 2.0 68 1.0 69 2.5 70 2.0 71 0.5 72 0.5 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 2.0 102-103 2.0 104-105 3.0 106-107 1.0 108-109 2.0 110-111 0.0 112-113 1.0 114-115 1.0 116-117 0.0 118-119 1.0 120-121 1.0 122-123 3.0 124-125 2.0 126-127 2.0 128-129 3.0 130-131 1.0 132-133 0.0 134-135 2.0 136-137 1.0 138-139 5.0 140-141 5.0 142-143 8.0 144-145 16.0 146-147 0.0 148-149 0.0 150-151 3938.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.95 #Duplication Level Percentage of deduplicated Percentage of total 1 83.77010125074449 70.325 2 13.639070875521146 22.900000000000002 3 2.352590827873734 5.925 4 0.1786777843954735 0.6 5 0.05955926146515784 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTTGGCCACCTTTTTGCCAATTGGAGCAAAACCACCAAACAGGACCCAG 5 0.125 No Hit CTCAGCCTGAACGAACCATCTCAAGTTCTCAGGGTCCTCAGCAAGCCCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCCAG 10 0.00707415 143.3125 5 CGGTGTT 10 0.00707415 143.3125 8 ACGGTGT 10 0.00707415 143.3125 7 >>END_MODULE SRR10828692 read2 length is 100-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828692_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.161 37.0 37.0 37.0 37.0 37.0 2 35.9145 37.0 37.0 37.0 37.0 37.0 3 36.2315 37.0 37.0 37.0 37.0 37.0 4 36.1475 37.0 37.0 37.0 37.0 37.0 5 36.336 37.0 37.0 37.0 37.0 37.0 6 36.279 37.0 37.0 37.0 37.0 37.0 7 36.275 37.0 37.0 37.0 37.0 37.0 8 36.4325 37.0 37.0 37.0 37.0 37.0 9 36.375 37.0 37.0 37.0 37.0 37.0 10-14 36.392999999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.2482 37.0 37.0 37.0 37.0 37.0 20-24 36.3023 37.0 37.0 37.0 37.0 37.0 25-29 36.2347 37.0 37.0 37.0 37.0 37.0 30-34 36.2545 37.0 37.0 37.0 37.0 37.0 35-39 36.2306 37.0 37.0 37.0 37.0 37.0 40-44 36.1619 37.0 37.0 37.0 37.0 37.0 45-49 36.2001 37.0 37.0 37.0 37.0 37.0 50-54 36.113800000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.1529 37.0 37.0 37.0 37.0 37.0 60-64 36.0481 37.0 37.0 37.0 37.0 37.0 65-69 36.030800000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.9998 37.0 37.0 37.0 37.0 37.0 75-79 35.926500000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.8605 37.0 37.0 37.0 37.0 37.0 85-89 35.998599999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.741400000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.7884 37.0 37.0 37.0 37.0 37.0 100-104 35.79667293601756 37.0 37.0 37.0 37.0 37.0 105-109 35.76967535998053 37.0 37.0 37.0 37.0 37.0 110-114 35.65219589459987 37.0 37.0 37.0 37.0 37.0 115-119 35.598316403626875 37.0 37.0 37.0 37.0 37.0 120-124 35.75100313436788 37.0 37.0 37.0 37.0 37.0 125-129 35.57131232496072 37.0 37.0 37.0 37.0 37.0 130-134 35.49765850448604 37.0 37.0 37.0 37.0 37.0 135-139 35.421677833706326 37.0 37.0 37.0 34.6 37.0 140-144 35.28688360362 37.0 37.0 37.0 27.4 37.0 145-149 35.49189405637907 37.0 37.0 37.0 37.0 37.0 150 35.54088369730828 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 5.0 24 6.0 25 5.0 26 8.0 27 12.0 28 8.0 29 22.0 30 27.0 31 46.0 32 53.0 33 102.0 34 181.0 35 655.0 36 2677.0 37 191.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.500000000000004 19.45 17.5 35.55 2 21.6 29.2 35.125 14.075 3 21.725 33.25 26.775 18.25 4 22.925 37.574999999999996 18.9 20.599999999999998 5 21.125 38.625 22.125 18.125 6 18.075 37.175000000000004 24.55 20.200000000000003 7 16.975 17.25 42.575 23.200000000000003 8 18.55 21.975 29.925 29.549999999999997 9 21.099999999999998 22.25 27.975 28.675 10-14 21.345 28.325 27.455000000000002 22.875 15-19 21.654999999999998 28.34 27.375 22.63 20-24 21.310000000000002 28.585 27.08 23.025000000000002 25-29 21.615000000000002 29.044999999999998 26.784999999999997 22.555 30-34 21.175 28.12 27.93 22.775000000000002 35-39 21.68 28.735 26.945000000000004 22.64 40-44 21.68 29.34 26.93 22.05 45-49 21.990000000000002 28.08 27.175 22.755 50-54 21.605 27.965 27.48 22.95 55-59 22.175 28.660000000000004 26.895000000000003 22.27 60-64 21.23 27.925 27.715 23.13 65-69 22.28 27.944999999999997 27.165 22.61 70-74 22.42 28.28 27.6 21.7 75-79 22.09 27.74 27.689999999999998 22.48 80-84 22.705000000000002 28.599999999999998 26.495 22.2 85-89 22.16 28.205000000000002 27.665 21.97 90-94 21.93 28.515 27.41 22.145 95-99 22.259999999999998 28.705000000000002 27.05 21.985 100-104 22.52351410846508 26.936161697018214 27.78166900140084 22.75865519311587 105-109 22.40032057703867 27.479463033460227 28.170707273091566 21.949509116409537 110-114 22.859434529777424 27.541608181271304 27.772207740124323 21.826749548826953 115-119 22.462387161484454 27.94383149448345 27.632898696088265 21.96088264794383 120-124 22.766961059815337 27.33340024086712 27.60939381774388 22.290244881573663 125-129 22.384159211981103 28.043019398934565 27.480148758669216 22.092672630415116 130-134 22.573829048649195 27.956935151179756 27.433717361774917 22.03551843839614 135-139 22.574636258369836 27.599053516588633 27.820570910738557 22.005739314302975 140-144 22.42476267420723 27.656029085033328 27.999394061805695 21.919814178953747 145-149 22.32092999644652 27.808518198893346 27.706990202548354 22.16356160211178 150 23.641442356526156 27.50126968004063 27.958354494667343 20.898933468765872 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 3.5 24 3.0 25 3.5 26 5.0 27 8.0 28 9.5 29 7.5 30 13.5 31 23.0 32 29.0 33 40.0 34 59.0 35 70.0 36 92.0 37 121.5 38 128.0 39 153.0 40 183.0 41 215.5 42 241.5 43 239.0 44 258.0 45 266.5 46 258.5 47 241.5 48 235.0 49 220.0 50 175.0 51 137.0 52 111.0 53 96.0 54 79.5 55 58.5 56 43.5 57 43.0 58 34.5 59 27.0 60 20.0 61 13.0 62 11.0 63 3.5 64 0.5 65 1.0 66 0.5 67 0.0 68 1.0 69 2.5 70 1.5 71 1.5 72 1.5 73 0.0 74 0.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 2.0 102-103 2.0 104-105 3.0 106-107 1.0 108-109 2.0 110-111 0.0 112-113 1.0 114-115 1.0 116-117 0.0 118-119 1.0 120-121 1.0 122-123 3.0 124-125 2.0 126-127 2.0 128-129 3.0 130-131 1.0 132-133 0.0 134-135 2.0 136-137 1.0 138-139 5.0 140-141 5.0 142-143 8.0 144-145 16.0 146-147 0.0 148-149 0.0 150-151 3938.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.525 #Duplication Level Percentage of deduplicated Percentage of total 1 83.53786291529482 69.77499999999999 2 13.70847051780904 22.900000000000002 3 2.394492666866208 6.0 4 0.26938042502244836 0.8999999999999999 5 0.029931158335827598 0.125 6 0.059862316671655195 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTC 6 0.15 No Hit CAAAAATCAAACAACAAAGAAAGAAAGAAAAGAAAACGAATGGCCACCGT 6 0.15 No Hit CTTTTGCCCGGTCATCATTAAATCATGATGATGTTTTTATCTTGGATACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298244 spots for SRR10828692.sra Written 1298244 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra Read 1298229 spots for SRR10828692.sra Written 1298229 spots for SRR10828692.sra SRR ids: ['SRR10828692.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lwo45pmj SRR10828692.sra spots: 25964595 blocks: [[1, 1298229], [1298230, 2596458], [2596459, 3894687], [3894688, 5192916], [5192917, 6491145], [6491146, 7789374], [7789375, 9087603], [9087604, 10385832], [10385833, 11684061], [11684062, 12982290], [12982291, 14280519], [14280520, 15578748], [15578749, 16876977], [16876978, 18175206], [18175207, 19473435], [19473436, 20771664], [20771665, 22069893], [22069894, 23368122], [23368123, 24666351], [24666352, 25964595]] SRR10828692 file size 8737054 SRR10828692 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10828692 SRR10828692_1.fastq SRR10828692_2.fastq Input file: SRR10828692_1.fastq Paired file: SRR10828692_2.fastq trimmed: SRR10828692-trimmed-pair1.fastq, SRR10828692-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:10:32 2025 >> started Thu Feb 13 20:11:02 2025 >> done (29.419s) 25964595 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 25 ( 0.00%) empty read pairs filtered out after trimming by size control 25964569 (100.00%) read pairs available; of these: 83987 ( 0.32%) trimmed read pairs available after processing 25880582 (99.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 2 0.00% 22 3 0.00% 23 3 0.00% 24 3 0.00% 25 2 0.00% 26 4 0.00% 27 5 0.00% 28 5 0.00% 29 8 0.00% 30 10 0.00% 31 3 0.00% 32 7 0.00% 33 8 0.00% 34 9 0.00% 35 9 0.00% 36 6 0.00% 37 10 0.00% 38 5 0.00% 39 4 0.00% 40 5 0.00% 41 8 0.00% 42 11 0.00% 43 10 0.00% 44 14 0.00% 45 7 0.00% 46 7 0.00% 47 11 0.00% 48 8 0.00% 49 7 0.00% 50 10 0.00% 51 12 0.00% 52 14 0.00% 53 10 0.00% 54 8 0.00% 55 16 0.00% 56 16 0.00% 57 12 0.00% 58 4 0.00% 59 8 0.00% 60 14 0.00% 61 14 0.00% 62 17 0.00% 63 14 0.00% 64 9 0.00% 65 10 0.00% 66 12 0.00% 67 16 0.00% 68 14 0.00% 69 10 0.00% 70 9 0.00% 71 12 0.00% 72 7 0.00% 73 5 0.00% 74 8 0.00% 75 14 0.00% 76 5 0.00% 77 3 0.00% 78 5 0.00% 79 9 0.00% 80 10 0.00% 81 11 0.00% 82 15 0.00% 83 14 0.00% 84 5 0.00% 85 11 0.00% 86 9 0.00% 87 7 0.00% 88 12 0.00% 89 13 0.00% 90 10 0.00% 91 10 0.00% 92 8 0.00% 93 13 0.00% 94 14 0.00% 95 16 0.00% 96 19 0.00% 97 12 0.00% 98 10 0.00% 99 1661 0.01% 100 1836 0.01% 101 1947 0.01% 102 2095 0.01% 103 2265 0.01% 104 2309 0.01% 105 2544 0.01% 106 2639 0.01% 107 2896 0.01% 108 3157 0.01% 109 3366 0.01% 110 3418 0.01% 111 3653 0.01% 112 3884 0.01% 113 4142 0.02% 114 4211 0.02% 115 4636 0.02% 116 4812 0.02% 117 5105 0.02% 118 5399 0.02% 119 5790 0.02% 120 5926 0.02% 121 6179 0.02% 122 6640 0.03% 123 7182 0.03% 124 7381 0.03% 125 7808 0.03% 126 8101 0.03% 127 8690 0.03% 128 8927 0.03% 129 9176 0.04% 130 9771 0.04% 131 10297 0.04% 132 10866 0.04% 133 11489 0.04% 134 11831 0.05% 135 12380 0.05% 136 13003 0.05% 137 111 0.00% 138 13692 0.05% 139 14236 0.05% 140 14904 0.06% 141 15446 0.06% 142 16840 0.06% 143 18260 0.07% 144 23583 0.09% 145 73755 0.28% 146 19362 0.07% 147 20050 0.08% 148 20999 0.08% 149 21545 0.08% 150 25463644 98.07% 25964569 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=29 prefix-density=0.57 prefix-fanout=2.0 sequence=CTCAAGTCTACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=57.64 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.6 sequence=CAAAACCACATATAGAGGGTGTACTAGCTAATTAGCCTGTAAGAGATG criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=32 prefix-density=0.57 prefix-fanout=2.1 sequence=CTCAAGTCTACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=54.54 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.6 sequence=AGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTACTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCACTTGCACTTGCCATCGTTCTCATCTGCAGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGT SRR10828692 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:12:18 Started mapping on | Feb 13 20:12:19 Finished on | Feb 13 20:16:02 Mapping speed, Million of reads per hour | 419.16 Number of input reads | 25964569 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 23593068 Uniquely mapped reads % | 90.87% Average mapped length | 287.91 Number of splices: Total | 23350530 Number of splices: Annotated (sjdb) | 22802903 Number of splices: GT/AG | 22812282 Number of splices: GC/AG | 409895 Number of splices: AT/AC | 13688 Number of splices: Non-canonical | 114665 Mismatch rate per base, % | 1.18% Deletion rate per base | 0.09% Deletion average length | 3.34 Insertion rate per base | 0.06% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1006806 % of reads mapped to multiple loci | 3.88% Number of reads mapped to too many loci | 229548 % of reads mapped to too many loci | 0.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1364695 1364695 1364695 N_multimapping 1006806 1006806 1006806 N_noFeature 707526 11963812 12102789 N_ambiguous 416632 91524 92004 UnstrandedReadsAssigned:22468910 PositiveStrandReadsAssigned:11537732 NegativeStrandReadsAssigned:11398275 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR10828692 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR10828692-trimmed-pair1.fastq SRR10828692-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,964,569 reads, 22,106,423 reads pseudoaligned [quant] estimated average fragment length: 235.825 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52401 SRR10828692.ke.tsv 34699 SRR10828692.se.tsv 87100 total ==> SRR10828692.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.17 1019 20.8174 Potri.005G024800.1.v4.1 1035 800.175 255 11.6092 Potri.004G059700.1.v4.1 961 726.179 15 0.752476 Potri.007G009000.2.v4.1 1416 1181.17 0 0 Potri.003G141000.2.v4.1 2943 2708.17 561.311 7.55044 Potri.016G087400.1.v4.1 270 56.8087 1014 650.232 Potri.015G069301.1.v4.1 564 329.389 0 0 Potri.010G195200.1.v4.1 1773 1538.17 56 1.32626 Potri.012G127500.1.v4.1 977 742.179 57 2.79776 ==> SRR10828692.se.tsv <== Potri.001G166300.v4.1 4 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 388 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR10828692 completed mapping pipeline successfully