Starting /dee2/code/volunteer_pipeline.sh SRR10828694 current disk space = 3087622938624 free memory = 1540557172 SRR10828694 SRAfilesize a7362632b11f481b8db726455e658e7b SRR10828694.sra SRR10828694.sra file validated SRR10828694 is paired end SRR10828694 is conventional basespace SRR10828694 read1 length is 106-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828694_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 106-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.32575 37.0 37.0 37.0 37.0 37.0 2 36.35225 37.0 37.0 37.0 37.0 37.0 3 36.441 37.0 37.0 37.0 37.0 37.0 4 36.417 37.0 37.0 37.0 37.0 37.0 5 36.5615 37.0 37.0 37.0 37.0 37.0 6 36.4635 37.0 37.0 37.0 37.0 37.0 7 36.4725 37.0 37.0 37.0 37.0 37.0 8 36.498 37.0 37.0 37.0 37.0 37.0 9 36.5255 37.0 37.0 37.0 37.0 37.0 10-14 36.5112 37.0 37.0 37.0 37.0 37.0 15-19 36.5201 37.0 37.0 37.0 37.0 37.0 20-24 36.480900000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.3869 37.0 37.0 37.0 37.0 37.0 30-34 36.4184 37.0 37.0 37.0 37.0 37.0 35-39 36.376599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3234 37.0 37.0 37.0 37.0 37.0 45-49 36.2614 37.0 37.0 37.0 37.0 37.0 50-54 36.345099999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.301100000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.2178 37.0 37.0 37.0 37.0 37.0 65-69 36.165800000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.2012 37.0 37.0 37.0 37.0 37.0 75-79 36.1708 37.0 37.0 37.0 37.0 37.0 80-84 36.1234 37.0 37.0 37.0 37.0 37.0 85-89 36.113 37.0 37.0 37.0 37.0 37.0 90-94 36.0283 37.0 37.0 37.0 37.0 37.0 95-99 36.0391 37.0 37.0 37.0 37.0 37.0 100-104 36.03490000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.96894388597149 37.0 37.0 37.0 37.0 37.0 110-114 35.905351042463366 37.0 37.0 37.0 37.0 37.0 115-119 35.91507260891337 37.0 37.0 37.0 37.0 37.0 120-124 35.81978477228217 37.0 37.0 37.0 37.0 37.0 125-129 35.862800712912 37.0 37.0 37.0 37.0 37.0 130-134 35.78925327611004 37.0 37.0 37.0 37.0 37.0 135-139 35.67826400929558 37.0 37.0 37.0 37.0 37.0 140-144 35.69929192500805 37.0 37.0 37.0 37.0 37.0 145-149 35.66161850635533 37.0 37.0 37.0 37.0 37.0 150 35.61136478944698 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 3.0 25 1.0 26 4.0 27 17.0 28 20.0 29 21.0 30 33.0 31 37.0 32 68.0 33 71.0 34 134.0 35 327.0 36 3005.0 37 257.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.65666416604151 18.65466366591648 17.5293823455864 37.15928982245561 2 22.202753441802255 28.986232790988737 35.018773466833544 13.792240300375468 3 20.9 32.675 25.924999999999997 20.5 4 23.175 37.175000000000004 20.375 19.275000000000002 5 21.175 37.925 22.925 17.974999999999998 6 17.849999999999998 38.324999999999996 23.474999999999998 20.349999999999998 7 16.075 16.175 44.574999999999996 23.175 8 20.05 23.150000000000002 28.725 28.075 9 21.125 23.825 28.025 27.025 10-14 21.560000000000002 29.020000000000003 26.615 22.805 15-19 21.145 27.389999999999997 28.185 23.28 20-24 21.955 28.660000000000004 27.250000000000004 22.134999999999998 25-29 21.475 28.749999999999996 27.875 21.9 30-34 21.475 28.599999999999998 27.49 22.435 35-39 20.724999999999998 28.305000000000003 28.345 22.625 40-44 21.935 28.04 28.13 21.895 45-49 21.625 28.315 27.92 22.14 50-54 21.07 28.215 28.025 22.689999999999998 55-59 21.755 27.825 27.839999999999996 22.58 60-64 21.85 28.634999999999998 27.375 22.14 65-69 21.86 27.939999999999998 27.99 22.21 70-74 21.91 27.55 28.265 22.275 75-79 21.154999999999998 28.17 27.865000000000002 22.81 80-84 21.884999999999998 27.915 27.715 22.485 85-89 22.285 27.665 27.395000000000003 22.655 90-94 21.7 27.474999999999998 28.144999999999996 22.68 95-99 21.62 27.82 27.975 22.585 100-104 22.1 28.439999999999998 27.26 22.2 105-109 21.723258488773318 27.849177376606495 28.0892133820073 22.338350752612893 110-114 22.601471397827936 28.081677593714026 27.28091687102748 22.03593413743056 115-119 22.32849273910866 28.212318477716575 27.526289434151224 21.932899349023536 120-124 21.445396682203178 27.59985967022503 28.431814764697037 22.52292888287476 125-129 21.959544245344574 28.389298800381468 27.45570446217939 22.195452492094564 130-134 22.16300467595153 27.79928603750817 27.80934184725225 22.22836743928805 135-139 22.295015874615736 27.551277528599506 28.04515446253087 22.10855213425389 140-144 21.94542698332491 28.07478524507327 28.287013643254166 21.69277412834765 145-149 21.89307091407122 28.502586994014408 27.670690879577965 21.93365121233641 150 22.171486555048197 28.411973617453068 27.904616945712835 21.511922881785893 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.5 22 3.5 23 3.0 24 3.0 25 3.0 26 4.5 27 6.5 28 14.0 29 22.0 30 18.5 31 22.0 32 33.5 33 43.0 34 51.5 35 71.5 36 97.0 37 109.0 38 142.0 39 177.5 40 195.0 41 203.0 42 217.5 43 245.5 44 275.0 45 276.5 46 246.5 47 239.0 48 235.0 49 196.5 50 161.0 51 139.5 52 116.5 53 103.0 54 83.5 55 66.5 56 47.0 57 34.0 58 28.0 59 21.0 60 15.0 61 7.0 62 5.5 63 3.5 64 1.5 65 0.5 66 0.0 67 1.0 68 1.5 69 1.5 70 2.5 71 1.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 106 1.0 107 0.0 108 0.0 109 1.0 110 1.0 111 1.0 112 0.0 113 2.0 114 0.0 115 0.0 116 0.0 117 0.0 118 0.0 119 0.0 120 1.0 121 3.0 122 1.0 123 2.0 124 0.0 125 0.0 126 4.0 127 0.0 128 0.0 129 0.0 130 3.0 131 3.0 132 2.0 133 1.0 134 1.0 135 3.0 136 2.0 137 0.0 138 4.0 139 2.0 140 0.0 141 3.0 142 3.0 143 5.0 144 5.0 145 4.0 146 0.0 147 0.0 148 0.0 149 0.0 150 3942.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.575 #Duplication Level Percentage of deduplicated Percentage of total 1 85.62664329535495 73.275 2 12.269938650306749 21.0 3 1.7820625182588372 4.575 4 0.26292725679228746 0.8999999999999999 5 0.05842827928717499 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGATACAAGTACAAATGATACAGTCATTGCTTTGGCTAGCGGATTATC 5 0.125 No Hit ATGCATTAAGGCCCCCATCGAATACTGGAAGTGGTGAATTTGAAGTTACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGATT 10 0.007002685 143.8 8 AATGGAA 10 0.007002685 143.8 5 ATCAATG 10 0.007002685 143.8 2 >>END_MODULE SRR10828694 read2 length is 106-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828694_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 106-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8665 37.0 37.0 37.0 37.0 37.0 2 35.682 37.0 37.0 37.0 37.0 37.0 3 36.045 37.0 37.0 37.0 37.0 37.0 4 35.867 37.0 37.0 37.0 37.0 37.0 5 36.1825 37.0 37.0 37.0 37.0 37.0 6 36.09525 37.0 37.0 37.0 37.0 37.0 7 36.186 37.0 37.0 37.0 37.0 37.0 8 36.1595 37.0 37.0 37.0 37.0 37.0 9 36.192 37.0 37.0 37.0 37.0 37.0 10-14 36.2183 37.0 37.0 37.0 37.0 37.0 15-19 36.13075 37.0 37.0 37.0 37.0 37.0 20-24 36.14110000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.0713 37.0 37.0 37.0 37.0 37.0 30-34 36.115899999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.03315 37.0 37.0 37.0 37.0 37.0 40-44 36.0193 37.0 37.0 37.0 37.0 37.0 45-49 36.02290000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.9563 37.0 37.0 37.0 37.0 37.0 55-59 35.9401 37.0 37.0 37.0 37.0 37.0 60-64 35.8481 37.0 37.0 37.0 37.0 37.0 65-69 35.851299999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.8433 37.0 37.0 37.0 37.0 37.0 75-79 35.716300000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.7036 37.0 37.0 37.0 37.0 37.0 85-89 35.7996 37.0 37.0 37.0 37.0 37.0 90-94 35.516000000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.6295 37.0 37.0 37.0 37.0 37.0 100-104 35.711800000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.56977086771693 37.0 37.0 37.0 37.0 37.0 110-114 35.499354181593354 37.0 37.0 37.0 37.0 37.0 115-119 35.33500250375563 37.0 37.0 37.0 32.2 37.0 120-124 35.502872094722264 37.0 37.0 37.0 37.0 37.0 125-129 35.26270765375368 37.0 37.0 37.0 29.8 37.0 130-134 35.327216554708826 37.0 37.0 37.0 29.8 37.0 135-139 35.267873880167045 37.0 37.0 37.0 32.2 37.0 140-144 35.1546467636282 37.0 37.0 37.0 27.4 37.0 145-149 35.26304964818043 37.0 37.0 37.0 32.2 37.0 150 35.23845763571791 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 6.0 23 2.0 24 5.0 25 9.0 26 13.0 27 16.0 28 18.0 29 23.0 30 32.0 31 46.0 32 71.0 33 109.0 34 239.0 35 813.0 36 2450.0 37 146.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.775 16.825000000000003 19.6 37.8 2 21.735867933966986 28.039019509754876 36.54327163581791 13.681840920460232 3 21.825 32.475 24.6 21.099999999999998 4 22.375 36.575 19.975 21.075 5 21.525 37.225 22.15 19.1 6 16.52913228307077 38.084521130282575 24.681170292573142 20.705176294073517 7 17.45 16.85 40.949999999999996 24.75 8 19.809904952476238 21.010505252626313 30.340170085042523 28.83941970985493 9 20.485242621310658 23.08654327163582 27.863931965982992 28.564282141070535 10-14 20.959191838367673 28.970794158831765 27.140428085617124 22.929585917183438 15-19 20.876043802190107 28.181409070453523 28.061403070153506 22.88114405720286 20-24 21.285 27.950000000000003 27.565 23.200000000000003 25-29 20.3 28.355000000000004 28.84 22.505 30-34 20.94 28.634999999999998 27.794999999999998 22.63 35-39 21.6882532379857 27.904185627844175 27.989198379756964 22.418362754413163 40-44 21.27 28.455000000000002 27.33 22.945 45-49 20.765 28.660000000000004 27.894999999999996 22.68 50-54 21.555 28.415000000000003 27.155 22.875 55-59 21.355 28.265 27.279999999999998 23.1 60-64 21.27 28.610000000000003 28.02 22.1 65-69 21.3 28.310000000000002 26.845000000000002 23.544999999999998 70-74 21.43 28.465 27.544999999999998 22.56 75-79 22.465 27.815 27.279999999999998 22.439999999999998 80-84 21.345 28.26 27.87 22.525000000000002 85-89 21.335 27.76 28.63 22.275 90-94 21.62 27.675 28.285 22.42 95-99 21.75 27.74 27.900000000000002 22.61 100-104 22.055 27.73 28.015 22.2 105-109 21.48037009252313 28.402100525131285 28.037009252313077 22.080520130032507 110-114 21.805715429658175 27.67128772333717 27.541164105900606 22.98183274110405 115-119 21.86279419128693 28.04206309464196 27.611417125688533 22.483725588382576 120-124 22.071868891895953 28.512003207537713 27.38936500776826 22.026762892798075 125-129 22.220549114089245 28.078100687647446 28.002810821663402 21.69853937659991 130-134 22.15294886620745 28.191462617527275 27.713811654683496 21.94177686158178 135-139 22.461321372776293 28.89684019553495 27.40009071208991 21.241747719598848 140-144 22.623679822123403 28.344029511344687 27.464753145687 21.567537520844915 145-149 22.542355686314295 27.929390281018566 27.523587298366643 22.004666734300496 150 22.881785895484523 28.741755454084224 26.91527143581938 21.461187214611872 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 2.0 20 2.0 21 0.5 22 0.5 23 2.0 24 4.5 25 4.0 26 7.0 27 11.0 28 11.5 29 15.0 30 22.0 31 27.5 32 35.0 33 43.5 34 51.0 35 69.0 36 95.5 37 121.0 38 134.0 39 150.5 40 178.5 41 207.5 42 228.0 43 239.0 44 264.5 45 282.0 46 265.0 47 263.5 48 247.0 49 208.0 50 161.5 51 120.0 52 106.0 53 90.0 54 68.5 55 59.5 56 56.5 57 40.0 58 31.0 59 26.5 60 17.5 61 8.5 62 5.5 63 3.0 64 1.0 65 0.0 66 1.5 67 1.5 68 1.5 69 2.0 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.05 9 0.05 10-14 0.02 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.010001500225033755 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005053057099545225 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 106 1.0 107 0.0 108 0.0 109 1.0 110 1.0 111 1.0 112 0.0 113 2.0 114 0.0 115 0.0 116 0.0 117 0.0 118 0.0 119 0.0 120 1.0 121 3.0 122 1.0 123 2.0 124 0.0 125 0.0 126 4.0 127 0.0 128 0.0 129 0.0 130 3.0 131 3.0 132 2.0 133 1.0 134 1.0 135 3.0 136 2.0 137 0.0 138 4.0 139 2.0 140 0.0 141 3.0 142 3.0 143 5.0 144 5.0 145 4.0 146 0.0 147 0.0 148 0.0 149 0.0 150 3942.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.725 #Duplication Level Percentage of deduplicated Percentage of total 1 85.8267716535433 73.575 2 12.1026538349373 20.75 3 1.7497812773403325 4.5 4 0.23330417031204434 0.8 5 0.08748906386701663 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACATTCCCATCTTCACACAATTCATATATCTTATCTAGTCTAAAAAATA 5 0.125 No Hit CTTCGCCTCACTTTCTGCCCCAGTTACTGTGACCTCAATTAGACATGTAG 5 0.125 No Hit CAAAAGATATCATTTACAAAATAACAGAGAGCAGTAGCATGTGGAAGACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGCGA 10 0.007002685 143.8 4 TCTATGA 10 0.007002685 143.8 7 CTATGAG 10 0.007002685 143.8 8 >>END_MODULE Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215977 spots for SRR10828694.sra Written 1215977 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra Read 1215974 spots for SRR10828694.sra Written 1215974 spots for SRR10828694.sra SRR ids: ['SRR10828694.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qooxcl1h SRR10828694.sra spots: 24319483 blocks: [[1, 1215974], [1215975, 2431948], [2431949, 3647922], [3647923, 4863896], [4863897, 6079870], [6079871, 7295844], [7295845, 8511818], [8511819, 9727792], [9727793, 10943766], [10943767, 12159740], [12159741, 13375714], [13375715, 14591688], [14591689, 15807662], [15807663, 17023636], [17023637, 18239610], [18239611, 19455584], [19455585, 20671558], [20671559, 21887532], [21887533, 23103506], [23103507, 24319483]] SRR10828694 file size 8184139 SRR10828694 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10828694 SRR10828694_1.fastq SRR10828694_2.fastq Input file: SRR10828694_1.fastq Paired file: SRR10828694_2.fastq trimmed: SRR10828694-trimmed-pair1.fastq, SRR10828694-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:07:34 2025 >> started Thu Feb 13 20:08:01 2025 >> done (27.184s) 24319483 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 15 ( 0.00%) empty read pairs filtered out after trimming by size control 24319468 (100.00%) read pairs available; of these: 68044 ( 0.28%) trimmed read pairs available after processing 24251424 (99.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 2 0.00% 24 1 0.00% 25 3 0.00% 26 2 0.00% 27 5 0.00% 28 4 0.00% 29 2 0.00% 30 3 0.00% 31 2 0.00% 32 5 0.00% 33 8 0.00% 34 3 0.00% 35 5 0.00% 36 11 0.00% 37 11 0.00% 38 6 0.00% 39 9 0.00% 40 5 0.00% 41 9 0.00% 42 7 0.00% 43 9 0.00% 44 13 0.00% 45 9 0.00% 46 10 0.00% 47 8 0.00% 48 6 0.00% 49 8 0.00% 50 9 0.00% 51 9 0.00% 52 4 0.00% 53 4 0.00% 54 8 0.00% 55 4 0.00% 56 11 0.00% 57 8 0.00% 58 10 0.00% 59 7 0.00% 60 9 0.00% 61 9 0.00% 62 8 0.00% 63 9 0.00% 64 12 0.00% 65 13 0.00% 66 11 0.00% 67 9 0.00% 68 9 0.00% 69 10 0.00% 70 9 0.00% 71 10 0.00% 72 8 0.00% 73 10 0.00% 74 10 0.00% 75 10 0.00% 76 10 0.00% 77 5 0.00% 78 11 0.00% 79 12 0.00% 80 10 0.00% 81 9 0.00% 82 6 0.00% 83 9 0.00% 84 12 0.00% 85 8 0.00% 86 14 0.00% 87 5 0.00% 88 7 0.00% 89 10 0.00% 90 8 0.00% 91 13 0.00% 92 11 0.00% 93 11 0.00% 94 14 0.00% 95 11 0.00% 96 12 0.00% 97 13 0.00% 98 17 0.00% 99 1326 0.01% 100 1487 0.01% 101 1635 0.01% 102 1697 0.01% 103 1720 0.01% 104 1819 0.01% 105 2104 0.01% 106 2192 0.01% 107 2200 0.01% 108 2392 0.01% 109 2562 0.01% 110 2779 0.01% 111 2898 0.01% 112 3103 0.01% 113 3289 0.01% 114 3329 0.01% 115 3738 0.02% 116 3754 0.02% 117 4128 0.02% 118 4162 0.02% 119 4414 0.02% 120 4687 0.02% 121 4857 0.02% 122 5308 0.02% 123 5455 0.02% 124 5665 0.02% 125 6016 0.02% 126 6147 0.03% 127 6865 0.03% 128 7000 0.03% 129 7155 0.03% 130 7774 0.03% 131 8015 0.03% 132 8497 0.03% 133 9131 0.04% 134 9442 0.04% 135 9692 0.04% 136 10231 0.04% 137 111 0.00% 138 10452 0.04% 139 11535 0.05% 140 11794 0.05% 141 12454 0.05% 142 13346 0.05% 143 14833 0.06% 144 20357 0.08% 145 68163 0.28% 146 15595 0.06% 147 16059 0.07% 148 16958 0.07% 149 17562 0.07% 150 23910948 98.32% 24319468 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=32 prefix-density=0.38 prefix-fanout=2.0 sequence=CTCAAGTCTACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=76.09 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.9 sequence=AAAAAAAATCTAAACTGCACCCGCTCATCCAGCAATGGCAGCA criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=33 prefix-density=0.37 prefix-fanout=2.0 sequence=ACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=34.19 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.8 sequence=CTGCATTTGCTAGCTAGAAGTCACTCTACCCTTTGCATTACTTCCTCAATCAACCACTGCTGTTTGATCATGGCAGCAACCATCTCAACCGTTGGAGCTGTCAACACAGCACCGCTGGCTTTGAATGGCTCTGGCGCTGGATCCACAGTCCCAAATTCAGCTTTCT SRR10828694 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:08:49 Started mapping on | Feb 13 20:08:50 Finished on | Feb 13 20:13:12 Mapping speed, Million of reads per hour | 334.16 Number of input reads | 24319468 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22323240 Uniquely mapped reads % | 91.79% Average mapped length | 295.75 Number of splices: Total | 22608573 Number of splices: Annotated (sjdb) | 22001017 Number of splices: GT/AG | 22085879 Number of splices: GC/AG | 385406 Number of splices: AT/AC | 15072 Number of splices: Non-canonical | 122216 Mismatch rate per base, % | 1.20% Deletion rate per base | 0.10% Deletion average length | 3.53 Insertion rate per base | 0.07% Insertion average length | 2.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1036886 % of reads mapped to multiple loci | 4.26% Number of reads mapped to too many loci | 100720 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.34% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 959342 959342 959342 N_multimapping 1036886 1036886 1036886 N_noFeature 722854 11339705 11496130 N_ambiguous 372750 81741 81620 UnstrandedReadsAssigned:21227636 PositiveStrandReadsAssigned:10901794 NegativeStrandReadsAssigned:10745490 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR10828694 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR10828694-trimmed-pair1.fastq SRR10828694-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,319,468 reads, 20,613,774 reads pseudoaligned [quant] estimated average fragment length: 247.893 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,233 rounds 52401 SRR10828694.ke.tsv 34699 SRR10828694.se.tsv 87100 total ==> SRR10828694.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.11 952 19.9448 Potri.005G024800.1.v4.1 1035 788.107 339 15.9607 Potri.004G059700.1.v4.1 961 714.112 3 0.155881 Potri.007G009000.2.v4.1 1416 1169.11 0 0 Potri.003G141000.2.v4.1 2943 2696.11 772 10.6247 Potri.016G087400.1.v4.1 270 50.8539 1216 887.251 Potri.015G069301.1.v4.1 564 317.328 0 0 Potri.010G195200.1.v4.1 1773 1526.11 64 1.55608 Potri.012G127500.1.v4.1 977 730.107 302 15.3482 ==> SRR10828694.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 370 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR10828694 completed mapping pipeline successfully