Starting /dee2/code/volunteer_pipeline.sh SRR1121292 current disk space = 3049049796608 free memory = 1578868176 SRR1121292 SRAfilesize 89657b3bcf7c8b37026e9751de257254 SRR1121292.sra SRR1121292.sra file validated SRR1121292 is single end SRR1121292 is conventional basespace SRR1121292 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1121292_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1805 34.0 34.0 34.0 31.0 34.0 2 33.42375 34.0 34.0 34.0 33.0 34.0 3 33.63125 34.0 34.0 34.0 33.0 34.0 4 36.788 37.0 37.0 37.0 37.0 37.0 5 36.73975 37.0 37.0 37.0 37.0 37.0 6 36.797 37.0 37.0 37.0 37.0 37.0 7 36.7715 37.0 37.0 37.0 37.0 37.0 8 36.69525 37.0 37.0 37.0 36.0 37.0 9 38.6025 39.0 39.0 39.0 38.0 39.0 10-11 38.703 39.0 39.0 39.0 39.0 39.0 12-13 38.609375 39.0 39.0 39.0 38.0 39.0 14-15 39.652375 40.0 40.0 40.0 39.0 40.0 16-17 39.679249999999996 40.0 40.0 40.0 39.0 40.0 18-19 39.615624999999994 40.0 40.0 40.0 39.0 40.0 20-21 39.609125000000006 40.0 40.0 40.0 39.0 40.0 22-23 39.571375 40.0 40.0 40.0 39.0 40.0 24-25 39.5005 40.0 40.0 40.0 39.0 40.0 26-27 39.447375 40.0 40.0 40.0 38.0 40.0 28-29 39.408125 40.0 40.0 40.0 38.5 40.0 30-31 39.306875 40.0 40.0 40.0 38.0 40.0 32-33 39.218 40.0 40.0 40.0 38.0 40.0 34-35 39.076 40.0 40.0 40.0 37.5 40.0 36-37 39.077875 40.0 40.0 40.0 38.0 40.0 38-39 38.989374999999995 40.0 40.0 40.0 38.0 40.0 40-41 39.070375 40.0 40.0 40.0 38.0 40.0 42-43 39.03037500000001 40.0 40.0 40.0 37.5 40.0 44-45 38.958875 40.0 40.0 40.0 37.0 40.0 46-47 38.946124999999995 40.0 39.5 40.0 37.0 40.0 48-49 39.074 40.0 40.0 40.0 37.0 40.0 50-51 38.957 40.0 40.0 40.0 37.0 40.0 52-53 38.945 40.0 40.0 40.0 37.0 40.0 54-55 38.873625000000004 40.0 40.0 40.0 36.5 40.0 56-57 38.755625 40.0 39.0 40.0 36.0 40.0 58-59 38.487375 40.0 39.0 40.0 35.0 40.0 60-61 38.262625 40.0 38.0 40.0 35.0 40.0 62-63 37.969125 40.0 37.0 40.0 35.0 40.0 64-65 37.792 39.5 37.0 40.0 35.0 40.0 66-67 37.475375 39.0 36.0 40.0 35.0 40.0 68-69 37.137375000000006 39.0 35.5 40.0 34.0 40.0 70-71 36.693875 37.0 35.0 39.5 34.0 40.0 72-73 36.251875 37.0 35.0 39.0 33.5 40.0 74-75 35.847624999999994 36.5 35.0 39.0 33.0 40.0 76-77 35.068 35.0 34.0 37.0 32.5 39.0 78-79 35.143249999999995 35.5 35.0 37.0 33.0 39.0 80-81 34.748125 35.0 35.0 37.0 33.0 38.0 82-83 34.504999999999995 35.0 35.0 36.0 33.0 37.0 84-85 34.247875 35.0 35.0 36.0 32.0 37.0 86-87 33.958124999999995 35.0 35.0 35.5 32.0 36.5 88-89 33.817750000000004 35.0 34.0 35.0 31.5 36.0 90-91 33.533875 35.0 34.0 35.0 31.5 36.0 92-93 32.939750000000004 35.0 34.0 35.0 30.0 36.0 94-95 32.078625 35.0 33.0 35.0 27.0 35.0 96-97 31.75675 35.0 32.5 35.0 26.0 35.0 98-99 30.634 34.0 31.5 35.0 14.5 35.0 100 29.94125 34.0 31.0 35.0 4.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 2.0 11 1.0 12 0.0 13 3.0 14 5.0 15 2.0 16 1.0 17 1.0 18 4.0 19 2.0 20 5.0 21 6.0 22 5.0 23 2.0 24 7.0 25 1.0 26 7.0 27 12.0 28 10.0 29 14.0 30 20.0 31 27.0 32 44.0 33 47.0 34 94.0 35 171.0 36 472.0 37 1525.0 38 1494.0 39 15.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.840707964601773 15.094816687737042 16.738305941845766 42.32616940581542 2 18.11358518889167 23.742807105328996 37.45308981736302 20.690517888416313 3 22.125 27.1 26.775 24.0 4 24.75 32.425 20.25 22.575 5 23.200000000000003 35.675000000000004 23.025000000000002 18.099999999999998 6 17.9 37.35 25.124999999999996 19.625 7 16.5 16.25 44.025 23.225 8 19.75 21.65 30.099999999999998 28.499999999999996 9 19.975 23.075000000000003 29.975 26.974999999999998 10-11 23.2125 32.2875 22.2625 22.237499999999997 12-13 20.6375 25.387500000000003 30.599999999999998 23.375 14-15 21.2625 27.525 28.9125 22.3 16-17 22.136068034017008 27.538769384692348 26.8384192096048 23.486743371685844 18-19 21.8625 27.3625 27.737499999999997 23.0375 20-21 21.575 28.1375 27.6 22.6875 22-23 21.9 28.025 27.6625 22.412499999999998 24-25 21.85 27.474999999999998 28.199999999999996 22.475 26-27 21.6 28.237499999999997 27.287499999999998 22.875 28-29 21.875 27.8375 27.8125 22.475 30-31 22.0625 27.6625 28.262500000000003 22.0125 32-33 20.9375 28.762500000000003 27.525 22.775000000000002 34-35 22.175 28.725 26.9125 22.1875 36-37 21.9942449643438 27.67421493807081 28.012010509195544 22.31952958838984 38-39 22.240280035004375 28.26603325415677 27.353419177397175 22.14026753344168 40-41 21.75 28.6875 27.775 21.7875 42-43 22.6375 27.787499999999998 27.224999999999998 22.35 44-45 22.6875 28.4375 26.937499999999996 21.9375 46-47 22.3625 28.5625 26.525 22.55 48-49 22.525000000000002 26.9625 27.212500000000002 23.3 50-51 22.425 27.700000000000003 27.400000000000002 22.475 52-53 21.375 28.549999999999997 28.199999999999996 21.875 54-55 22.407106217940697 27.461528837733017 27.17377705492306 22.95758788940323 56-57 23.14814814814815 27.039539539539543 27.852852852852855 21.95945945945946 58-59 21.467866966741685 28.81970492623156 28.28207051762941 21.43035758939735 60-61 21.9375 27.737499999999997 27.85 22.475 62-63 22.425 27.6125 27.737499999999997 22.225 64-65 23.1625 27.5875 27.4125 21.837500000000002 66-67 22.35 28.349999999999998 27.0875 22.2125 68-69 22.85 28.7 27.450000000000003 21.0 70-71 22.52094535450794 27.49781167937977 27.785419532324624 22.19582343378767 72-73 22.145804676753784 26.73502563461298 28.248093034888083 22.871076653745153 74-75 23.380845211302827 26.669167291822955 27.84446111527882 22.1055263815954 76-77 22.473736868434216 27.463731865932967 27.388694347173587 22.67383691845923 78-79 22.433412529698636 27.285231961985744 27.522821057896714 22.758534450418907 80-81 22.5625 27.6 27.474999999999998 22.3625 82-83 22.25 27.500000000000004 27.5125 22.7375 84-85 22.025 27.8875 27.462500000000002 22.625 86-87 21.725 28.125 27.712500000000002 22.4375 88-89 23.252906613326665 27.665958244780597 28.141017627203404 20.940117514689334 90-91 22.8978978978979 27.77777777777778 26.926926926926924 22.3973973973974 92-93 22.786393196598297 27.363681840920464 28.70185092546273 21.14807403701851 94-95 23.377110694183862 27.329580988117574 27.879924953095685 21.41338336460288 96-97 22.59597349005877 27.522821057896714 27.435288233087405 22.44591721895711 98-99 21.637500000000003 27.987499999999997 29.012500000000003 21.3625 100 22.125 27.425 27.474999999999998 22.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.5 24 2.5 25 2.0 26 3.5 27 5.0 28 7.0 29 9.5 30 12.0 31 16.5 32 21.5 33 34.5 34 48.0 35 57.5 36 82.5 37 106.5 38 124.5 39 150.0 40 184.0 41 218.5 42 238.5 43 273.0 44 269.0 45 255.0 46 280.5 47 263.5 48 234.5 49 200.5 50 164.5 51 142.0 52 125.5 53 106.0 54 83.0 55 63.0 56 43.5 57 38.0 58 31.0 59 23.0 60 18.5 61 12.5 62 6.5 63 5.0 64 6.0 65 5.0 66 4.0 67 3.5 68 2.0 69 2.0 70 2.5 71 1.5 72 0.5 73 0.0 74 0.0 75 1.0 76 1.0 77 1.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.05 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.08750000000000001 38-39 0.0125 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.08750000000000001 56-57 0.1 58-59 0.025 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0375 72-73 0.0375 74-75 0.025 76-77 0.05 78-79 0.0375 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.1 92-93 0.05 94-95 0.0625 96-97 0.0375 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0125 0.0 48-49 0.025 0.0 0.0 0.025 0.0 50-51 0.025 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.05 0.0 0.0 0.025 0.0 62-63 0.05 0.0 0.0 0.025 0.0 64-65 0.05 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.075 0.0 0.0 0.025 0.0 72-73 0.075 0.0 0.0 0.025 0.0 74-75 0.075 0.0 0.0 0.025 0.0 76-77 0.075 0.0 0.0 0.025 0.0 78-79 0.075 0.0 0.0 0.025 0.0 80-81 0.075 0.0 0.0 0.025 0.0 82-83 0.125 0.0 0.0 0.025 0.0 84-85 0.125 0.0 0.0 0.025 0.0 86-87 0.2 0.0 0.0 0.025 0.0 88 0.225 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063638 spots for SRR1121292.sra Written 1063638 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra Read 1063632 spots for SRR1121292.sra Written 1063632 spots for SRR1121292.sra SRR ids: ['SRR1121292.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cj9t3sd4 SRR1121292.sra spots: 21272646 blocks: [[1, 1063632], [1063633, 2127264], [2127265, 3190896], [3190897, 4254528], [4254529, 5318160], [5318161, 6381792], [6381793, 7445424], [7445425, 8509056], [8509057, 9572688], [9572689, 10636320], [10636321, 11699952], [11699953, 12763584], [12763585, 13827216], [13827217, 14890848], [14890849, 15954480], [15954481, 17018112], [17018113, 18081744], [18081745, 19145376], [19145377, 20209008], [20209009, 21272646]] SRR1121292 file size 5525280 SRR1121292 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1121292 SRR1121292_1.fastq Input file: SRR1121292_1.fastq trimmed: SRR1121292-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 05:08:27 2025 >> started Wed Feb 12 05:08:38 2025 >> done (11.149s) 21272646 reads processed; of these: 2811 ( 0.01%) short reads filtered out after trimming by size control 9284 ( 0.04%) empty reads filtered out after trimming by size control 21260551 (99.94%) reads available; of these: 5854909 (27.54%) trimmed reads available after processing 15405642 (72.46%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 390 0.00% 19 402 0.00% 20 515 0.00% 21 660 0.00% 22 770 0.00% 23 1198 0.01% 24 1538 0.01% 25 1952 0.01% 26 2038 0.01% 27 2201 0.01% 28 2194 0.01% 29 2254 0.01% 30 2203 0.01% 31 2163 0.01% 32 2357 0.01% 33 2380 0.01% 34 2556 0.01% 35 2587 0.01% 36 2762 0.01% 37 2775 0.01% 38 2762 0.01% 39 2850 0.01% 40 2825 0.01% 41 2886 0.01% 42 2942 0.01% 43 2971 0.01% 44 3097 0.01% 45 2985 0.01% 46 3129 0.01% 47 3043 0.01% 48 3107 0.01% 49 3266 0.02% 50 3443 0.02% 51 3657 0.02% 52 3716 0.02% 53 3917 0.02% 54 3937 0.02% 55 4011 0.02% 56 4125 0.02% 57 4584 0.02% 58 4835 0.02% 59 4635 0.02% 60 4870 0.02% 61 4846 0.02% 62 5152 0.02% 63 5049 0.02% 64 5260 0.02% 65 5499 0.03% 66 5654 0.03% 67 6167 0.03% 68 6174 0.03% 69 6190 0.03% 70 6564 0.03% 71 6730 0.03% 72 7290 0.03% 73 7499 0.04% 74 7427 0.03% 75 7390 0.03% 76 6022 0.03% 77 6897 0.03% 78 8052 0.04% 79 8777 0.04% 80 9355 0.04% 81 10334 0.05% 82 11461 0.05% 83 13422 0.06% 84 14378 0.07% 85 16831 0.08% 86 20493 0.10% 87 27349 0.13% 88 41640 0.20% 89 162408 0.76% 90 967564 4.55% 91 205082 0.96% 92 1016473 4.78% 93 190720 0.90% 94 1016183 4.78% 95 254257 1.20% 96 890561 4.19% 97 155988 0.73% 98 376857 1.77% 99 213426 1.00% 100 15405642 72.46% 21260551 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=16.70 fanout-score-rank=11 prefix-density=0.13 prefix-fanout=16.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=281.07 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=28.3 sequence=TTCTTCTTCTTT Started job on | Feb 12 05:08:53 Started mapping on | Feb 12 05:08:53 Finished on | Feb 12 05:09:13 Mapping speed, Million of reads per hour | 3826.90 Number of input reads | 21260551 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 20300757 Uniquely mapped reads % | 95.49% Average mapped length | 97.41 Number of splices: Total | 6146526 Number of splices: Annotated (sjdb) | 6058331 Number of splices: GT/AG | 6055890 Number of splices: GC/AG | 75433 Number of splices: AT/AC | 6051 Number of splices: Non-canonical | 9152 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 482306 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 362234 % of reads mapped to too many loci | 1.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.53% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 477488 477488 477488 N_multimapping 482306 482306 482306 N_noFeature 550971 10365669 10373523 N_ambiguous 174859 31000 31530 UnstrandedReadsAssigned:19574927 PositiveStrandReadsAssigned:9904088 NegativeStrandReadsAssigned:9895704 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1121292 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR1121292-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,260,551 reads, 20,299,963 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR1121292.ke.tsv 34699 SRR1121292.se.tsv 87100 total ==> SRR1121292.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 494 16.8905 Potri.005G024800.1.v4.1 1035 936 82 5.74815 Potri.004G059700.1.v4.1 961 862 20 1.52235 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 466.164 10.7547 Potri.016G087400.1.v4.1 270 171 1337 513.01 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 83 3.25322 Potri.012G127500.1.v4.1 977 878 6609 493.892 ==> SRR1121292.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2203 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 384 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR1121292 completed mapping pipeline successfully