Starting /dee2/code/volunteer_pipeline.sh SRR10828693
    current disk space = 3087486398464
    free memory = 1429745192 
SRR10828693 SRAfilesize
bc1172f14ff5e68352b8ceaaf3e8eed7  SRR10828693.sra
SRR10828693.sra file validated
SRR10828693 is paired end
SRR10828693 is conventional basespace
SRR10828693 read1 length is 100-150 nt
##FastQC	0.11.5
>>Basic Statistics	pass
#Measure	Value
Filename	SRR10828693_1.fastq
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	4000
Sequences flagged as poor quality	0
Sequence length	100-150
%GC	44
>>END_MODULE
>>Per base sequence quality	pass
#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
1	36.45375	37.0	37.0	37.0	37.0	37.0
2	36.48425	37.0	37.0	37.0	37.0	37.0
3	36.505	37.0	37.0	37.0	37.0	37.0
4	36.4635	37.0	37.0	37.0	37.0	37.0
5	36.481	37.0	37.0	37.0	37.0	37.0
6	36.4595	37.0	37.0	37.0	37.0	37.0
7	36.4	37.0	37.0	37.0	37.0	37.0
8	36.587	37.0	37.0	37.0	37.0	37.0
9	36.5855	37.0	37.0	37.0	37.0	37.0
10-14	36.4894	37.0	37.0	37.0	37.0	37.0
15-19	36.4864	37.0	37.0	37.0	37.0	37.0
20-24	36.461400000000005	37.0	37.0	37.0	37.0	37.0
25-29	36.416799999999995	37.0	37.0	37.0	37.0	37.0
30-34	36.409400000000005	37.0	37.0	37.0	37.0	37.0
35-39	36.320100000000004	37.0	37.0	37.0	37.0	37.0
40-44	36.3072	37.0	37.0	37.0	37.0	37.0
45-49	36.3282	37.0	37.0	37.0	37.0	37.0
50-54	36.3078	37.0	37.0	37.0	37.0	37.0
55-59	36.2483	37.0	37.0	37.0	37.0	37.0
60-64	36.2547	37.0	37.0	37.0	37.0	37.0
65-69	36.2057	37.0	37.0	37.0	37.0	37.0
70-74	36.1577	37.0	37.0	37.0	37.0	37.0
75-79	36.173500000000004	37.0	37.0	37.0	37.0	37.0
80-84	36.1749	37.0	37.0	37.0	37.0	37.0
85-89	36.1059	37.0	37.0	37.0	37.0	37.0
90-94	36.0409	37.0	37.0	37.0	37.0	37.0
95-99	36.065999999999995	37.0	37.0	37.0	37.0	37.0
100-104	36.033803225806444	37.0	37.0	37.0	37.0	37.0
105-109	35.9197155963012	37.0	37.0	37.0	37.0	37.0
110-114	35.956309121703605	37.0	37.0	37.0	37.0	37.0
115-119	35.919775405199644	37.0	37.0	37.0	37.0	37.0
120-124	35.82370232314245	37.0	37.0	37.0	37.0	37.0
125-129	35.90678294860685	37.0	37.0	37.0	37.0	37.0
130-134	35.763171948070976	37.0	37.0	37.0	37.0	37.0
135-139	35.69435084254354	37.0	37.0	37.0	37.0	37.0
140-144	35.690747315915516	37.0	37.0	37.0	37.0	37.0
145-149	35.63436317552837	37.0	37.0	37.0	37.0	37.0
150	35.5805138641567	37.0	37.0	37.0	37.0	37.0
>>END_MODULE
>>Per sequence quality scores	pass
#Quality	Count
24	1.0
25	3.0
26	6.0
27	13.0
28	21.0
29	32.0
30	39.0
31	54.0
32	57.0
33	62.0
34	108.0
35	312.0
36	2996.0
37	296.0
>>END_MODULE
>>Per base sequence content	fail
#Base	G	A	T	C
1	26.319739804853644	18.663997998498875	17.68826619964974	37.32799599699775
2	22.316737553164874	28.621466099574683	34.92619464598449	14.135601701275958
3	22.375	30.95	27.425	19.25
4	22.05	37.05	21.325	19.575
5	21.125	38.95	22.0	17.925
6	17.125	36.4	26.125	20.349999999999998
7	15.875	16.3	44.5	23.325000000000003
8	18.675	22.650000000000002	29.299999999999997	29.375
9	21.0	22.625	30.025000000000002	26.35
10-14	21.16	28.754999999999995	27.55	22.535
15-19	21.215	28.005000000000003	28.32	22.46
20-24	21.705	28.64	27.200000000000003	22.455
25-29	21.355	29.244999999999997	27.675	21.725
30-34	20.995	29.080000000000002	27.939999999999998	21.985
35-39	21.51	27.939999999999998	28.065	22.485
40-44	21.875	28.599999999999998	27.61	21.915000000000003
45-49	21.505	28.895	27.01	22.59
50-54	21.92	28.854999999999997	27.105	22.12
55-59	22.195	28.62	27.42	21.765
60-64	21.93	28.189999999999998	27.6	22.28
65-69	21.665	28.76	27.450000000000003	22.125
70-74	21.995	28.299999999999997	27.189999999999998	22.515
75-79	21.555	28.665000000000003	27.089999999999996	22.689999999999998
80-84	21.875	28.685	27.474999999999998	21.965
85-89	21.755	28.315	27.060000000000002	22.869999999999997
90-94	22.41	27.650000000000002	27.639999999999997	22.3
95-99	22.07	27.99	27.615000000000002	22.325
100-104	21.839367873574712	28.170634126825366	27.310462092418486	22.679535907181435
105-109	21.744785153318993	28.302736231304088	27.622430093542093	22.330048521834826
110-114	22.47084146768784	28.06727736897432	27.756920458527308	21.70496070481053
115-119	22.393590385578367	27.901852779168753	27.746619929894845	21.957936905358036
120-124	21.77116223124342	28.21129654688518	27.87049566481231	22.14704555705909
125-129	22.08216151064685	28.073523503415025	27.963037364403377	21.881277621534753
130-134	22.396016697681436	27.968616405974956	28.003822360810744	21.631544535532868
135-139	22.44640605296343	27.979823455233294	28.030264817150062	21.543505674653215
140-144	21.989475814612426	28.455778182554138	27.615867233353576	21.938878769479864
145-149	22.27984543420785	28.304860687411022	27.59812894041082	21.817164937970308
150	21.59755787331468	27.906385143729327	29.94149071483083	20.55456626812516
>>END_MODULE
>>Per sequence GC content	pass
#GC Content	Count
0	0.0
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10	0.0
11	0.0
12	0.0
13	0.0
14	0.0
15	0.0
16	0.0
17	0.5
18	1.0
19	1.0
20	1.0
21	2.5
22	2.0
23	0.5
24	3.0
25	4.0
26	6.0
27	13.0
28	14.0
29	13.0
30	16.0
31	20.5
32	35.0
33	53.0
34	64.5
35	80.5
36	94.0
37	100.5
38	131.0
39	164.5
40	204.5
41	228.5
42	234.0
43	244.5
44	280.0
45	287.5
46	242.0
47	230.5
48	233.5
49	203.0
50	149.0
51	112.0
52	95.5
53	88.0
54	81.5
55	72.5
56	55.5
57	38.5
58	25.0
59	18.0
60	12.5
61	7.0
62	7.5
63	7.5
64	4.5
65	3.0
66	3.0
67	1.5
68	1.5
69	3.5
70	2.5
71	1.0
72	0.5
73	0.0
74	0.0
75	0.0
76	0.0
77	0.0
78	0.0
79	0.0
80	0.0
81	0.0
82	0.0
83	0.0
84	0.0
85	0.0
86	0.0
87	0.0
88	0.0
89	0.0
90	0.0
91	0.0
92	0.0
93	0.0
94	0.0
95	0.0
96	0.0
97	0.0
98	0.0
99	0.0
100	0.0
>>END_MODULE
>>Per base N content	pass
#Base	N-Count
1	0.075
2	0.075
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10-14	0.0
15-19	0.0
20-24	0.0
25-29	0.0
30-34	0.0
35-39	0.0
40-44	0.0
45-49	0.0
50-54	0.0
55-59	0.0
60-64	0.0
65-69	0.0
70-74	0.0
75-79	0.0
80-84	0.0
85-89	0.0
90-94	0.0
95-99	0.0
100-104	0.0
105-109	0.0
110-114	0.0
115-119	0.0
120-124	0.0
125-129	0.0
130-134	0.0
135-139	0.0
140-144	0.0
145-149	0.0
150	0.0
>>END_MODULE
>>Sequence Length Distribution	warn
#Length	Count
100-101	1.0
102-103	0.0
104-105	0.0
106-107	1.0
108-109	1.0
110-111	2.0
112-113	0.0
114-115	1.0
116-117	0.0
118-119	1.0
120-121	1.0
122-123	5.0
124-125	3.0
126-127	3.0
128-129	3.0
130-131	1.0
132-133	4.0
134-135	6.0
136-137	4.0
138-139	5.0
140-141	5.0
142-143	5.0
144-145	17.0
146-147	0.0
148-149	0.0
150-151	3931.0
>>END_MODULE
>>Sequence Duplication Levels	pass
#Total Deduplicated Percentage	84.05
#Duplication Level	Percentage of deduplicated	Percentage of total
1	83.75966686496133	70.39999999999999
2	13.86079714455681	23.3
3	2.0820939916716243	5.25
4	0.2379535990481856	0.8
5	0.0594883997620464	0.25
6	0.0	0.0
7	0.0	0.0
8	0.0	0.0
9	0.0	0.0
>10	0.0	0.0
>50	0.0	0.0
>100	0.0	0.0
>500	0.0	0.0
>1k	0.0	0.0
>5k	0.0	0.0
>10k+	0.0	0.0
>>END_MODULE
>>Overrepresented sequences	warn
#Sequence	Count	Percentage	Possible Source
TAGAAAGTACACTTGTATGGTCCGAAGGAAGAAGTGACTGGCAGCCATTG	5	0.125	No Hit
CCACATTCTCCAGTAAATACACCCGAATTATATAACTGGAAATTTCTGCC	5	0.125	No Hit
>>END_MODULE
>>Adapter Content	pass
#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
1	0.0	0.0	0.0	0.0	0.0
2	0.0	0.0	0.0	0.0	0.0
3	0.0	0.0	0.0	0.0	0.0
4	0.0	0.0	0.0	0.0	0.0
5	0.0	0.0	0.0	0.0	0.0
6	0.0	0.0	0.0	0.0	0.0
7	0.0	0.0	0.0	0.0	0.0
8	0.0	0.0	0.0	0.0	0.0
9	0.0	0.0	0.0	0.0	0.0
10-11	0.0	0.0	0.0	0.0	0.0
12-13	0.0	0.0	0.0	0.0	0.0
14-15	0.0	0.0	0.0	0.0	0.0
16-17	0.0	0.0	0.0	0.0	0.0
18-19	0.0	0.0	0.0	0.0	0.0
20-21	0.0	0.0	0.0	0.0	0.0
22-23	0.0	0.0	0.0	0.0	0.0
24-25	0.0	0.0	0.0	0.0	0.0
26-27	0.0	0.0	0.0	0.0	0.0
28-29	0.0	0.0	0.0	0.0	0.0
30-31	0.0	0.0	0.0	0.0	0.0
32-33	0.0	0.0	0.0	0.0	0.0
34-35	0.0	0.0	0.0	0.0	0.0
36-37	0.0	0.0	0.0	0.0	0.0
38-39	0.0	0.0	0.0	0.0	0.0
40-41	0.0	0.0	0.0	0.0	0.0
42-43	0.0	0.0	0.0	0.0	0.0
44-45	0.0	0.0	0.0	0.0	0.0
46-47	0.0	0.0	0.0	0.0	0.0
48-49	0.0	0.0	0.0	0.0	0.0
50-51	0.0	0.0	0.0	0.0	0.0
52-53	0.0	0.0	0.0	0.0	0.0
54-55	0.0	0.0	0.0	0.0	0.0
56-57	0.0	0.0	0.0	0.0	0.0
58-59	0.0	0.0	0.0	0.0	0.0
60-61	0.0	0.0	0.0	0.0	0.0
62-63	0.0	0.0	0.0	0.0	0.0
64-65	0.0	0.0	0.0	0.0	0.0
66-67	0.0	0.0	0.0	0.0	0.0
68-69	0.0	0.0	0.0	0.0	0.0
70-71	0.0	0.0	0.0	0.0	0.0
72-73	0.0	0.0	0.0	0.0	0.0
74-75	0.0	0.0	0.0	0.0	0.0
76-77	0.0	0.0	0.0	0.0	0.0
78-79	0.0	0.0	0.0	0.0	0.0
80-81	0.0	0.0	0.0	0.0	0.0
82-83	0.0	0.0	0.0	0.0	0.0
84-85	0.0	0.0	0.0	0.0	0.0
86-87	0.0	0.0	0.0	0.0	0.0
88-89	0.0	0.0	0.0	0.0	0.0
90-91	0.0	0.0	0.0	0.0	0.0
92-93	0.0	0.0	0.0	0.0	0.0
94-95	0.0	0.0	0.0	0.0	0.0
96-97	0.0	0.0	0.0	0.0	0.0
98-99	0.0	0.0	0.0	0.0	0.0
100-101	0.0	0.0	0.0	0.0	0.0
102-103	0.0	0.0	0.0	0.0	0.0
104-105	0.0	0.0	0.0	0.0	0.0
106-107	0.0	0.0	0.0	0.0	0.0
108-109	0.0	0.0	0.0	0.0	0.0
110-111	0.0	0.0	0.0	0.0	0.0
112-113	0.0	0.0	0.0	0.0	0.0
114-115	0.0	0.0	0.0	0.0	0.0
116-117	0.0	0.0	0.0	0.0	0.0
118-119	0.0	0.0	0.0	0.0	0.0
120-121	0.0	0.0	0.0	0.0	0.0
122-123	0.0	0.0	0.0	0.0	0.0
124-125	0.0	0.0	0.0	0.0	0.0
126-127	0.0	0.0	0.0	0.0	0.0
128-129	0.0	0.0	0.0	0.0	0.0
130-131	0.0	0.0	0.0	0.0	0.0
132-133	0.0	0.0	0.0	0.0	0.0
134-135	0.0	0.0	0.0	0.0	0.0
136-137	0.0	0.0	0.0	0.0	0.0
138	0.0	0.0	0.0	0.0	0.0
>>END_MODULE
>>Kmer Content	warn
#Sequence	Count	PValue	Obs/Exp Max	Max Obs/Exp Position
TCTCTGC	10	0.007057572	143.42499	4
>>END_MODULE
SRR10828693 read2 length is 100-150 nt
##FastQC	0.11.5
>>Basic Statistics	pass
#Measure	Value
Filename	SRR10828693_2.fastq
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	4000
Sequences flagged as poor quality	0
Sequence length	100-150
%GC	43
>>END_MODULE
>>Per base sequence quality	pass
#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
1	36.223	37.0	37.0	37.0	37.0	37.0
2	36.163	37.0	37.0	37.0	37.0	37.0
3	36.246	37.0	37.0	37.0	37.0	37.0
4	36.201	37.0	37.0	37.0	37.0	37.0
5	36.364	37.0	37.0	37.0	37.0	37.0
6	36.305	37.0	37.0	37.0	37.0	37.0
7	36.438	37.0	37.0	37.0	37.0	37.0
8	36.4105	37.0	37.0	37.0	37.0	37.0
9	36.3835	37.0	37.0	37.0	37.0	37.0
10-14	36.3552	37.0	37.0	37.0	37.0	37.0
15-19	36.2562	37.0	37.0	37.0	37.0	37.0
20-24	36.3124	37.0	37.0	37.0	37.0	37.0
25-29	36.1981	37.0	37.0	37.0	37.0	37.0
30-34	36.22769999999999	37.0	37.0	37.0	37.0	37.0
35-39	36.186	37.0	37.0	37.0	37.0	37.0
40-44	36.1719	37.0	37.0	37.0	37.0	37.0
45-49	36.13779999999999	37.0	37.0	37.0	37.0	37.0
50-54	36.1339	37.0	37.0	37.0	37.0	37.0
55-59	36.1034	37.0	37.0	37.0	37.0	37.0
60-64	36.0456	37.0	37.0	37.0	37.0	37.0
65-69	36.006	37.0	37.0	37.0	37.0	37.0
70-74	36.011	37.0	37.0	37.0	37.0	37.0
75-79	35.9367	37.0	37.0	37.0	37.0	37.0
80-84	35.8488	37.0	37.0	37.0	37.0	37.0
85-89	35.9505	37.0	37.0	37.0	37.0	37.0
90-94	35.789	37.0	37.0	37.0	37.0	37.0
95-99	35.8057	37.0	37.0	37.0	37.0	37.0
100-104	35.83826834208553	37.0	37.0	37.0	37.0	37.0
105-109	35.751028744742754	37.0	37.0	37.0	37.0	37.0
110-114	35.67136324709114	37.0	37.0	37.0	37.0	37.0
115-119	35.598413055971854	37.0	37.0	37.0	37.0	37.0
120-124	35.710774143526386	37.0	37.0	37.0	37.0	37.0
125-129	35.51527949532897	37.0	37.0	37.0	37.0	37.0
130-134	35.4925104575275	37.0	37.0	37.0	34.6	37.0
135-139	35.47391905120479	37.0	37.0	37.0	37.0	37.0
140-144	35.30424237170085	37.0	37.0	37.0	32.2	37.0
145-149	35.4938685220665	37.0	37.0	37.0	37.0	37.0
150	35.40396845586365	37.0	37.0	37.0	37.0	37.0
>>END_MODULE
>>Per sequence quality scores	pass
#Quality	Count
21	1.0
22	1.0
23	3.0
24	5.0
25	7.0
26	8.0
27	11.0
28	18.0
29	15.0
30	25.0
31	39.0
32	65.0
33	90.0
34	184.0
35	687.0
36	2659.0
37	182.0
>>END_MODULE
>>Per base sequence content	fail
#Base	G	A	T	C
1	25.025	18.65	18.5	37.824999999999996
2	22.05	29.375	34.8	13.775
3	20.674999999999997	32.1	26.5	20.724999999999998
4	21.125	36.175000000000004	21.075	21.625
5	20.3	37.8	24.349999999999998	17.549999999999997
6	16.075	37.55	24.825	21.55
7	15.65	16.975	43.15	24.224999999999998
8	20.349999999999998	23.125	29.325000000000003	27.200000000000003
9	21.15	23.425	28.925	26.5
10-14	20.13	28.465	27.875	23.53
15-19	21.05	27.534999999999997	28.415000000000003	23.0
20-24	20.785	28.615000000000002	28.07	22.53
25-29	21.13	28.685	27.700000000000003	22.485
30-34	20.25	28.57	28.405	22.775000000000002
35-39	21.23	29.005	27.415	22.35
40-44	20.93	28.365000000000002	27.994999999999997	22.71
45-49	21.38	28.975	27.36	22.285
50-54	21.195	28.345	28.249999999999996	22.21
55-59	20.865000000000002	29.115000000000002	27.575	22.445
60-64	21.125	28.12	28.42	22.335
65-69	21.07	28.560000000000002	27.855	22.515
70-74	21.105	28.689999999999998	26.965	23.24
75-79	21.404999999999998	28.305000000000003	27.6	22.689999999999998
80-84	22.009999999999998	28.435	27.089999999999996	22.465
85-89	21.705	28.455000000000002	27.815	22.025
90-94	21.73	28.675	27.21	22.384999999999998
95-99	21.654999999999998	28.685	27.575	22.085
100-104	21.729345869173837	28.675735147029407	27.375475095019002	22.219443888777757
105-109	22.019908959031564	28.532839777900055	27.257265769596316	22.18998549347206
110-114	21.870150673274267	27.711868648946286	28.00220253291285	22.415778144866596
115-119	22.819228843264895	27.621432148222336	27.30595893840761	22.25338007010516
120-124	21.525585125043854	28.476920763794915	27.299153009572496	22.698341101588735
125-129	21.715548413017277	28.219164323021296	28.16894335074327	21.89634391321816
130-134	21.747221244279032	27.91832218478097	28.295528843735855	22.038927727204143
135-139	22.330390920554855	27.364438839848678	27.843631778058008	22.46153846153846
140-144	21.974296701072657	28.445658773527626	27.367941712204008	22.21210281319571
145-149	21.390075249135652	27.969290217612365	28.248932275777918	22.39170225747407
150	21.444924955482065	28.873060290002545	28.796743831086236	20.885270923429154
>>END_MODULE
>>Per sequence GC content	pass
#GC Content	Count
0	0.0
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10	0.0
11	0.0
12	0.0
13	0.0
14	0.0
15	0.0
16	0.5
17	0.5
18	0.5
19	0.5
20	0.5
21	1.0
22	1.0
23	1.0
24	3.5
25	5.0
26	5.5
27	7.0
28	12.5
29	20.0
30	22.0
31	25.0
32	30.5
33	46.5
34	68.0
35	81.5
36	103.5
37	127.0
38	154.5
39	179.0
40	183.0
41	212.0
42	259.5
43	263.0
44	262.0
45	271.5
46	256.5
47	224.0
48	197.0
49	191.0
50	155.0
51	124.0
52	115.5
53	91.0
54	72.0
55	52.5
56	44.5
57	40.5
58	27.5
59	20.5
60	14.5
61	12.5
62	8.5
63	1.5
64	1.5
65	1.5
66	0.0
67	0.5
68	0.5
69	0.0
70	0.0
71	0.0
72	0.0
73	0.0
74	0.0
75	0.0
76	0.0
77	0.0
78	0.0
79	0.0
80	0.0
81	0.0
82	0.0
83	0.0
84	0.0
85	0.0
86	0.0
87	0.0
88	0.0
89	0.0
90	0.0
91	0.0
92	0.0
93	0.0
94	0.0
95	0.0
96	0.0
97	0.0
98	0.0
99	0.0
100	0.0
>>END_MODULE
>>Per base N content	pass
#Base	N-Count
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10-14	0.0
15-19	0.0
20-24	0.0
25-29	0.0
30-34	0.0
35-39	0.0
40-44	0.0
45-49	0.0
50-54	0.0
55-59	0.0
60-64	0.0
65-69	0.0
70-74	0.0
75-79	0.0
80-84	0.0
85-89	0.0
90-94	0.0
95-99	0.0
100-104	0.0
105-109	0.0
110-114	0.0
115-119	0.0
120-124	0.0
125-129	0.0
130-134	0.0
135-139	0.0
140-144	0.0
145-149	0.0
150	0.0
>>END_MODULE
>>Sequence Length Distribution	warn
#Length	Count
100-101	1.0
102-103	0.0
104-105	0.0
106-107	1.0
108-109	1.0
110-111	2.0
112-113	0.0
114-115	1.0
116-117	0.0
118-119	1.0
120-121	1.0
122-123	5.0
124-125	3.0
126-127	3.0
128-129	3.0
130-131	1.0
132-133	4.0
134-135	6.0
136-137	4.0
138-139	5.0
140-141	5.0
142-143	5.0
144-145	17.0
146-147	0.0
148-149	0.0
150-151	3931.0
>>END_MODULE
>>Sequence Duplication Levels	pass
#Total Deduplicated Percentage	84.575
#Duplication Level	Percentage of deduplicated	Percentage of total
1	84.39255099024534	71.375
2	13.331362695832102	22.55
3	1.9804906887378066	5.025
4	0.23647650014779784	0.8
5	0.05911912503694946	0.25
6	0.0	0.0
7	0.0	0.0
8	0.0	0.0
9	0.0	0.0
>10	0.0	0.0
>50	0.0	0.0
>100	0.0	0.0
>500	0.0	0.0
>1k	0.0	0.0
>5k	0.0	0.0
>10k+	0.0	0.0
>>END_MODULE
>>Overrepresented sequences	warn
#Sequence	Count	Percentage	Possible Source
GCCATTTCTCAAACTCATCTTCATCATCGTTGGAAGACACTAAAGTAGAA	5	0.125	No Hit
GGTAGATGTGACACGTACAGGAAAAATGCCAAAGTTGTTTCAATCGATTC	5	0.125	No Hit
>>END_MODULE
>>Adapter Content	pass
#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
1	0.0	0.0	0.0	0.0	0.0
2	0.0	0.0	0.0	0.0	0.0
3	0.0	0.0	0.0	0.0	0.0
4	0.0	0.0	0.0	0.0	0.0
5	0.0	0.0	0.0	0.0	0.0
6	0.0	0.0	0.0	0.0	0.0
7	0.0	0.0	0.0	0.0	0.0
8	0.0	0.0	0.0	0.0	0.0
9	0.0	0.0	0.0	0.0	0.0
10-11	0.0	0.0	0.0	0.0	0.0
12-13	0.0	0.0	0.0	0.0	0.0
14-15	0.0	0.0	0.0	0.0	0.0
16-17	0.0	0.0	0.0	0.0	0.0
18-19	0.0	0.0	0.0	0.0	0.0
20-21	0.0	0.0	0.0	0.0	0.0
22-23	0.0	0.0	0.0	0.0	0.0
24-25	0.0	0.0	0.0	0.0	0.0
26-27	0.0	0.0	0.0	0.0	0.0
28-29	0.0	0.0	0.0	0.0	0.0
30-31	0.0	0.0	0.0	0.0	0.0
32-33	0.0	0.0	0.0	0.0	0.0
34-35	0.0	0.0	0.0	0.0	0.0
36-37	0.0	0.0	0.0	0.0	0.0
38-39	0.0	0.0	0.0	0.0	0.0
40-41	0.0	0.0	0.0	0.0	0.0
42-43	0.0	0.0	0.0	0.0	0.0
44-45	0.0	0.0	0.0	0.0	0.0
46-47	0.0	0.0	0.0	0.0	0.0
48-49	0.0	0.0	0.0	0.0	0.0
50-51	0.0	0.0	0.0	0.0	0.0
52-53	0.0	0.0	0.0	0.0	0.0
54-55	0.0	0.0	0.0	0.0	0.0
56-57	0.0	0.0	0.0	0.0	0.0
58-59	0.0	0.0	0.0	0.0	0.0
60-61	0.0	0.0	0.0	0.0	0.0
62-63	0.0	0.0	0.0	0.0	0.0
64-65	0.0	0.0	0.0	0.0	0.0
66-67	0.0	0.0	0.0	0.0	0.0
68-69	0.0	0.0	0.0	0.0	0.0
70-71	0.0	0.0	0.0	0.0	0.0
72-73	0.0	0.0	0.0	0.0	0.0
74-75	0.0	0.0	0.0	0.0	0.0
76-77	0.0	0.0	0.0	0.0	0.0
78-79	0.0	0.0	0.0	0.0	0.0
80-81	0.0	0.0	0.0	0.0	0.0
82-83	0.0	0.0	0.0	0.0	0.0
84-85	0.0	0.0	0.0	0.0	0.0
86-87	0.0	0.0	0.0	0.0	0.0
88-89	0.0	0.0	0.0	0.0	0.0
90-91	0.0	0.0	0.0	0.0	0.0
92-93	0.0	0.0	0.0	0.0	0.0
94-95	0.0	0.0	0.0	0.0	0.0
96-97	0.0	0.0	0.0	0.0	0.0
98-99	0.0	0.0	0.0	0.0	0.0
100-101	0.0	0.0	0.0	0.0	0.0
102-103	0.0	0.0	0.0	0.0	0.0
104-105	0.0	0.0	0.0	0.0	0.0
106-107	0.0	0.0	0.0	0.0	0.0
108-109	0.0	0.0	0.0	0.0	0.0
110-111	0.0	0.0	0.0	0.0	0.0
112-113	0.0	0.0	0.0	0.0	0.0
114-115	0.0	0.0	0.0	0.0	0.0
116-117	0.0	0.0	0.0	0.0	0.0
118-119	0.0	0.0	0.0	0.0	0.0
120-121	0.0	0.0	0.0	0.0	0.0
122-123	0.0	0.0	0.0	0.0	0.0
124-125	0.0	0.0	0.0	0.0	0.0
126-127	0.0	0.0	0.0	0.0	0.0
128-129	0.0	0.0	0.0	0.0	0.0
130-131	0.0	0.0	0.0	0.0	0.0
132-133	0.0	0.0	0.0	0.0	0.0
134-135	0.0	0.0	0.0	0.0	0.0
136-137	0.0	0.0	0.0	0.0	0.0
138	0.0	0.0	0.0	0.0	0.0
>>END_MODULE
>>Kmer Content	warn
#Sequence	Count	PValue	Obs/Exp Max	Max Obs/Exp Position
GCCCCAA	10	0.007057572	143.42499	8
>>END_MODULE
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274838 spots for SRR10828693.sra
Written 1274838 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
Read 1274828 spots for SRR10828693.sra
Written 1274828 spots for SRR10828693.sra
SRR ids: ['SRR10828693.sra']
extra args: ['--split-files', '--defline-qual', '+']
tempdir: /tmp/pfd_etkagzp4
SRR10828693.sra spots: 25496570
blocks: [[1, 1274828], [1274829, 2549656], [2549657, 3824484], [3824485, 5099312], [5099313, 6374140], [6374141, 7648968], [7648969, 8923796], [8923797, 10198624], [10198625, 11473452], [11473453, 12748280], [12748281, 14023108], [14023109, 15297936], [15297937, 16572764], [16572765, 17847592], [17847593, 19122420], [19122421, 20397248], [20397249, 21672076], [21672077, 22946904], [22946905, 24221732], [24221733, 25496570]]
SRR10828693 file size 8579774
SRR10828693 completed basic pipeline successfully
skewer v0.2.2 [April 4, 2016]
COMMAND LINE:	skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10828693 SRR10828693_1.fastq SRR10828693_2.fastq
Input file:	SRR10828693_1.fastq
Paired file:	SRR10828693_2.fastq
trimmed:	SRR10828693-trimmed-pair1.fastq, SRR10828693-trimmed-pair2.fastq

Parameters used:
-- 3' end adapter sequence (-x):	AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
-- paired 3' end adapter sequence (-y):	AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
-- maximum error ratio allowed (-r):	0.100
-- maximum indel error ratio allowed (-d):	0.030
-- end quality threshold (-q):		10
-- minimum read length allowed after trimming (-l):	18
-- file format (-f):		Sanger/Illumina 1.8+ FASTQ 
-- number of concurrent threads (-t):	20
Thu Feb 13 19:53:35 2025 >> started

Thu Feb 13 19:54:05 2025 >> done (29.533s)
25496570 read pairs processed; of these:
       2 ( 0.00%) short read pairs filtered out after trimming by size control
       1 ( 0.00%) empty read pairs filtered out after trimming by size control
25496567 (100.00%) read pairs available; of these:
   74519 ( 0.29%) trimmed read pairs available after processing
25422048 (99.71%) untrimmed read pairs available after processing

Length distribution of reads after trimming:
length	count	percentage
 20	       1	  0.00%
 21	       4	  0.00%
 22	       3	  0.00%
 23	       2	  0.00%
 24	       4	  0.00%
 25	       6	  0.00%
 26	       9	  0.00%
 27	       4	  0.00%
 28	       5	  0.00%
 29	      10	  0.00%
 30	       9	  0.00%
 31	      10	  0.00%
 32	       9	  0.00%
 33	       8	  0.00%
 34	      11	  0.00%
 35	       9	  0.00%
 36	      18	  0.00%
 37	      14	  0.00%
 38	      12	  0.00%
 39	      15	  0.00%
 40	      15	  0.00%
 41	      11	  0.00%
 42	      11	  0.00%
 43	       9	  0.00%
 44	      13	  0.00%
 45	      18	  0.00%
 46	      23	  0.00%
 47	       9	  0.00%
 48	      11	  0.00%
 49	      18	  0.00%
 50	      12	  0.00%
 51	       9	  0.00%
 52	      14	  0.00%
 53	      22	  0.00%
 54	      12	  0.00%
 55	      22	  0.00%
 56	      15	  0.00%
 57	      11	  0.00%
 58	      18	  0.00%
 59	      14	  0.00%
 60	      13	  0.00%
 61	      10	  0.00%
 62	      15	  0.00%
 63	      12	  0.00%
 64	      10	  0.00%
 65	      22	  0.00%
 66	      13	  0.00%
 67	      13	  0.00%
 68	      13	  0.00%
 69	      23	  0.00%
 70	      21	  0.00%
 71	      12	  0.00%
 72	      15	  0.00%
 73	      18	  0.00%
 74	      15	  0.00%
 75	      17	  0.00%
 76	      18	  0.00%
 77	      13	  0.00%
 78	      20	  0.00%
 79	      16	  0.00%
 80	      17	  0.00%
 81	      17	  0.00%
 82	      21	  0.00%
 83	      12	  0.00%
 84	      21	  0.00%
 85	      20	  0.00%
 86	      28	  0.00%
 87	      12	  0.00%
 88	      22	  0.00%
 89	      21	  0.00%
 90	      32	  0.00%
 91	      23	  0.00%
 92	      21	  0.00%
 93	      20	  0.00%
 94	      30	  0.00%
 95	      14	  0.00%
 96	      20	  0.00%
 97	      16	  0.00%
 98	      25	  0.00%
 99	    1705	  0.01%
100	    1838	  0.01%
101	    1955	  0.01%
102	    2160	  0.01%
103	    2283	  0.01%
104	    2405	  0.01%
105	    2482	  0.01%
106	    2751	  0.01%
107	    2847	  0.01%
108	    2899	  0.01%
109	    3156	  0.01%
110	    3486	  0.01%
111	    3568	  0.01%
112	    3635	  0.01%
113	    3930	  0.02%
114	    4235	  0.02%
115	    4480	  0.02%
116	    4498	  0.02%
117	    4897	  0.02%
118	    5188	  0.02%
119	    5307	  0.02%
120	    5557	  0.02%
121	    6160	  0.02%
122	    6105	  0.02%
123	    6648	  0.03%
124	    6944	  0.03%
125	    7093	  0.03%
126	    7451	  0.03%
127	    7915	  0.03%
128	    7934	  0.03%
129	    8535	  0.03%
130	    8896	  0.03%
131	    9242	  0.04%
132	    9785	  0.04%
133	   10446	  0.04%
134	   10599	  0.04%
135	   11156	  0.04%
136	   11952	  0.05%
137	     101	  0.00%
138	   12181	  0.05%
139	   12423	  0.05%
140	   13204	  0.05%
141	   14069	  0.06%
142	   14693	  0.06%
143	   16149	  0.06%
144	   22886	  0.09%
145	   75082	  0.29%
146	   16993	  0.07%
147	   17693	  0.07%
148	   18175	  0.07%
149	   18980	  0.07%
150	25030664	 98.17%
25496567 reads passed initial QC


criterion=sequence-density
sequence-density=0.31
sequence-density-rank=1
fanout-score=2.11
fanout-score-rank=29
prefix-density=0.32
prefix-fanout=2.1
sequence=GGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCACTCTCGGCTCCCA


criterion=fanout-score
sequence-density=0.01
sequence-density-rank=31
fanout-score=191.19
fanout-score-rank=1
prefix-density=0.17
prefix-fanout=14.0
sequence=CTTCTCTCTGTCTTCTTGATTCCTTGTTTTTTCTTCTGTTTATTACAGCAGTCATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGCAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCAGCAAAGCCTGCAGAAACCGTGGCTGCTGCATAATGTTGATAATACCAATATTTACTATGTGGAACTGTGTTCTACTGGGTTATAGTTTG


criterion=sequence-density
sequence-density=0.31
sequence-density-rank=1
fanout-score=2.25
fanout-score-rank=33
prefix-density=0.33
prefix-fanout=2.1
sequence=GGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCACTCTCGGCTCCCA


criterion=fanout-score
sequence-density=0.01
sequence-density-rank=35
fanout-score=234.31
fanout-score-rank=1
prefix-density=0.19
prefix-fanout=14.5
sequence=CTTCTCTCTGTCTTCTTGATTCCTTGTTTTTTCTTCTGTTTATTACAGCAGTCATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGCAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCAGCAAAGCCTGCAGAAACCGTGGCTGCTGCATAATGTTGATAATACCAATATTTACTATGTGGAACTGTGTTCTACTGGGTTATAGTTTG
SRR10828693 testing PE reads STAR mapping to Ensembl genome
                                 Started job on |	Feb 13 19:55:15
                             Started mapping on |	Feb 13 19:55:15
                                    Finished on |	Feb 13 19:59:06
       Mapping speed, Million of reads per hour |	397.35

                          Number of input reads |	25496567
                      Average input read length |	291
                                    UNIQUE READS:
                   Uniquely mapped reads number |	23263544
                        Uniquely mapped reads % |	91.24%
                          Average mapped length |	287.69
                       Number of splices: Total |	22958031
            Number of splices: Annotated (sjdb) |	22267923
                       Number of splices: GT/AG |	22437325
                       Number of splices: GC/AG |	359374
                       Number of splices: AT/AC |	18807
               Number of splices: Non-canonical |	142525
                      Mismatch rate per base, % |	1.23%
                         Deletion rate per base |	0.10%
                        Deletion average length |	3.45
                        Insertion rate per base |	0.08%
                       Insertion average length |	2.79
                             MULTI-MAPPING READS:
        Number of reads mapped to multiple loci |	1116404
             % of reads mapped to multiple loci |	4.38%
        Number of reads mapped to too many loci |	46297
             % of reads mapped to too many loci |	0.18%
                                  UNMAPPED READS:
       % of reads unmapped: too many mismatches |	0.00%
                 % of reads unmapped: too short |	4.09%
                     % of reads unmapped: other |	0.11%
                                  CHIMERIC READS:
                       Number of chimeric reads |	0
                            % of chimeric reads |	0.00%
N_unmapped	1116619	1116619	1116619
N_multimapping	1116404	1116404	1116404
N_noFeature	844435	11886854	11985057
N_ambiguous	425937	95762	95137
UnstrandedReadsAssigned:21993172 PositiveStrandReadsAssigned:11280928 NegativeStrandReadsAssigned:11183350
Dataset is classified unstranded
MeadianReadLen=142 20thPercentileLength=142 echo kmer=137
SRR10828693 Starting Kallisto paired end mapping to ensembl reference transcriptome

[quant] fragment length distribution will be estimated from the data
[index] k-mer length: 31
[index] number of targets: 52,400
[index] number of k-mers: 62,057,036
[index] number of equivalence classes: 130,681
[quant] running in paired-end mode
[quant] will process pair 1: SRR10828693-trimmed-pair1.fastq
                             SRR10828693-trimmed-pair2.fastq
[quant] finding pseudoalignments for the reads ... done
[quant] processed 25,496,567 reads, 21,655,314 reads pseudoaligned
[quant] estimated average fragment length: 242.507
[   em] quantifying the abundances ... done
[   em] the Expectation-Maximization algorithm ran for 1,123 rounds

  52401 SRR10828693.ke.tsv
  34699 SRR10828693.se.tsv
  87100 total
==> SRR10828693.ke.tsv <==
target_id	length	eff_length	est_counts	tpm
Potri.005G200100.1.v4.1	2018	1776.49	1230	23.3691
Potri.005G024800.1.v4.1	1035	793.493	496	21.0979
Potri.004G059700.1.v4.1	961	719.512	10	0.469096
Potri.007G009000.2.v4.1	1416	1174.49	0	0
Potri.003G141000.2.v4.1	2943	2701.49	832.345	10.3992
Potri.016G087400.1.v4.1	270	54.5199	1502	929.856
Potri.015G069301.1.v4.1	564	322.739	0	0
Potri.010G195200.1.v4.1	1773	1531.49	61	1.34436
Potri.012G127500.1.v4.1	977	735.508	31	1.42257

==> SRR10828693.se.tsv <==
Potri.001G166300.v4.1	2
Potri.001G448400.v4.1	4
Potri.001G233950.v4.1	0
Potri.001G122700.v4.1	379
Potri.001G212900.v4.1	0
Potri.001G182400.v4.1	0
Potri.001G256600.v4.1	0
Potri.001G040500.v4.1	15
Potri.001G416900.v4.1	2
Potri.001G452600.v4.1	85
SRR10828693 completed mapping pipeline successfully
