Starting /dee2/code/volunteer_pipeline.sh SRR10828695 current disk space = 3087573688320 free memory = 1528028280 SRR10828695 SRAfilesize c213b4773454258818b8d685bccb97dc SRR10828695.sra SRR10828695.sra file validated SRR10828695 is paired end SRR10828695 is conventional basespace SRR10828695 read1 length is 105-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828695_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 105-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42125 37.0 37.0 37.0 37.0 37.0 2 36.46125 37.0 37.0 37.0 37.0 37.0 3 36.5145 37.0 37.0 37.0 37.0 37.0 4 36.523 37.0 37.0 37.0 37.0 37.0 5 36.5 37.0 37.0 37.0 37.0 37.0 6 36.4015 37.0 37.0 37.0 37.0 37.0 7 36.335 37.0 37.0 37.0 37.0 37.0 8 36.541 37.0 37.0 37.0 37.0 37.0 9 36.5395 37.0 37.0 37.0 37.0 37.0 10-14 36.514700000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.4643 37.0 37.0 37.0 37.0 37.0 20-24 36.4904 37.0 37.0 37.0 37.0 37.0 25-29 36.401700000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.390600000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.3829 37.0 37.0 37.0 37.0 37.0 40-44 36.3037 37.0 37.0 37.0 37.0 37.0 45-49 36.289 37.0 37.0 37.0 37.0 37.0 50-54 36.2859 37.0 37.0 37.0 37.0 37.0 55-59 36.1738 37.0 37.0 37.0 37.0 37.0 60-64 36.210499999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.132 37.0 37.0 37.0 37.0 37.0 70-74 36.187 37.0 37.0 37.0 37.0 37.0 75-79 36.1638 37.0 37.0 37.0 37.0 37.0 80-84 36.1243 37.0 37.0 37.0 37.0 37.0 85-89 36.16369999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.976800000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.02140000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.0163 37.0 37.0 37.0 37.0 37.0 105-109 35.93269562839234 37.0 37.0 37.0 37.0 37.0 110-114 35.947779064050735 37.0 37.0 37.0 37.0 37.0 115-119 35.8733843560987 37.0 37.0 37.0 37.0 37.0 120-124 35.84121821736649 37.0 37.0 37.0 37.0 37.0 125-129 35.88017376244145 37.0 37.0 37.0 37.0 37.0 130-134 35.83313057465746 37.0 37.0 37.0 37.0 37.0 135-139 35.716210360706604 37.0 37.0 37.0 37.0 37.0 140-144 35.683148756508444 37.0 37.0 37.0 37.0 37.0 145-149 35.64510781516003 37.0 37.0 37.0 37.0 37.0 150 35.64287535049707 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 3.0 25 6.0 26 7.0 27 9.0 28 16.0 29 12.0 30 38.0 31 40.0 32 58.0 33 81.0 34 133.0 35 353.0 36 2997.0 37 245.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.25656414103526 19.379844961240313 19.70492623155789 34.658664666166544 2 21.916437327995997 27.695771828871653 35.67675756817613 14.711033274956216 3 21.2 31.775 25.900000000000002 21.125 4 23.3 35.725 21.7 19.275000000000002 5 22.375 37.85 21.55 18.224999999999998 6 18.224999999999998 37.225 23.200000000000003 21.349999999999998 7 16.525000000000002 16.725 44.275 22.475 8 19.875 21.25 29.975 28.9 9 21.4 23.0 27.500000000000004 28.1 10-14 20.745 28.945 27.72 22.59 15-19 21.345 27.92 27.58 23.155 20-24 21.765 28.605000000000004 26.96 22.67 25-29 21.505 27.884999999999998 28.115000000000002 22.495 30-34 21.465 28.549999999999997 27.315 22.67 35-39 21.73 28.544999999999998 27.175 22.55 40-44 21.6 28.42 27.575 22.405 45-49 21.69 29.044999999999998 26.77 22.495 50-54 21.805 28.439999999999998 27.04 22.715 55-59 21.38 28.42 27.36 22.84 60-64 21.465 28.285 27.41 22.84 65-69 21.875 28.945 27.0 22.18 70-74 21.5 29.13 26.369999999999997 23.0 75-79 22.485 27.68 27.47 22.365 80-84 21.47 27.79 27.76 22.98 85-89 21.65 27.805000000000003 27.35 23.195 90-94 22.03 28.044999999999998 27.505000000000003 22.42 95-99 21.884999999999998 27.465 27.87 22.78 100-104 21.965 27.810000000000002 27.950000000000003 22.275 105-109 22.094361334867664 27.427828088257368 27.93815980387252 22.53965077300245 110-114 22.121500475785044 27.92607802874743 27.500375619772626 22.452045875694896 115-119 22.122518548225386 27.86244235011029 27.376178062963707 22.63886103870062 120-124 22.264643825982116 27.85089922636391 28.137245051743193 21.74721189591078 125-129 22.995271154039642 27.683871616862866 27.43736794446121 21.883489284636283 130-134 22.24685138539043 28.000000000000004 27.783375314861463 21.96977329974811 135-139 22.038609258136244 28.269658378815443 27.824944410753993 21.86678795229432 140-144 22.168735748669878 28.32531036230048 27.448695211553076 22.057258677476565 145-149 22.602007029697926 27.42091589832408 27.721460954612603 22.255616117365392 150 22.329849604894214 28.52408870762172 27.810349222533777 21.335712464950294 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 2.5 24 3.0 25 3.0 26 6.0 27 8.0 28 11.0 29 16.0 30 18.0 31 27.0 32 36.5 33 44.5 34 59.5 35 68.0 36 88.5 37 103.0 38 113.5 39 157.5 40 191.5 41 204.5 42 237.0 43 247.5 44 251.0 45 265.5 46 252.5 47 225.5 48 217.0 49 215.5 50 188.0 51 159.0 52 133.0 53 109.0 54 77.0 55 51.5 56 44.5 57 36.5 58 30.5 59 28.0 60 18.5 61 13.5 62 11.0 63 7.0 64 4.5 65 2.0 66 1.0 67 1.0 68 1.0 69 0.5 70 1.5 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 105 2.0 106 1.0 107 0.0 108 2.0 109 0.0 110 0.0 111 2.0 112 0.0 113 2.0 114 0.0 115 0.0 116 2.0 117 0.0 118 1.0 119 1.0 120 3.0 121 3.0 122 4.0 123 0.0 124 0.0 125 0.0 126 2.0 127 0.0 128 1.0 129 0.0 130 0.0 131 5.0 132 0.0 133 5.0 134 1.0 135 4.0 136 3.0 137 0.0 138 2.0 139 3.0 140 3.0 141 2.0 142 0.0 143 2.0 144 5.0 145 16.0 146 0.0 147 0.0 148 0.0 149 0.0 150 3923.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.09953161592506 72.675 2 12.997658079625293 22.2 3 1.668618266978923 4.275 4 0.1756440281030445 0.6 5 0.0585480093676815 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGCGTGTTGTCGAAT 5 0.125 No Hit ATTGTTAGAGGCAAGGTGGTCTGTTGGAGAAGCTGAGGCTGGCGTAGCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTGTG 10 0.0070833815 143.25 8 >>END_MODULE SRR10828695 read2 length is 105-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828695_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 105-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2995 37.0 37.0 37.0 37.0 37.0 2 36.00575 37.0 37.0 37.0 37.0 37.0 3 36.198 37.0 37.0 37.0 37.0 37.0 4 36.0065 37.0 37.0 37.0 37.0 37.0 5 36.242 37.0 37.0 37.0 37.0 37.0 6 36.19825 37.0 37.0 37.0 37.0 37.0 7 36.3035 37.0 37.0 37.0 37.0 37.0 8 36.32625 37.0 37.0 37.0 37.0 37.0 9 36.21725 37.0 37.0 37.0 37.0 37.0 10-14 36.38005 37.0 37.0 37.0 37.0 37.0 15-19 36.2294 37.0 37.0 37.0 37.0 37.0 20-24 36.30330000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.2302 37.0 37.0 37.0 37.0 37.0 30-34 36.1888 37.0 37.0 37.0 37.0 37.0 35-39 36.181200000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1885 37.0 37.0 37.0 37.0 37.0 45-49 36.1368 37.0 37.0 37.0 37.0 37.0 50-54 36.096199999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.0933 37.0 37.0 37.0 37.0 37.0 60-64 36.0769 37.0 37.0 37.0 37.0 37.0 65-69 36.0283 37.0 37.0 37.0 37.0 37.0 70-74 35.9858 37.0 37.0 37.0 37.0 37.0 75-79 35.9296 37.0 37.0 37.0 37.0 37.0 80-84 35.834199999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.9231 37.0 37.0 37.0 37.0 37.0 90-94 35.7641 37.0 37.0 37.0 37.0 37.0 95-99 35.8585 37.0 37.0 37.0 37.0 37.0 100-104 35.8849 37.0 37.0 37.0 37.0 37.0 105-109 35.73299816061389 37.0 37.0 37.0 37.0 37.0 110-114 35.63981613679806 37.0 37.0 37.0 37.0 37.0 115-119 35.566898259567715 37.0 37.0 37.0 37.0 37.0 120-124 35.705740273900425 37.0 37.0 37.0 37.0 37.0 125-129 35.45677948460984 37.0 37.0 37.0 37.0 37.0 130-134 35.48513533141762 37.0 37.0 37.0 37.0 37.0 135-139 35.43658422641355 37.0 37.0 37.0 37.0 37.0 140-144 35.3634704169735 37.0 37.0 37.0 32.2 37.0 145-149 35.513374228459924 37.0 37.0 37.0 37.0 37.0 150 35.40632169258221 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 2.0 22 2.0 23 5.0 24 5.0 25 9.0 26 6.0 27 7.0 28 22.0 29 17.0 30 29.0 31 37.0 32 44.0 33 103.0 34 194.0 35 673.0 36 2661.0 37 183.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.125 18.0 19.525000000000002 36.35 2 22.20555138784696 28.232058014503625 35.25881470367592 14.303575893973495 3 22.575 32.125 25.7 19.6 4 23.5 36.175000000000004 20.3 20.025000000000002 5 22.225 38.35 21.75 17.675 6 16.879219804951237 36.084021005251316 24.056014003500874 22.980745186296573 7 16.8 16.55 42.975 23.674999999999997 8 20.255063765941486 22.405601400350086 28.507126781695426 28.832208052013 9 19.604901225306325 23.680920230057513 28.93223305826457 27.781945486371594 10-14 20.72603630181509 28.86144307215361 27.086354317715887 23.326166308315415 15-19 21.715 27.800000000000004 27.810000000000002 22.675 20-24 20.794999999999998 28.499999999999996 27.91 22.795 25-29 21.22 28.910000000000004 27.43 22.439999999999998 30-34 21.25 28.51 27.834999999999997 22.405 35-39 21.07210721072107 28.01780178017802 27.97779777977798 22.932293229322934 40-44 21.14 28.055000000000003 28.050000000000004 22.755 45-49 20.935000000000002 29.26 26.545 23.26 50-54 21.055 28.645 27.705000000000002 22.595000000000002 55-59 21.47 29.145 27.265 22.12 60-64 21.560000000000002 27.495000000000005 27.37 23.575 65-69 21.455 27.47 27.96 23.115 70-74 21.67 28.075 27.51 22.745 75-79 21.535 28.275 27.560000000000002 22.63 80-84 21.815 28.194999999999997 27.284999999999997 22.705000000000002 85-89 21.959999999999997 28.08 27.450000000000003 22.509999999999998 90-94 21.855 28.005000000000003 27.57 22.57 95-99 21.61 28.52 27.41 22.46 100-104 22.145 27.87 27.884999999999998 22.1 105-109 22.105473831682176 27.749424597218052 27.594316021214848 22.550785549884917 110-114 22.146541793960033 28.016226774177394 27.305053338007713 22.53217809385486 115-119 22.33306597152597 28.158211349508722 27.566673350711852 21.94204932825346 120-124 22.073746609062596 27.323420074349443 28.01165477745403 22.59117853913393 125-129 21.87845859744441 27.62350337056042 28.071234530636886 22.426803501358286 130-134 22.423173803526446 27.34005037783375 28.261964735516372 21.974811083123424 135-139 21.90216292702648 27.804730139478472 27.991712148777037 22.301394784718013 140-144 22.275145680263492 27.08892829997466 28.375981758297442 22.259944261464405 145-149 22.123172533238243 27.48713769038765 28.704599867556418 21.685089908817687 150 21.106296201886313 27.682895743053788 27.657405047157784 23.553403007902116 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.5 20 2.0 21 2.5 22 3.0 23 2.5 24 2.0 25 4.0 26 5.5 27 8.5 28 14.0 29 16.0 30 19.0 31 29.5 32 37.5 33 45.5 34 57.0 35 67.5 36 85.0 37 109.5 38 126.0 39 157.5 40 190.0 41 215.0 42 241.0 43 241.0 44 259.5 45 267.0 46 250.0 47 231.0 48 220.5 49 202.5 50 175.0 51 156.0 52 117.5 53 93.5 54 79.5 55 61.5 56 49.0 57 41.5 58 31.5 59 20.0 60 14.0 61 12.5 62 10.5 63 5.5 64 4.5 65 3.0 66 0.0 67 0.0 68 1.5 69 2.5 70 1.0 71 0.0 72 0.0 73 1.5 74 2.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.025 9 0.025 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0050032521138740176 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 105 2.0 106 1.0 107 0.0 108 2.0 109 0.0 110 0.0 111 2.0 112 0.0 113 2.0 114 0.0 115 0.0 116 2.0 117 0.0 118 1.0 119 1.0 120 3.0 121 3.0 122 4.0 123 0.0 124 0.0 125 0.0 126 2.0 127 0.0 128 1.0 129 0.0 130 0.0 131 5.0 132 0.0 133 5.0 134 1.0 135 4.0 136 3.0 137 0.0 138 2.0 139 3.0 140 3.0 141 2.0 142 0.0 143 2.0 144 5.0 145 16.0 146 0.0 147 0.0 148 0.0 149 0.0 150 3923.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.1 #Duplication Level Percentage of deduplicated Percentage of total 1 85.94657375145181 74.0 2 12.253193960511034 21.099999999999998 3 1.5389082462253194 3.975 4 0.23228803716608595 0.8 5 0.029036004645760744 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAGTCGAAGCAGAGAAAAAAATGGGAGAGAAGAAGAAAGGCAAGGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGCAC 10 0.0070833815 143.25 1 >>END_MODULE Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209164 spots for SRR10828695.sra Written 1209164 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra Read 1209156 spots for SRR10828695.sra Written 1209156 spots for SRR10828695.sra SRR ids: ['SRR10828695.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3na0i020 SRR10828695.sra spots: 24183128 blocks: [[1, 1209156], [1209157, 2418312], [2418313, 3627468], [3627469, 4836624], [4836625, 6045780], [6045781, 7254936], [7254937, 8464092], [8464093, 9673248], [9673249, 10882404], [10882405, 12091560], [12091561, 13300716], [13300717, 14509872], [14509873, 15719028], [15719029, 16928184], [16928185, 18137340], [18137341, 19346496], [19346497, 20555652], [20555653, 21764808], [21764809, 22973964], [22973965, 24183128]] SRR10828695 file size 8137380 SRR10828695 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10828695 SRR10828695_1.fastq SRR10828695_2.fastq Input file: SRR10828695_1.fastq Paired file: SRR10828695_2.fastq trimmed: SRR10828695-trimmed-pair1.fastq, SRR10828695-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:26:39 2025 >> started Thu Feb 13 20:27:04 2025 >> done (25.251s) 24183128 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 12 ( 0.00%) empty read pairs filtered out after trimming by size control 24183115 (100.00%) read pairs available; of these: 68704 ( 0.28%) trimmed read pairs available after processing 24114411 (99.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 6 0.00% 25 6 0.00% 26 7 0.00% 27 1 0.00% 28 6 0.00% 29 4 0.00% 30 3 0.00% 31 3 0.00% 32 11 0.00% 33 8 0.00% 34 5 0.00% 35 6 0.00% 36 10 0.00% 37 4 0.00% 38 10 0.00% 39 12 0.00% 40 10 0.00% 41 6 0.00% 42 7 0.00% 43 8 0.00% 44 9 0.00% 45 12 0.00% 46 12 0.00% 47 14 0.00% 48 7 0.00% 49 14 0.00% 50 13 0.00% 51 16 0.00% 52 11 0.00% 53 11 0.00% 54 8 0.00% 55 7 0.00% 56 13 0.00% 57 12 0.00% 58 8 0.00% 59 10 0.00% 60 14 0.00% 61 11 0.00% 62 7 0.00% 63 11 0.00% 64 13 0.00% 65 8 0.00% 66 7 0.00% 67 8 0.00% 68 17 0.00% 69 10 0.00% 70 12 0.00% 71 15 0.00% 72 10 0.00% 73 18 0.00% 74 11 0.00% 75 11 0.00% 76 13 0.00% 77 13 0.00% 78 10 0.00% 79 11 0.00% 80 12 0.00% 81 12 0.00% 82 14 0.00% 83 9 0.00% 84 12 0.00% 85 18 0.00% 86 9 0.00% 87 10 0.00% 88 9 0.00% 89 11 0.00% 90 18 0.00% 91 9 0.00% 92 11 0.00% 93 14 0.00% 94 16 0.00% 95 11 0.00% 96 17 0.00% 97 13 0.00% 98 15 0.00% 99 1514 0.01% 100 1651 0.01% 101 1717 0.01% 102 1855 0.01% 103 1957 0.01% 104 2069 0.01% 105 2210 0.01% 106 2289 0.01% 107 2533 0.01% 108 2663 0.01% 109 2836 0.01% 110 2831 0.01% 111 3187 0.01% 112 3347 0.01% 113 3569 0.01% 114 3671 0.02% 115 3804 0.02% 116 4192 0.02% 117 4376 0.02% 118 4561 0.02% 119 4750 0.02% 120 4959 0.02% 121 5185 0.02% 122 5514 0.02% 123 5939 0.02% 124 6013 0.02% 125 6397 0.03% 126 6741 0.03% 127 7216 0.03% 128 7314 0.03% 129 7730 0.03% 130 7918 0.03% 131 8470 0.04% 132 8959 0.04% 133 9379 0.04% 134 9835 0.04% 135 10372 0.04% 136 10739 0.04% 137 87 0.00% 138 10996 0.05% 139 11576 0.05% 140 12217 0.05% 141 12696 0.05% 142 13481 0.06% 143 14704 0.06% 144 20181 0.08% 145 68487 0.28% 146 15700 0.06% 147 16278 0.07% 148 17238 0.07% 149 17575 0.07% 150 23760844 98.25% 24183115 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=31 prefix-density=0.50 prefix-fanout=2.0 sequence=CTCAAGTCTACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=53.03 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.6 sequence=AAAAAAAATCTAAACTGCACCCGCTCATCCAGCAATGGCAGCA criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=31 prefix-density=0.51 prefix-fanout=2.1 sequence=ACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=80.36 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.2 sequence=CAAAACCACATATAGAGGGTGTACTAGCTAATTAGCCTGTAAGAGATG SRR10828695 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:27:52 Started mapping on | Feb 13 20:27:52 Finished on | Feb 13 20:31:54 Mapping speed, Million of reads per hour | 359.75 Number of input reads | 24183115 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22341275 Uniquely mapped reads % | 92.38% Average mapped length | 295.89 Number of splices: Total | 22725125 Number of splices: Annotated (sjdb) | 22141339 Number of splices: GT/AG | 22202108 Number of splices: GC/AG | 390309 Number of splices: AT/AC | 14129 Number of splices: Non-canonical | 118579 Mismatch rate per base, % | 1.19% Deletion rate per base | 0.09% Deletion average length | 3.47 Insertion rate per base | 0.07% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 983541 % of reads mapped to multiple loci | 4.07% Number of reads mapped to too many loci | 72038 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 858299 858299 858299 N_multimapping 983541 983541 983541 N_noFeature 698676 11328818 11468425 N_ambiguous 407800 83446 82631 UnstrandedReadsAssigned:21234799 PositiveStrandReadsAssigned:10929011 NegativeStrandReadsAssigned:10790219 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR10828695 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR10828695-trimmed-pair1.fastq SRR10828695-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,183,115 reads, 20,469,920 reads pseudoaligned [quant] estimated average fragment length: 248.995 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR10828695.ke.tsv 34699 SRR10828695.se.tsv 87100 total ==> SRR10828695.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.01 977 20.7386 Potri.005G024800.1.v4.1 1035 787.005 258 12.3169 Potri.004G059700.1.v4.1 961 713.015 4 0.210776 Potri.007G009000.2.v4.1 1416 1168.01 0 0 Potri.003G141000.2.v4.1 2943 2695.01 589 8.21137 Potri.016G087400.1.v4.1 270 51.0856 984 723.696 Potri.015G069301.1.v4.1 564 316.323 0 0 Potri.010G195200.1.v4.1 1773 1525.01 27 0.665201 Potri.012G127500.1.v4.1 977 729.015 39 2.00996 ==> SRR10828695.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 363 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR10828695 completed mapping pipeline successfully