Starting /dee2/code/volunteer_pipeline.sh SRR10828697 current disk space = 2810367041536 free memory = 1581354216 SRR10828697 SRAfilesize 1322c26cb174ef1be238737c0daa73e2 SRR10828697.sra SRR10828697.sra file validated SRR10828697 is paired end SRR10828697 is conventional basespace SRR10828697 read1 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828697_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.45625 37.0 37.0 37.0 37.0 37.0 2 36.47325 37.0 37.0 37.0 37.0 37.0 3 36.4655 37.0 37.0 37.0 37.0 37.0 4 36.4595 37.0 37.0 37.0 37.0 37.0 5 36.5195 37.0 37.0 37.0 37.0 37.0 6 36.463 37.0 37.0 37.0 37.0 37.0 7 36.3345 37.0 37.0 37.0 37.0 37.0 8 36.627 37.0 37.0 37.0 37.0 37.0 9 36.4975 37.0 37.0 37.0 37.0 37.0 10-14 36.47109999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4959 37.0 37.0 37.0 37.0 37.0 20-24 36.4324 37.0 37.0 37.0 37.0 37.0 25-29 36.3938 37.0 37.0 37.0 37.0 37.0 30-34 36.3783 37.0 37.0 37.0 37.0 37.0 35-39 36.344100000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.3045 37.0 37.0 37.0 37.0 37.0 45-49 36.2752 37.0 37.0 37.0 37.0 37.0 50-54 36.280499999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.2709 37.0 37.0 37.0 37.0 37.0 60-64 36.206599999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.1978 37.0 37.0 37.0 37.0 37.0 70-74 36.210899999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.161899999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.1498 37.0 37.0 37.0 37.0 37.0 85-89 36.1284 37.0 37.0 37.0 37.0 37.0 90-94 36.029900000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.013799999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.08284402049108 37.0 37.0 37.0 37.0 37.0 105-109 35.960922370661685 37.0 37.0 37.0 37.0 37.0 110-114 35.92864601666374 37.0 37.0 37.0 37.0 37.0 115-119 35.922479768978526 37.0 37.0 37.0 37.0 37.0 120-124 35.77045183109017 37.0 37.0 37.0 37.0 37.0 125-129 35.88112461672319 37.0 37.0 37.0 37.0 37.0 130-134 35.76376978305866 37.0 37.0 37.0 37.0 37.0 135-139 35.66144642743969 37.0 37.0 37.0 37.0 37.0 140-144 35.60369263558724 37.0 37.0 37.0 37.0 37.0 145-149 35.624101407497434 37.0 37.0 37.0 37.0 37.0 150 35.7675483214649 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 2.0 25 4.0 26 7.0 27 8.0 28 21.0 29 32.0 30 26.0 31 38.0 32 65.0 33 83.0 34 106.0 35 343.0 36 2998.0 37 264.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.94445834375782 19.139354515886914 19.06429822366775 35.851888916687514 2 22.9672254190643 28.77157868401301 34.701025769326996 13.560170127595697 3 22.0 31.95 26.55 19.5 4 23.125 35.3 20.25 21.325 5 21.175 38.6 21.525 18.7 6 17.325 37.4 24.4 20.875 7 16.475 17.5 44.15 21.875 8 19.5 23.200000000000003 28.075 29.225 9 20.275000000000002 23.875 29.775000000000002 26.075 10-14 20.895 28.599999999999998 27.060000000000002 23.445 15-19 21.69 28.199999999999996 27.27 22.84 20-24 21.545 28.57 27.694999999999997 22.189999999999998 25-29 21.945 28.705000000000002 27.455000000000002 21.895 30-34 20.965 28.895 27.63 22.509999999999998 35-39 21.475 28.32 27.63 22.575 40-44 21.935 28.58 27.284999999999997 22.2 45-49 21.82 28.705000000000002 27.400000000000002 22.075 50-54 21.740000000000002 28.125 27.839999999999996 22.295 55-59 21.345 28.725 27.944999999999997 21.985 60-64 21.855 28.13 27.205000000000002 22.81 65-69 21.740000000000002 28.58 27.21 22.470000000000002 70-74 21.965 28.005000000000003 27.93 22.1 75-79 21.875 28.325 27.42 22.38 80-84 21.13 28.244999999999997 27.33 23.294999999999998 85-89 22.509999999999998 28.410000000000004 27.450000000000003 21.63 90-94 21.584999999999997 27.76 28.425 22.23 95-99 22.155 28.225 27.395000000000003 22.225 100-104 21.119287180257295 28.532812734644843 28.077288882214546 22.270611202883316 105-109 21.976755836088568 28.609357779781586 26.996292956617573 22.417593427512273 110-114 21.667668871517336 28.93365403888555 27.194828622970533 22.203848466626578 115-119 22.344744624329607 27.898350959851637 27.362036990627036 22.39486742519172 120-124 21.988662017759495 28.490442983996388 27.26634224652586 22.254552751718258 125-129 22.266860844674333 28.40857731130417 27.605082107166172 21.71947973685532 130-134 22.16632288574735 28.314131911254215 27.5745836896916 21.944961513306836 135-139 22.515120967741936 28.775201612903228 26.638104838709676 22.07157258064516 140-144 22.36210121846403 27.969058091915667 27.969058091915667 21.699782597704637 145-149 22.361732411549408 28.197437982919887 27.587433916226107 21.853395689304595 150 21.337741607324517 28.35707019328586 28.73855544252289 21.566632756866735 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 2.5 24 3.5 25 4.0 26 7.5 27 8.5 28 8.0 29 13.5 30 26.0 31 33.0 32 31.5 33 40.0 34 58.5 35 80.0 36 97.0 37 108.5 38 134.0 39 167.5 40 205.5 41 226.5 42 237.5 43 266.5 44 254.0 45 249.0 46 264.0 47 238.5 48 210.0 49 183.0 50 165.5 51 138.5 52 103.0 53 85.5 54 78.0 55 58.0 56 44.0 57 39.0 58 26.0 59 23.0 60 24.0 61 16.5 62 9.0 63 7.0 64 3.5 65 3.0 66 1.5 67 1.5 68 1.5 69 0.5 70 1.0 71 1.5 72 1.0 73 1.0 74 1.0 75 1.0 76 2.0 77 1.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 4.0 100-101 1.0 102-103 0.0 104-105 2.0 106-107 1.0 108-109 0.0 110-111 1.0 112-113 0.0 114-115 0.0 116-117 1.0 118-119 2.0 120-121 1.0 122-123 3.0 124-125 0.0 126-127 2.0 128-129 2.0 130-131 5.0 132-133 3.0 134-135 3.0 136-137 2.0 138-139 3.0 140-141 10.0 142-143 3.0 144-145 19.0 146-147 0.0 148-149 0.0 150-151 3932.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.77292965271594 71.39999999999999 2 12.347877708518848 20.8 3 2.315227070347284 5.8500000000000005 4 0.5046007717423567 1.7000000000000002 5 0.05936479667557139 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCAAGAAGCATGGCAACGAAAATCAACCATCAGATTTCACCAAATTCAG 5 0.125 No Hit TAGACATCATCCTCACTTCATCACCACAGCCACTACATCCATGGCCATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR10828697 read2 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10828697_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.221 37.0 37.0 37.0 37.0 37.0 2 36.11775 37.0 37.0 37.0 37.0 37.0 3 36.1915 37.0 37.0 37.0 37.0 37.0 4 36.211 37.0 37.0 37.0 37.0 37.0 5 36.3535 37.0 37.0 37.0 37.0 37.0 6 36.2945 37.0 37.0 37.0 37.0 37.0 7 36.31 37.0 37.0 37.0 37.0 37.0 8 36.46025 37.0 37.0 37.0 37.0 37.0 9 36.42775 37.0 37.0 37.0 37.0 37.0 10-14 36.40025000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.306799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.35360000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.39450000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.309400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.2562 37.0 37.0 37.0 37.0 37.0 40-44 36.2851 37.0 37.0 37.0 37.0 37.0 45-49 36.2362 37.0 37.0 37.0 37.0 37.0 50-54 36.208099999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.1374 37.0 37.0 37.0 37.0 37.0 60-64 36.1102 37.0 37.0 37.0 37.0 37.0 65-69 36.0674 37.0 37.0 37.0 37.0 37.0 70-74 36.0446 37.0 37.0 37.0 37.0 37.0 75-79 36.02040000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.916 37.0 37.0 37.0 37.0 37.0 85-89 36.038 37.0 37.0 37.0 37.0 37.0 90-94 35.851600000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.8848 37.0 37.0 37.0 37.0 37.0 100-104 35.907444114953506 37.0 37.0 37.0 37.0 37.0 105-109 35.83141699125775 37.0 37.0 37.0 37.0 37.0 110-114 35.74353671010274 37.0 37.0 37.0 37.0 37.0 115-119 35.629246555750306 37.0 37.0 37.0 37.0 37.0 120-124 35.75221655626281 37.0 37.0 37.0 37.0 37.0 125-129 35.66611988184066 37.0 37.0 37.0 37.0 37.0 130-134 35.63746570690335 37.0 37.0 37.0 37.0 37.0 135-139 35.6523171043048 37.0 37.0 37.0 37.0 37.0 140-144 35.50469919086326 37.0 37.0 37.0 34.6 37.0 145-149 35.55206564331981 37.0 37.0 37.0 37.0 37.0 150 35.50050864699898 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 2.0 23 3.0 24 4.0 25 7.0 26 13.0 27 10.0 28 16.0 29 18.0 30 21.0 31 37.0 32 48.0 33 70.0 34 161.0 35 591.0 36 2777.0 37 220.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.2 18.75 19.2 36.85 2 21.655413853463365 29.557389347336834 34.808702175543885 13.978494623655912 3 21.3 33.275 26.174999999999997 19.25 4 21.025 37.525 20.4 21.05 5 21.675 38.725 22.225 17.375 6 15.975 40.025 23.674999999999997 20.325 7 16.975 16.900000000000002 42.825 23.3 8 18.00450112528132 23.055763940985248 28.93223305826457 30.00750187546887 9 20.505126281570394 22.605651412853213 30.207551887971995 26.6816704176044 10-14 20.996049802490123 28.671433571678584 27.176358817940898 23.156157807890395 15-19 21.584999999999997 27.775 28.03 22.61 20-24 21.16 28.34 28.310000000000002 22.189999999999998 25-29 21.82 29.49 26.97 21.72 30-34 20.91 29.255 27.52 22.314999999999998 35-39 21.56215621562156 28.697869786978696 27.767776777677767 21.972197219721973 40-44 21.25 28.785 27.345000000000002 22.62 45-49 21.529999999999998 28.07 28.075 22.325 50-54 21.59 28.875 27.51 22.025 55-59 21.69 28.494999999999997 26.86 22.955000000000002 60-64 21.395 28.294999999999998 27.589999999999996 22.720000000000002 65-69 21.335 29.095 27.375 22.195 70-74 22.03 28.28 28.1 21.59 75-79 21.32 28.77 27.33 22.58 80-84 21.785 27.96 28.22 22.035 85-89 21.47 27.939999999999998 27.68 22.91 90-94 21.38 27.71 27.810000000000002 23.1 95-99 21.325 28.625 27.655 22.395 100-104 21.795064323972568 27.726885918806627 27.486609601041195 22.991440156179607 105-109 22.30850157807725 28.42041981864636 27.538700465908523 21.732378137367867 110-114 22.464421727801163 27.675886951292846 27.93144918821407 21.92824213269192 115-119 21.968823617863766 28.063756202696606 27.70788431657561 22.259535862864016 120-124 22.189334269803844 27.8633421963578 27.752972457733406 22.19435107610495 125-129 22.04589966353638 28.02691708933862 27.9365238788731 21.990659368251897 130-134 22.66941691402123 27.695326256477337 27.735573778739248 21.899683050762185 135-139 22.47983870967742 27.787298387096776 27.923387096774192 21.809475806451616 140-144 22.321654279791698 28.262298397290053 27.817382071894432 21.598665251023814 145-149 21.904229361529076 28.35502236681578 27.31293208621391 22.427816185441234 150 22.227873855544253 26.678535096642932 29.52695829094608 21.566632756866735 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.5 23 1.5 24 1.5 25 4.5 26 8.0 27 8.5 28 11.5 29 14.5 30 17.0 31 29.0 32 40.0 33 48.5 34 64.5 35 77.0 36 94.5 37 120.5 38 144.0 39 187.0 40 212.0 41 220.5 42 246.5 43 265.5 44 259.0 45 248.5 46 241.0 47 236.5 48 222.5 49 183.0 50 151.0 51 124.5 52 93.0 53 81.0 54 73.0 55 62.5 56 52.5 57 39.0 58 28.0 59 20.5 60 22.5 61 13.5 62 4.0 63 4.5 64 3.5 65 1.5 66 2.5 67 2.0 68 2.0 69 1.0 70 0.5 71 1.0 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.025 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0050095180843602845 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 4.0 100-101 1.0 102-103 0.0 104-105 2.0 106-107 1.0 108-109 0.0 110-111 1.0 112-113 0.0 114-115 0.0 116-117 1.0 118-119 2.0 120-121 1.0 122-123 3.0 124-125 0.0 126-127 2.0 128-129 2.0 130-131 5.0 132-133 3.0 134-135 3.0 136-137 2.0 138-139 3.0 140-141 10.0 142-143 3.0 144-145 19.0 146-147 0.0 148-149 0.0 150-151 3932.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.075 #Duplication Level Percentage of deduplicated Percentage of total 1 84.68629200118941 71.2 2 12.429378531073446 20.9 3 2.230151650312221 5.625 4 0.5649717514124294 1.9 5 0.08920606601248886 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit TATCAATCATCAGAGAACAAAAGGAACCCGTGAAAGCAAAGACGACAGAA 5 0.125 No Hit TGGACTTGTACTTGTCAATGCGTTTCTTGAAGAAGGTATCGGGACCCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAGGT 10 0.007066775 143.3625 3 AAAAGAC 10 0.007066775 143.3625 1 >>END_MODULE Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294598 spots for SRR10828697.sra Written 1294598 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra Read 1294583 spots for SRR10828697.sra Written 1294583 spots for SRR10828697.sra SRR ids: ['SRR10828697.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ny2ux22m SRR10828697.sra spots: 25891675 blocks: [[1, 1294583], [1294584, 2589166], [2589167, 3883749], [3883750, 5178332], [5178333, 6472915], [6472916, 7767498], [7767499, 9062081], [9062082, 10356664], [10356665, 11651247], [11651248, 12945830], [12945831, 14240413], [14240414, 15534996], [15534997, 16829579], [16829580, 18124162], [18124163, 19418745], [19418746, 20713328], [20713329, 22007911], [22007912, 23302494], [23302495, 24597077], [24597078, 25891675]] SRR10828697 file size 8713861 SRR10828697 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10828697 SRR10828697_1.fastq SRR10828697_2.fastq Input file: SRR10828697_1.fastq Paired file: SRR10828697_2.fastq trimmed: SRR10828697-trimmed-pair1.fastq, SRR10828697-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Apr 11 12:17:06 2025 >> started Fri Apr 11 12:17:34 2025 >> done (27.367s) 25891675 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 19 ( 0.00%) empty read pairs filtered out after trimming by size control 25891656 (100.00%) read pairs available; of these: 68138 ( 0.26%) trimmed read pairs available after processing 25823518 (99.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 3 0.00% 21 1 0.00% 22 1 0.00% 23 4 0.00% 24 4 0.00% 25 3 0.00% 26 3 0.00% 27 3 0.00% 28 5 0.00% 29 8 0.00% 30 6 0.00% 31 3 0.00% 32 13 0.00% 33 4 0.00% 34 9 0.00% 35 10 0.00% 36 3 0.00% 37 14 0.00% 38 9 0.00% 39 12 0.00% 40 14 0.00% 41 13 0.00% 42 15 0.00% 43 11 0.00% 44 18 0.00% 45 11 0.00% 46 13 0.00% 47 15 0.00% 48 16 0.00% 49 14 0.00% 50 20 0.00% 51 12 0.00% 52 15 0.00% 53 21 0.00% 54 17 0.00% 55 17 0.00% 56 22 0.00% 57 21 0.00% 58 16 0.00% 59 17 0.00% 60 18 0.00% 61 13 0.00% 62 18 0.00% 63 20 0.00% 64 17 0.00% 65 19 0.00% 66 22 0.00% 67 24 0.00% 68 12 0.00% 69 21 0.00% 70 22 0.00% 71 17 0.00% 72 18 0.00% 73 10 0.00% 74 20 0.00% 75 18 0.00% 76 21 0.00% 77 8 0.00% 78 15 0.00% 79 20 0.00% 80 20 0.00% 81 17 0.00% 82 15 0.00% 83 14 0.00% 84 11 0.00% 85 14 0.00% 86 12 0.00% 87 20 0.00% 88 16 0.00% 89 7 0.00% 90 18 0.00% 91 13 0.00% 92 24 0.00% 93 15 0.00% 94 17 0.00% 95 23 0.00% 96 18 0.00% 97 31 0.00% 98 27 0.00% 99 1639 0.01% 100 1788 0.01% 101 1928 0.01% 102 2020 0.01% 103 2158 0.01% 104 2380 0.01% 105 2433 0.01% 106 2634 0.01% 107 2842 0.01% 108 2959 0.01% 109 3130 0.01% 110 3260 0.01% 111 3394 0.01% 112 3701 0.01% 113 3888 0.02% 114 4154 0.02% 115 4300 0.02% 116 4456 0.02% 117 4752 0.02% 118 4908 0.02% 119 5048 0.02% 120 5378 0.02% 121 5708 0.02% 122 5877 0.02% 123 6264 0.02% 124 6486 0.03% 125 6777 0.03% 126 7173 0.03% 127 7406 0.03% 128 7771 0.03% 129 7993 0.03% 130 8648 0.03% 131 8811 0.03% 132 9241 0.04% 133 9733 0.04% 134 9976 0.04% 135 10490 0.04% 136 10924 0.04% 137 88 0.00% 138 11472 0.04% 139 11771 0.05% 140 12385 0.05% 141 12657 0.05% 142 13639 0.05% 143 15240 0.06% 144 21568 0.08% 145 73550 0.28% 146 15280 0.06% 147 16064 0.06% 148 16695 0.06% 149 17459 0.07% 150 25450239 98.30% 25891656 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=28 prefix-density=0.33 prefix-fanout=2.1 sequence=GGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCACTCTCGGCTCCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=98.89 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.5 sequence=AAAAAAAATCTAAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCGGAGACCTTTGC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=29 prefix-density=0.33 prefix-fanout=2.1 sequence=GGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCACTCTCGGCTCCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=103.48 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=12.0 sequence=AAAAAAAATCTAAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCGGAGACCTTTGC SRR10828697 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 11 12:18:45 Started mapping on | Apr 11 12:18:45 Finished on | Apr 11 12:22:32 Mapping speed, Million of reads per hour | 410.62 Number of input reads | 25891656 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 23533885 Uniquely mapped reads % | 90.89% Average mapped length | 287.65 Number of splices: Total | 22965800 Number of splices: Annotated (sjdb) | 22265483 Number of splices: GT/AG | 22434074 Number of splices: GC/AG | 367207 Number of splices: AT/AC | 18231 Number of splices: Non-canonical | 146288 Mismatch rate per base, % | 1.23% Deletion rate per base | 0.10% Deletion average length | 3.42 Insertion rate per base | 0.08% Insertion average length | 2.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1126772 % of reads mapped to multiple loci | 4.35% Number of reads mapped to too many loci | 164156 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.89% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1230999 1230999 1230999 N_multimapping 1126772 1126772 1126772 N_noFeature 891921 12003039 12151644 N_ambiguous 463832 96948 96800 UnstrandedReadsAssigned:22178132 PositiveStrandReadsAssigned:11433898 NegativeStrandReadsAssigned:11285441 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR10828697 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR10828697-trimmed-pair1.fastq SRR10828697-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,891,656 reads, 21,928,819 reads pseudoaligned [quant] estimated average fragment length: 248.948 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR10828697.ke.tsv 34699 SRR10828697.se.tsv 87100 total ==> SRR10828697.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.05 1111 20.952 Potri.005G024800.1.v4.1 1035 787.052 383 16.244 Potri.004G059700.1.v4.1 961 713.052 10 0.468141 Potri.007G009000.2.v4.1 1416 1168.05 0 0 Potri.003G141000.2.v4.1 2943 2695.05 760 9.41336 Potri.016G087400.1.v4.1 270 53.2088 1368 858.224 Potri.015G069301.1.v4.1 564 316.269 0 0 Potri.010G195200.1.v4.1 1773 1525.05 43 0.9412 Potri.012G127500.1.v4.1 977 729.052 30 1.3736 ==> SRR10828697.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 399 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 102 SRR10828697 completed mapping pipeline successfully