Starting /dee2/code/volunteer_pipeline.sh SRR1121295 current disk space = 3049619152896 free memory = 1579893208 SRR1121295 SRAfilesize ec017a4b8bd0804a1a4eb5c2c0dc1201 SRR1121295.sra SRR1121295.sra file validated SRR1121295 is single end SRR1121295 is conventional basespace SRR1121295 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1121295_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94775 34.0 34.0 34.0 31.0 34.0 2 33.24875 34.0 34.0 34.0 31.0 34.0 3 33.53375 34.0 34.0 34.0 31.0 34.0 4 36.771 37.0 37.0 37.0 37.0 37.0 5 36.679 37.0 37.0 37.0 37.0 37.0 6 36.685 37.0 37.0 37.0 35.0 37.0 7 36.66825 37.0 37.0 37.0 35.0 37.0 8 36.69275 37.0 37.0 37.0 35.0 37.0 9 38.64875 39.0 39.0 39.0 38.0 39.0 10-11 38.680125 39.0 39.0 39.0 38.0 39.0 12-13 38.68237499999999 39.0 39.0 39.0 38.0 39.0 14-15 39.608125 40.0 40.0 40.0 39.0 40.0 16-17 39.567875 40.0 40.0 40.0 38.5 40.0 18-19 39.56399999999999 40.0 40.0 40.0 39.0 40.0 20-21 39.548 40.0 40.0 40.0 39.0 40.0 22-23 39.464124999999996 40.0 40.0 40.0 38.5 40.0 24-25 39.442625 40.0 40.0 40.0 38.0 40.0 26-27 39.385374999999996 40.0 40.0 40.0 38.0 40.0 28-29 39.2735 40.0 40.0 40.0 38.0 40.0 30-31 39.192 40.0 40.0 40.0 38.0 40.0 32-33 39.112125 40.0 40.0 40.0 38.0 40.0 34-35 38.925 40.0 39.5 40.0 37.5 40.0 36-37 38.7555 40.0 39.0 40.0 37.0 40.0 38-39 38.807625 40.0 39.5 40.0 37.0 40.0 40-41 38.814125000000004 40.0 39.5 40.0 37.0 40.0 42-43 38.712374999999994 40.0 39.0 40.0 37.0 40.0 44-45 38.61425 40.0 39.0 40.0 36.0 40.0 46-47 38.650375 40.0 39.0 40.0 36.5 40.0 48-49 38.716 40.0 40.0 40.0 36.0 40.0 50-51 38.65675 40.0 39.0 40.0 36.0 40.0 52-53 38.527 40.0 39.0 40.0 36.0 40.0 54-55 38.33825 40.0 39.0 40.0 35.0 40.0 56-57 38.103 40.0 38.5 40.0 35.0 40.0 58-59 37.9895 40.0 38.0 40.0 35.0 40.0 60-61 37.851625 40.0 37.0 40.0 35.0 40.0 62-63 37.5205 40.0 37.0 40.0 34.0 40.0 64-65 37.269875 39.0 36.0 40.0 34.0 40.0 66-67 36.95675 39.0 36.0 40.0 34.0 40.0 68-69 36.577375 37.5 35.0 40.0 33.0 40.0 70-71 36.154624999999996 37.0 35.0 39.5 33.0 40.0 72-73 35.493375 37.0 35.0 39.0 32.0 40.0 74-75 35.11 36.0 35.0 39.0 31.0 40.0 76-77 34.491 35.0 34.0 37.0 30.5 39.0 78-79 34.559375 35.0 35.0 37.0 32.0 39.0 80-81 34.314499999999995 35.0 35.0 36.5 31.0 38.0 82-83 34.02375 35.0 34.0 36.0 31.0 37.0 84-85 33.676125 35.0 34.0 36.0 31.0 37.0 86-87 33.410250000000005 35.0 34.0 35.0 30.5 36.0 88-89 33.1195 35.0 34.0 35.0 30.0 36.0 90-91 32.974625 35.0 34.0 35.0 30.0 36.0 92-93 32.666 35.0 34.0 35.0 29.0 36.0 94-95 32.417875 35.0 34.0 35.0 29.0 35.0 96-97 31.94225 35.0 33.0 35.0 27.0 35.0 98-99 31.505 35.0 33.0 35.0 25.0 35.0 100 30.34075 34.0 31.0 35.0 19.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 8.0 13 2.0 14 6.0 15 6.0 16 2.0 17 2.0 18 5.0 19 5.0 20 4.0 21 5.0 22 5.0 23 7.0 24 9.0 25 12.0 26 10.0 27 22.0 28 21.0 29 21.0 30 34.0 31 35.0 32 37.0 33 55.0 34 98.0 35 201.0 36 448.0 37 1510.0 38 1408.0 39 21.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.299058284550775 13.973021124968184 16.11096971239501 44.61695087808602 2 19.989992494370778 22.9672254190643 37.6282211658744 19.41456092069052 3 22.15 27.825 27.85 22.175 4 24.95 32.550000000000004 20.25 22.25 5 24.099999999999998 34.2 22.95 18.75 6 18.05 36.475 24.875 20.599999999999998 7 17.325 17.299999999999997 44.474999999999994 20.9 8 19.725 20.8 28.725 30.75 9 20.599999999999998 21.875 30.9 26.625 10-11 22.475 32.9375 21.6 22.9875 12-13 20.4375 25.112499999999997 29.612500000000004 24.837500000000002 14-15 20.7 27.675 28.475 23.150000000000002 16-17 22.037499999999998 27.175 28.3875 22.400000000000002 18-19 21.6 28.125 27.187499999999996 23.0875 20-21 22.8125 28.349999999999998 27.325 21.512500000000003 22-23 22.5 27.6625 27.1125 22.725 24-25 21.5625 28.237499999999997 27.825 22.375 26-27 22.287499999999998 28.125 26.9625 22.625 28-29 21.912499999999998 27.925 27.250000000000004 22.912499999999998 30-31 21.587500000000002 27.700000000000003 27.175 23.5375 32-33 22.162499999999998 28.025 27.875 21.9375 34-35 22.4375 27.6375 27.200000000000003 22.725 36-37 22.275059441872106 28.406957827556 26.442247528469526 22.875735202102366 38-39 21.925 28.000000000000004 27.3 22.775000000000002 40-41 22.0625 28.012500000000003 27.05 22.875 42-43 21.4875 27.9125 27.900000000000002 22.7 44-45 22.95 27.900000000000002 26.487500000000004 22.662499999999998 46-47 22.375 28.499999999999996 26.6625 22.4625 48-49 22.8 28.037499999999998 26.5625 22.6 50-51 22.6875 28.1625 27.287499999999998 21.8625 52-53 22.287499999999998 28.225 26.875 22.6125 54-55 21.648709596592333 28.038085692808817 27.712352793786017 22.60085191681283 56-57 23.212720671090523 27.21923125078252 27.45711781645173 22.11093026167522 58-59 23.05 27.650000000000002 27.3375 21.9625 60-61 21.6875 27.950000000000003 26.8625 23.5 62-63 22.5625 27.6875 27.075 22.675 64-65 22.975 26.924999999999997 27.6125 22.4875 66-67 22.225 28.4125 26.775 22.5875 68-69 22.9625 27.237499999999997 27.450000000000003 22.35 70-71 22.90544771446462 27.589229805886035 27.639323731997496 21.865998747651847 72-73 21.84313231776407 27.53367745184439 27.697343572957323 22.925846657434217 74-75 22.417914203044408 27.802239275380554 27.31161152346207 22.468234998112973 76-77 23.205112141335672 27.552938228292195 26.50043854153615 22.741511088835985 78-79 22.8375 27.0 27.212500000000002 22.95 80-81 22.662499999999998 27.737499999999997 27.212500000000002 22.3875 82-83 22.4375 27.05 28.1125 22.400000000000002 84-85 22.5 26.775 27.35 23.375 86-87 22.5 28.725 26.525 22.25 88-89 22.186052335044447 27.72004507324402 27.745085764367094 22.348816827344432 90-91 22.434127979924718 28.557089084065247 26.562107904642406 22.44667503136763 92-93 21.987499999999997 27.474999999999998 28.375 22.162499999999998 94-95 23.039338511651213 27.862691054873466 26.81032322726134 22.287647206213983 96-97 21.747840240390634 27.97045198447477 27.056466758482532 23.22524101665206 98-99 23.3375 27.8625 26.450000000000003 22.35 100 22.375 26.85 27.900000000000002 22.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 2.0 27 4.0 28 7.5 29 12.5 30 17.0 31 21.0 32 34.5 33 48.5 34 55.0 35 70.0 36 82.0 37 87.0 38 117.5 39 150.0 40 167.0 41 185.0 42 224.5 43 241.0 44 248.5 45 276.5 46 268.5 47 251.5 48 244.0 49 210.5 50 177.0 51 154.5 52 129.5 53 103.0 54 73.0 55 59.5 56 50.5 57 44.5 58 32.0 59 23.5 60 20.5 61 12.5 62 11.0 63 9.0 64 7.0 65 7.5 66 6.0 67 6.5 68 6.0 69 4.0 70 3.0 71 3.5 72 4.0 73 2.5 74 2.5 75 3.5 76 3.0 77 4.0 78 3.0 79 1.0 80 2.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.11249999999999999 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.22499999999999998 56-57 0.1625 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.1875 72-73 0.7125 74-75 0.6375 76-77 0.2375 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.1625 90-91 0.375 92-93 0.0 94-95 0.22499999999999998 96-97 0.1625 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.037500000000000006 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340770 spots for SRR1121295.sra Written 1340770 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra Read 1340767 spots for SRR1121295.sra Written 1340767 spots for SRR1121295.sra SRR ids: ['SRR1121295.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nt51fvcd SRR1121295.sra spots: 26815343 blocks: [[1, 1340767], [1340768, 2681534], [2681535, 4022301], [4022302, 5363068], [5363069, 6703835], [6703836, 8044602], [8044603, 9385369], [9385370, 10726136], [10726137, 12066903], [12066904, 13407670], [13407671, 14748437], [14748438, 16089204], [16089205, 17429971], [17429972, 18770738], [18770739, 20111505], [20111506, 21452272], [21452273, 22793039], [22793040, 24133806], [24133807, 25474573], [25474574, 26815343]] SRR1121295 file size 6967767 SRR1121295 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1121295 SRR1121295_1.fastq Input file: SRR1121295_1.fastq trimmed: SRR1121295-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 05:37:10 2025 >> started Wed Feb 12 05:37:22 2025 >> done (12.885s) 26815343 reads processed; of these: 3765 ( 0.01%) short reads filtered out after trimming by size control 12921 ( 0.05%) empty reads filtered out after trimming by size control 26798657 (99.94%) reads available; of these: 4591512 (17.13%) trimmed reads available after processing 22207145 (82.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 476 0.00% 19 648 0.00% 20 753 0.00% 21 1021 0.00% 22 1379 0.01% 23 2056 0.01% 24 2586 0.01% 25 3634 0.01% 26 5071 0.02% 27 5106 0.02% 28 4017 0.01% 29 3857 0.01% 30 3871 0.01% 31 3808 0.01% 32 3963 0.01% 33 3805 0.01% 34 4039 0.02% 35 4149 0.02% 36 4195 0.02% 37 4144 0.02% 38 4509 0.02% 39 4337 0.02% 40 4574 0.02% 41 4457 0.02% 42 4822 0.02% 43 5037 0.02% 44 4759 0.02% 45 4611 0.02% 46 4961 0.02% 47 4685 0.02% 48 4731 0.02% 49 5343 0.02% 50 5405 0.02% 51 5796 0.02% 52 6068 0.02% 53 6163 0.02% 54 6061 0.02% 55 6191 0.02% 56 6539 0.02% 57 7111 0.03% 58 7368 0.03% 59 7212 0.03% 60 8126 0.03% 61 7754 0.03% 62 8124 0.03% 63 7982 0.03% 64 8009 0.03% 65 8571 0.03% 66 8976 0.03% 67 9505 0.04% 68 9772 0.04% 69 9974 0.04% 70 10158 0.04% 71 10574 0.04% 72 11207 0.04% 73 11461 0.04% 74 11644 0.04% 75 11710 0.04% 76 9399 0.04% 77 11120 0.04% 78 12696 0.05% 79 13578 0.05% 80 14643 0.05% 81 15880 0.06% 82 18079 0.07% 83 20197 0.08% 84 22158 0.08% 85 25167 0.09% 86 29443 0.11% 87 37274 0.14% 88 52944 0.20% 89 115695 0.43% 90 305780 1.14% 91 228774 0.85% 92 620004 2.31% 93 183261 0.68% 94 420412 1.57% 95 235872 0.88% 96 533854 1.99% 97 296817 1.11% 98 660318 2.46% 99 371282 1.39% 100 22207145 82.87% 26798657 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=25.15 fanout-score-rank=3 prefix-density=0.19 prefix-fanout=21.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=10 fanout-score=81.99 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=14.3 sequence=CCACCACCAACA Started job on | Feb 12 05:37:37 Started mapping on | Feb 12 05:37:38 Finished on | Feb 12 05:38:07 Mapping speed, Million of reads per hour | 3326.73 Number of input reads | 26798657 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 24057031 Uniquely mapped reads % | 89.77% Average mapped length | 98.23 Number of splices: Total | 7240408 Number of splices: Annotated (sjdb) | 7137579 Number of splices: GT/AG | 7134179 Number of splices: GC/AG | 88375 Number of splices: AT/AC | 7005 Number of splices: Non-canonical | 10849 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 1.92 Insertion rate per base | 0.01% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 608527 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 2004985 % of reads mapped to too many loci | 7.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2133099 2133099 2133099 N_multimapping 608527 608527 608527 N_noFeature 659435 12260207 12322386 N_ambiguous 203498 34478 35383 UnstrandedReadsAssigned:23194098 PositiveStrandReadsAssigned:11762346 NegativeStrandReadsAssigned:11699262 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1121295 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR1121295-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,798,657 reads, 25,389,604 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR1121295.ke.tsv 34699 SRR1121295.se.tsv 87100 total ==> SRR1121295.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 557 14.3954 Potri.005G024800.1.v4.1 1035 936 119 6.30544 Potri.004G059700.1.v4.1 961 862 23 1.32332 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 550.279 9.59617 Potri.016G087400.1.v4.1 270 171 1865 540.913 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 63 1.86651 Potri.012G127500.1.v4.1 977 878 9323 526.63 ==> SRR1121295.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2437 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 546 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR1121295 completed mapping pipeline successfully