Starting /dee2/code/volunteer_pipeline.sh SRR1121294 current disk space = 3051776688128 free memory = 1398710336 SRR1121294 SRAfilesize 3c9c7081d83d3babdd784d7387c65976 SRR1121294.sra SRR1121294.sra file validated SRR1121294 is single end SRR1121294 is conventional basespace SRR1121294 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1121294_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.119 34.0 34.0 34.0 31.0 34.0 2 33.35425 34.0 34.0 34.0 31.0 34.0 3 33.57175 34.0 34.0 34.0 33.0 34.0 4 36.8155 37.0 37.0 37.0 37.0 37.0 5 36.76475 37.0 37.0 37.0 37.0 37.0 6 36.719 37.0 37.0 37.0 36.0 37.0 7 36.68825 37.0 37.0 37.0 35.0 37.0 8 36.73525 37.0 37.0 37.0 36.0 37.0 9 38.72175 39.0 39.0 39.0 39.0 39.0 10-11 38.711875 39.0 39.0 39.0 39.0 39.0 12-13 38.703374999999994 39.0 39.0 39.0 38.0 39.0 14-15 39.657375 40.0 40.0 40.0 39.0 40.0 16-17 39.633250000000004 40.0 40.0 40.0 39.0 40.0 18-19 39.643375 40.0 40.0 40.0 39.0 40.0 20-21 39.597375 40.0 40.0 40.0 39.0 40.0 22-23 39.586375000000004 40.0 40.0 40.0 39.0 40.0 24-25 39.510999999999996 40.0 40.0 40.0 39.0 40.0 26-27 39.471125 40.0 40.0 40.0 38.5 40.0 28-29 39.361875 40.0 40.0 40.0 38.0 40.0 30-31 39.327125 40.0 40.0 40.0 38.0 40.0 32-33 39.25475 40.0 40.0 40.0 38.0 40.0 34-35 39.1265 40.0 40.0 40.0 38.0 40.0 36-37 39.00175 40.0 40.0 40.0 37.0 40.0 38-39 39.04375 40.0 40.0 40.0 37.5 40.0 40-41 39.11225 40.0 40.0 40.0 38.0 40.0 42-43 38.980875 40.0 40.0 40.0 37.0 40.0 44-45 38.914 40.0 39.5 40.0 37.0 40.0 46-47 38.969625 40.0 39.5 40.0 37.0 40.0 48-49 39.094 40.0 40.0 40.0 37.0 40.0 50-51 39.013374999999996 40.0 40.0 40.0 37.0 40.0 52-53 38.90775 40.0 39.0 40.0 37.0 40.0 54-55 38.640875 40.0 39.0 40.0 36.0 40.0 56-57 38.503875 40.0 39.0 40.0 35.5 40.0 58-59 38.441 40.0 38.5 40.0 35.0 40.0 60-61 38.339625 40.0 38.0 40.0 35.0 40.0 62-63 38.0335 40.0 37.0 40.0 35.0 40.0 64-65 37.7595 39.0 37.0 40.0 35.0 40.0 66-67 37.483125 39.0 36.0 40.0 34.0 40.0 68-69 37.058875 38.5 35.5 40.0 34.0 40.0 70-71 36.647000000000006 37.0 35.0 39.5 34.0 40.0 72-73 36.000375 37.0 35.0 39.0 33.0 40.0 74-75 35.630250000000004 36.5 35.0 39.0 33.0 40.0 76-77 34.953875 35.5 34.5 37.0 31.5 39.0 78-79 34.997875 35.5 35.0 37.0 32.5 39.0 80-81 34.7565 35.0 35.0 37.0 32.5 38.0 82-83 34.5015 35.0 35.0 36.0 32.0 37.0 84-85 34.109375 35.0 34.0 36.0 32.0 37.0 86-87 33.92875 35.0 34.0 35.5 32.0 36.5 88-89 33.625 35.0 34.0 35.0 31.0 36.0 90-91 33.357124999999996 35.0 34.0 35.0 31.0 36.0 92-93 33.112125 35.0 34.0 35.0 31.0 36.0 94-95 32.700125 35.0 34.0 35.0 29.0 35.0 96-97 32.337625 35.0 33.0 35.0 29.0 35.0 98-99 31.897750000000002 35.0 33.0 35.0 27.0 35.0 100 30.80725 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 3.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 2.0 19 3.0 20 3.0 21 6.0 22 5.0 23 7.0 24 4.0 25 6.0 26 7.0 27 10.0 28 26.0 29 20.0 30 20.0 31 23.0 32 50.0 33 47.0 34 82.0 35 147.0 36 476.0 37 1500.0 38 1525.0 39 23.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.962512664640325 15.273556231003038 15.501519756838904 43.262411347517734 2 19.514635976982735 23.46760070052539 37.828371278458846 19.189392044033024 3 21.025 27.175 28.199999999999996 23.599999999999998 4 23.275000000000002 33.125 20.424999999999997 23.175 5 24.425 35.55 22.975 17.05 6 17.599999999999998 36.55 25.275 20.575 7 15.625 16.525000000000002 46.2 21.65 8 18.875 22.125 29.7 29.299999999999997 9 18.45 23.425 31.8 26.325 10-11 22.9875 32.2875 22.4625 22.2625 12-13 20.0625 25.174999999999997 31.1 23.6625 14-15 21.075 26.825 28.325 23.775 16-17 22.037499999999998 27.8625 27.725 22.375 18-19 21.925 28.212500000000002 26.85 23.0125 20-21 22.037499999999998 28.287499999999998 27.4125 22.2625 22-23 21.95 27.3875 27.9375 22.725 24-25 21.75 28.037499999999998 28.375 21.837500000000002 26-27 22.4375 28.125 26.974999999999998 22.4625 28-29 21.6 27.8625 27.825 22.7125 30-31 20.9375 28.487499999999997 27.8625 22.7125 32-33 21.9 28.199999999999996 27.35 22.55 34-35 22.275 29.1375 27.2625 21.325 36-37 21.85389041781336 28.071053289967473 27.89592194145609 22.17913435076307 38-39 22.2625 27.8625 27.875 22.0 40-41 22.3375 27.537499999999998 27.5875 22.537499999999998 42-43 22.2 27.9125 27.3 22.5875 44-45 21.5 28.812500000000004 27.462500000000002 22.225 46-47 22.7625 28.775000000000002 26.474999999999998 21.987499999999997 48-49 22.1875 27.287499999999998 28.225 22.3 50-51 22.475 28.175 27.325 22.025 52-53 22.8125 28.037499999999998 27.425 21.725 54-55 22.410121508204934 26.99486408618314 28.347738945258676 22.24727546035325 56-57 22.198572680605984 27.945411293351697 28.208338550143985 21.647677475898337 58-59 22.6875 27.200000000000003 27.55 22.5625 60-61 21.5375 28.3125 27.450000000000003 22.7 62-63 22.05 28.275 28.050000000000004 21.625 64-65 21.925 29.1125 27.400000000000002 21.5625 66-67 22.400000000000002 28.6625 28.15 20.7875 68-69 22.75 27.8375 27.675 21.7375 70-71 22.21665623043206 27.977457733249842 27.238572323105824 22.567313713212272 72-73 22.27672955974843 28.60377358490566 26.77987421383648 22.339622641509436 74-75 22.715831865089353 28.316133903850993 26.705260508431916 22.26277372262774 76-77 21.934109983715395 28.022046849555306 28.385318802455217 21.658524364274083 78-79 22.5875 27.6875 27.4125 22.3125 80-81 22.825 27.800000000000004 28.275 21.099999999999998 82-83 22.7375 27.750000000000004 27.6 21.912499999999998 84-85 21.587500000000002 27.8375 28.3625 22.2125 86-87 21.775 26.8125 28.5875 22.825 88-89 21.672718167021408 28.50882684362088 27.394516088644043 22.42393890071366 90-91 22.12744606121425 27.433517310587053 28.286502759658806 22.15253386853989 92-93 22.3125 27.700000000000003 27.287499999999998 22.7 94-95 22.428267134444305 27.16451572484651 28.066658313494546 22.340558827214636 96-97 22.887191686490546 27.194190559659447 27.907850256667082 22.010767497182922 98-99 22.3 28.9875 27.55 21.1625 100 22.325 27.950000000000003 27.425 22.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 1.0 24 3.0 25 4.5 26 3.5 27 4.0 28 8.0 29 11.5 30 17.5 31 24.0 32 28.5 33 38.5 34 48.0 35 59.0 36 85.0 37 107.0 38 125.5 39 161.0 40 193.0 41 212.5 42 226.5 43 250.0 44 279.0 45 287.0 46 271.0 47 245.0 48 222.5 49 202.5 50 182.5 51 158.5 52 131.5 53 103.0 54 75.0 55 57.5 56 45.0 57 28.5 58 18.0 59 14.5 60 13.5 61 12.0 62 7.0 63 5.5 64 5.0 65 3.5 66 2.5 67 1.5 68 1.0 69 0.5 70 1.5 71 2.0 72 1.0 73 0.5 74 1.0 75 1.5 76 1.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 1.0 85 1.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.075 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.21250000000000002 56-57 0.1625 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.1875 72-73 0.625 74-75 0.675 76-77 0.21250000000000002 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.1625 90-91 0.35000000000000003 92-93 0.0 94-95 0.2375 96-97 0.1625 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820202 spots for SRR1121294.sra Written 820202 spots for SRR1121294.sra Read 820211 spots for SRR1121294.sra Written 820211 spots for SRR1121294.sra SRR ids: ['SRR1121294.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7ifbr42i SRR1121294.sra spots: 16404049 blocks: [[1, 820202], [820203, 1640404], [1640405, 2460606], [2460607, 3280808], [3280809, 4101010], [4101011, 4921212], [4921213, 5741414], [5741415, 6561616], [6561617, 7381818], [7381819, 8202020], [8202021, 9022222], [9022223, 9842424], [9842425, 10662626], [10662627, 11482828], [11482829, 12303030], [12303031, 13123232], [13123233, 13943434], [13943435, 14763636], [14763637, 15583838], [15583839, 16404049]] SRR1121294 file size 4258227 SRR1121294 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1121294 SRR1121294_1.fastq Input file: SRR1121294_1.fastq trimmed: SRR1121294-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:28:58 2025 >> started Tue Feb 11 11:29:07 2025 >> done (8.907s) 16404049 reads processed; of these: 2279 ( 0.01%) short reads filtered out after trimming by size control 6434 ( 0.04%) empty reads filtered out after trimming by size control 16395336 (99.95%) reads available; of these: 2747791 (16.76%) trimmed reads available after processing 13647545 (83.24%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 334 0.00% 19 420 0.00% 20 596 0.00% 21 603 0.00% 22 771 0.00% 23 1221 0.01% 24 1492 0.01% 25 1982 0.01% 26 3053 0.02% 27 3325 0.02% 28 2521 0.02% 29 2382 0.01% 30 2183 0.01% 31 2164 0.01% 32 2285 0.01% 33 2157 0.01% 34 2360 0.01% 35 2340 0.01% 36 2502 0.02% 37 2342 0.01% 38 2566 0.02% 39 2471 0.02% 40 2630 0.02% 41 2626 0.02% 42 2744 0.02% 43 2831 0.02% 44 2806 0.02% 45 2840 0.02% 46 2924 0.02% 47 2792 0.02% 48 2940 0.02% 49 2959 0.02% 50 3082 0.02% 51 3388 0.02% 52 3464 0.02% 53 3725 0.02% 54 3719 0.02% 55 3845 0.02% 56 3963 0.02% 57 4072 0.02% 58 4120 0.03% 59 4248 0.03% 60 4424 0.03% 61 4509 0.03% 62 4642 0.03% 63 4595 0.03% 64 4607 0.03% 65 5028 0.03% 66 5208 0.03% 67 5273 0.03% 68 5532 0.03% 69 5586 0.03% 70 5783 0.04% 71 5995 0.04% 72 6406 0.04% 73 6682 0.04% 74 6824 0.04% 75 6437 0.04% 76 5440 0.03% 77 6496 0.04% 78 7271 0.04% 79 7828 0.05% 80 8377 0.05% 81 9312 0.06% 82 10017 0.06% 83 11321 0.07% 84 12596 0.08% 85 14098 0.09% 86 16469 0.10% 87 20775 0.13% 88 29611 0.18% 89 65429 0.40% 90 182068 1.11% 91 138087 0.84% 92 385387 2.35% 93 110240 0.67% 94 256668 1.57% 95 135474 0.83% 96 309969 1.89% 97 176147 1.07% 98 410096 2.50% 99 223296 1.36% 100 13647545 83.24% 16395336 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=19.59 fanout-score-rank=11 prefix-density=0.14 prefix-fanout=18.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=286.32 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=29.1 sequence=TTCTTCTTCTTT Started job on | Feb 11 11:29:28 Started mapping on | Feb 11 11:29:28 Finished on | Feb 11 11:29:45 Mapping speed, Million of reads per hour | 3471.95 Number of input reads | 16395336 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 15806265 Uniquely mapped reads % | 96.41% Average mapped length | 98.22 Number of splices: Total | 4785265 Number of splices: Annotated (sjdb) | 4709955 Number of splices: GT/AG | 4713115 Number of splices: GC/AG | 59877 Number of splices: AT/AC | 4754 Number of splices: Non-canonical | 7519 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 367588 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 132546 % of reads mapped to too many loci | 0.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 221483 221483 221483 N_multimapping 367588 367588 367588 N_noFeature 519218 8108085 8129283 N_ambiguous 138838 25283 25624 UnstrandedReadsAssigned:15148209 PositiveStrandReadsAssigned:7672897 NegativeStrandReadsAssigned:7651358 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1121294 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR1121294-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,395,336 reads, 15,570,735 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR1121294.ke.tsv 34699 SRR1121294.se.tsv 87100 total ==> SRR1121294.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 440 20.1254 Potri.005G024800.1.v4.1 1035 936 71 6.65809 Potri.004G059700.1.v4.1 961 862 6 0.610958 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 330.215 10.1914 Potri.016G087400.1.v4.1 270 171 968 496.874 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 91 4.77148 Potri.012G127500.1.v4.1 977 878 5100 509.851 ==> SRR1121294.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 2068 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 327 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR1121294 completed mapping pipeline successfully