Starting /dee2/code/volunteer_pipeline.sh SRR1121293 current disk space = 3048988557312 free memory = 1298034324 SRR1121293 SRAfilesize c8ea943d1c8b9fda939de05bc7c4c4a3 SRR1121293.sra SRR1121293.sra file validated SRR1121293 is single end SRR1121293 is conventional basespace SRR1121293 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1121293_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0645 34.0 34.0 34.0 31.0 34.0 2 33.33175 34.0 34.0 34.0 31.0 34.0 3 33.5735 34.0 34.0 34.0 33.0 34.0 4 36.79925 37.0 37.0 37.0 37.0 37.0 5 36.75125 37.0 37.0 37.0 37.0 37.0 6 36.72525 37.0 37.0 37.0 37.0 37.0 7 36.69825 37.0 37.0 37.0 35.0 37.0 8 36.74825 37.0 37.0 37.0 37.0 37.0 9 38.74325 39.0 39.0 39.0 39.0 39.0 10-11 38.740625 39.0 39.0 39.0 39.0 39.0 12-13 38.700374999999994 39.0 39.0 39.0 38.5 39.0 14-15 39.626999999999995 40.0 40.0 40.0 39.0 40.0 16-17 39.62375 40.0 40.0 40.0 39.0 40.0 18-19 39.6105 40.0 40.0 40.0 39.0 40.0 20-21 39.587 40.0 40.0 40.0 39.0 40.0 22-23 39.569374999999994 40.0 40.0 40.0 39.0 40.0 24-25 39.51275 40.0 40.0 40.0 39.0 40.0 26-27 39.4025 40.0 40.0 40.0 38.0 40.0 28-29 39.3485 40.0 40.0 40.0 38.0 40.0 30-31 39.292625 40.0 40.0 40.0 38.0 40.0 32-33 39.207 40.0 40.0 40.0 38.0 40.0 34-35 39.04575 40.0 40.0 40.0 37.5 40.0 36-37 38.91225 40.0 40.0 40.0 37.0 40.0 38-39 38.916624999999996 40.0 40.0 40.0 37.0 40.0 40-41 38.976 40.0 40.0 40.0 37.0 40.0 42-43 38.90325 40.0 40.0 40.0 37.0 40.0 44-45 38.703875 40.0 39.0 40.0 36.0 40.0 46-47 38.725 40.0 39.0 40.0 36.5 40.0 48-49 38.801 40.0 40.0 40.0 37.0 40.0 50-51 38.79475 40.0 39.5 40.0 36.0 40.0 52-53 38.660124999999994 40.0 39.0 40.0 36.0 40.0 54-55 38.4925 40.0 39.0 40.0 35.0 40.0 56-57 38.312875 40.0 39.0 40.0 35.0 40.0 58-59 38.214375000000004 40.0 38.0 40.0 35.0 40.0 60-61 38.0535 40.0 37.5 40.0 35.0 40.0 62-63 37.835750000000004 40.0 37.0 40.0 35.0 40.0 64-65 37.46475 39.0 36.5 40.0 34.0 40.0 66-67 37.170874999999995 39.0 36.0 40.0 34.0 40.0 68-69 36.79375 38.5 35.0 40.0 34.0 40.0 70-71 36.30875 37.0 35.0 39.5 33.0 40.0 72-73 35.715875 37.0 35.0 39.0 32.5 40.0 74-75 35.288375 36.0 35.0 39.0 32.0 40.0 76-77 34.638125 35.0 34.0 37.0 31.5 39.0 78-79 34.7605 35.0 35.0 37.0 32.0 39.0 80-81 34.556124999999994 35.0 35.0 36.5 32.5 38.0 82-83 34.242375 35.0 35.0 36.0 32.0 37.0 84-85 33.8505 35.0 34.0 36.0 31.0 37.0 86-87 33.659375 35.0 34.0 35.5 31.0 36.0 88-89 33.349625 35.0 34.0 35.0 30.5 36.0 90-91 33.078 35.0 34.0 35.0 30.0 36.0 92-93 32.790125 35.0 34.0 35.0 29.5 35.5 94-95 32.450874999999996 35.0 34.0 35.0 29.0 35.0 96-97 32.144875 35.0 33.0 35.0 28.0 35.0 98-99 31.706000000000003 35.0 33.0 35.0 26.0 35.0 100 30.70725 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 3.0 13 6.0 14 3.0 15 1.0 16 3.0 17 2.0 18 5.0 19 3.0 20 3.0 21 5.0 22 6.0 23 4.0 24 7.0 25 13.0 26 8.0 27 13.0 28 25.0 29 19.0 30 28.0 31 31.0 32 38.0 33 42.0 34 106.0 35 183.0 36 489.0 37 1462.0 38 1476.0 39 15.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.269377382465056 14.866581956797967 16.797966963151207 44.066073697585765 2 19.564673505128845 22.792094070552913 37.65323992994746 19.989992494370778 3 22.475 26.3 26.974999999999998 24.25 4 24.325 32.425 19.675 23.575 5 24.175 35.65 20.625 19.55 6 18.125 36.575 23.849999999999998 21.45 7 15.950000000000001 16.625 44.375 23.05 8 19.8 23.075000000000003 27.55 29.575000000000003 9 19.8 23.075000000000003 31.85 25.275 10-11 22.425 33.575 21.987499999999997 22.0125 12-13 20.5125 26.2125 29.2 24.075 14-15 21.675 27.8625 27.9375 22.525000000000002 16-17 22.900000000000002 28.225 26.875 22.0 18-19 21.45 27.800000000000004 27.825 22.925 20-21 21.8875 28.237499999999997 27.224999999999998 22.650000000000002 22-23 22.1875 27.8875 26.5875 23.3375 24-25 21.4375 28.8375 27.150000000000002 22.575 26-27 21.625 27.9375 27.762500000000003 22.675 28-29 22.775000000000002 28.6875 25.887500000000003 22.650000000000002 30-31 23.3875 27.750000000000004 26.674999999999997 22.1875 32-33 21.762500000000003 28.299999999999997 26.974999999999998 22.9625 34-35 21.425 29.049999999999997 27.0875 22.4375 36-37 22.0540405303978 28.5839379534651 26.670002501876404 22.692019014260694 38-39 22.1375 28.050000000000004 26.950000000000003 22.8625 40-41 22.7375 28.025 26.85 22.3875 42-43 22.287499999999998 28.925 26.55 22.237499999999997 44-45 22.85 27.6625 27.325 22.162499999999998 46-47 22.6875 27.474999999999998 26.6125 23.225 48-49 22.1 28.15 27.825 21.925 50-51 22.287499999999998 27.6375 27.237499999999997 22.8375 52-53 22.287499999999998 28.3875 27.1375 22.1875 54-55 22.262590829366076 27.81257830117765 26.998246053620644 22.92658481583563 56-57 21.71571696931747 28.741390106449593 26.512210394489667 23.030682529743267 58-59 21.7375 28.000000000000004 27.037499999999998 23.225 60-61 22.3 27.487499999999997 27.425 22.787499999999998 62-63 22.8625 27.237499999999997 27.275 22.625 64-65 22.8 28.262500000000003 26.5 22.4375 66-67 22.8125 27.925 26.85 22.412499999999998 68-69 22.2125 27.525 27.525 22.7375 70-71 21.88400350745334 26.982337467117624 27.67130151572091 23.462357509708127 72-73 22.633434038267875 27.341389728096676 27.316213494461227 22.70896273917422 74-75 21.756109851347947 26.883345930964982 27.99193751574704 23.368606701940035 76-77 22.348816827344432 27.56980092650557 26.9437836484287 23.137598597721297 78-79 22.6125 26.787499999999998 26.674999999999997 23.925 80-81 22.3875 27.3125 26.887499999999996 23.4125 82-83 23.025000000000002 26.950000000000003 26.875 23.150000000000002 84-85 22.925 27.625 26.2625 23.1875 86-87 22.237499999999997 28.462500000000002 26.887499999999996 22.412499999999998 88-89 23.36296481782897 28.07061474896707 26.28020533366721 22.286215099536747 90-91 22.93497363796134 27.090133065528498 28.08184785337685 21.893045443133317 92-93 23.7375 27.474999999999998 26.887499999999996 21.9 94-95 23.351717222361497 28.014539984958635 26.422662321383804 22.211080471296064 96-97 22.35161532682194 26.93463561232156 28.01152016028049 22.702228900576007 98-99 23.075000000000003 27.3125 27.212500000000002 22.400000000000002 100 24.125 26.424999999999997 26.8 22.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 2.0 26 2.5 27 3.0 28 6.5 29 8.0 30 15.5 31 24.5 32 29.5 33 38.5 34 49.0 35 63.5 36 76.0 37 94.5 38 119.5 39 137.5 40 169.5 41 202.5 42 229.0 43 261.0 44 262.0 45 263.0 46 265.5 47 242.0 48 216.0 49 186.5 50 171.0 51 154.0 52 129.5 53 115.0 54 97.0 55 71.0 56 48.5 57 44.0 58 36.0 59 28.5 60 28.0 61 19.5 62 17.0 63 15.0 64 10.0 65 6.0 66 4.0 67 3.5 68 1.5 69 3.5 70 6.5 71 5.0 72 2.0 73 3.5 74 5.0 75 2.5 76 0.5 77 0.5 78 0.5 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.075 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.22499999999999998 56-57 0.1875 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.21250000000000002 72-73 0.7000000000000001 74-75 0.775 76-77 0.1625 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.1625 90-91 0.42500000000000004 92-93 0.0 94-95 0.27499999999999997 96-97 0.17500000000000002 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19273461150352 98.3 2 0.7315842583249244 1.4500000000000002 3 0.050454086781029264 0.15 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047759 spots for SRR1121293.sra Written 1047759 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra Read 1047744 spots for SRR1121293.sra Written 1047744 spots for SRR1121293.sra SRR ids: ['SRR1121293.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ufl9udky SRR1121293.sra spots: 20954895 blocks: [[1, 1047744], [1047745, 2095488], [2095489, 3143232], [3143233, 4190976], [4190977, 5238720], [5238721, 6286464], [6286465, 7334208], [7334209, 8381952], [8381953, 9429696], [9429697, 10477440], [10477441, 11525184], [11525185, 12572928], [12572929, 13620672], [13620673, 14668416], [14668417, 15716160], [15716161, 16763904], [16763905, 17811648], [17811649, 18859392], [18859393, 19907136], [19907137, 20954895]] SRR1121293 file size 5442376 SRR1121293 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1121293 SRR1121293_1.fastq Input file: SRR1121293_1.fastq trimmed: SRR1121293-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 05:16:53 2025 >> started Wed Feb 12 05:17:04 2025 >> done (10.666s) 20954895 reads processed; of these: 3935 ( 0.02%) short reads filtered out after trimming by size control 26552 ( 0.13%) empty reads filtered out after trimming by size control 20924408 (99.85%) reads available; of these: 3448102 (16.48%) trimmed reads available after processing 17476306 (83.52%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 520 0.00% 19 595 0.00% 20 728 0.00% 21 808 0.00% 22 1200 0.01% 23 1819 0.01% 24 2244 0.01% 25 2951 0.01% 26 3510 0.02% 27 3599 0.02% 28 3154 0.02% 29 3115 0.01% 30 3097 0.01% 31 3006 0.01% 32 3397 0.02% 33 3146 0.02% 34 3283 0.02% 35 3303 0.02% 36 3529 0.02% 37 3571 0.02% 38 3822 0.02% 39 3591 0.02% 40 4038 0.02% 41 3753 0.02% 42 4207 0.02% 43 4195 0.02% 44 3912 0.02% 45 3829 0.02% 46 4017 0.02% 47 3893 0.02% 48 4148 0.02% 49 4212 0.02% 50 4498 0.02% 51 4898 0.02% 52 4909 0.02% 53 5148 0.02% 54 5123 0.02% 55 5232 0.03% 56 5587 0.03% 57 5677 0.03% 58 6150 0.03% 59 6083 0.03% 60 6494 0.03% 61 6333 0.03% 62 6893 0.03% 63 6701 0.03% 64 6677 0.03% 65 7658 0.04% 66 7281 0.03% 67 8009 0.04% 68 7967 0.04% 69 7780 0.04% 70 8213 0.04% 71 8465 0.04% 72 9048 0.04% 73 8953 0.04% 74 9268 0.04% 75 9076 0.04% 76 7360 0.04% 77 8484 0.04% 78 10001 0.05% 79 10652 0.05% 80 11527 0.06% 81 12386 0.06% 82 14225 0.07% 83 15386 0.07% 84 16922 0.08% 85 19381 0.09% 86 22181 0.11% 87 27801 0.13% 88 38923 0.19% 89 82124 0.39% 90 252114 1.20% 91 177239 0.85% 92 530748 2.54% 93 137826 0.66% 94 301938 1.44% 95 157909 0.75% 96 368087 1.76% 97 208793 1.00% 98 500865 2.39% 99 238917 1.14% 100 17476306 83.52% 20924408 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=42.38 fanout-score-rank=2 prefix-density=0.29 prefix-fanout=30.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=80.30 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=13.6 sequence=CCACCACCAACA Started job on | Feb 12 05:17:22 Started mapping on | Feb 12 05:17:22 Finished on | Feb 12 05:17:46 Mapping speed, Million of reads per hour | 3138.66 Number of input reads | 20924408 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 18775867 Uniquely mapped reads % | 89.73% Average mapped length | 98.28 Number of splices: Total | 5793407 Number of splices: Annotated (sjdb) | 5709818 Number of splices: GT/AG | 5709244 Number of splices: GC/AG | 70116 Number of splices: AT/AC | 5584 Number of splices: Non-canonical | 8463 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 1.91 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454807 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 1595158 % of reads mapped to too many loci | 7.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.46% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1693734 1693734 1693734 N_multimapping 454807 454807 454807 N_noFeature 525610 9594527 9605253 N_ambiguous 157002 27590 27890 UnstrandedReadsAssigned:18093255 PositiveStrandReadsAssigned:9153750 NegativeStrandReadsAssigned:9142724 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1121293 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR1121293-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,924,408 reads, 19,847,994 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR1121293.ke.tsv 34699 SRR1121293.se.tsv 87100 total ==> SRR1121293.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 465 15.1542 Potri.005G024800.1.v4.1 1035 936 98.0054 6.54829 Potri.004G059700.1.v4.1 961 862 15 1.08827 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 333.256 7.32827 Potri.016G087400.1.v4.1 270 171 1469 537.254 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 64 2.39099 Potri.012G127500.1.v4.1 977 878 8060 574.109 ==> SRR1121293.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1985 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 481 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 30 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR1121293 completed mapping pipeline successfully