Starting /dee2/code/volunteer_pipeline.sh SRR1121296 current disk space = 3051505790976 free memory = 1459336284 SRR1121296 SRAfilesize 5f262e663c119dd5abd2cbd2038ccb83 SRR1121296.sra SRR1121296.sra file validated SRR1121296 is single end SRR1121296 is conventional basespace SRR1121296 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1121296_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.143 34.0 34.0 34.0 31.0 34.0 2 33.39375 34.0 34.0 34.0 33.0 34.0 3 33.60575 34.0 34.0 34.0 33.0 34.0 4 36.79175 37.0 37.0 37.0 37.0 37.0 5 36.75675 37.0 37.0 37.0 37.0 37.0 6 36.786 37.0 37.0 37.0 37.0 37.0 7 36.77075 37.0 37.0 37.0 37.0 37.0 8 36.7145 37.0 37.0 37.0 36.0 37.0 9 38.66025 39.0 39.0 39.0 39.0 39.0 10-11 38.713750000000005 39.0 39.0 39.0 39.0 39.0 12-13 38.61925 39.0 39.0 39.0 38.0 39.0 14-15 39.641125 40.0 40.0 40.0 39.0 40.0 16-17 39.663 40.0 40.0 40.0 39.0 40.0 18-19 39.616625 40.0 40.0 40.0 39.0 40.0 20-21 39.624750000000006 40.0 40.0 40.0 39.0 40.0 22-23 39.59725 40.0 40.0 40.0 39.0 40.0 24-25 39.5225 40.0 40.0 40.0 39.0 40.0 26-27 39.46125 40.0 40.0 40.0 38.5 40.0 28-29 39.3975 40.0 40.0 40.0 38.0 40.0 30-31 39.266000000000005 40.0 40.0 40.0 38.0 40.0 32-33 39.183499999999995 40.0 40.0 40.0 38.0 40.0 34-35 39.067 40.0 40.0 40.0 37.5 40.0 36-37 39.055499999999995 40.0 40.0 40.0 38.0 40.0 38-39 38.95925 40.0 40.0 40.0 37.0 40.0 40-41 38.998999999999995 40.0 40.0 40.0 37.0 40.0 42-43 38.969375 40.0 40.0 40.0 37.0 40.0 44-45 38.875 40.0 39.5 40.0 36.5 40.0 46-47 38.878875 40.0 39.5 40.0 37.0 40.0 48-49 38.987 40.0 40.0 40.0 37.0 40.0 50-51 38.876000000000005 40.0 40.0 40.0 36.5 40.0 52-53 38.85425 40.0 40.0 40.0 36.0 40.0 54-55 38.792 40.0 39.0 40.0 36.0 40.0 56-57 38.645250000000004 40.0 39.0 40.0 35.0 40.0 58-59 38.35075 40.0 38.5 40.0 35.0 40.0 60-61 38.1815 40.0 38.0 40.0 35.0 40.0 62-63 37.796875 40.0 37.0 40.0 34.5 40.0 64-65 37.697374999999994 39.0 37.0 40.0 35.0 40.0 66-67 37.367000000000004 39.0 36.0 40.0 34.0 40.0 68-69 36.958375000000004 38.5 35.5 40.0 34.0 40.0 70-71 36.595749999999995 37.0 35.0 39.5 34.0 40.0 72-73 36.20225 37.0 35.0 39.0 34.0 40.0 74-75 35.783375 36.0 35.0 39.0 33.0 40.0 76-77 34.963875 35.5 34.0 37.0 32.0 39.0 78-79 35.01 35.0 35.0 37.0 33.0 39.0 80-81 34.661125 35.0 35.0 36.5 32.5 38.0 82-83 34.369125 35.0 35.0 36.0 32.5 37.0 84-85 34.13225 35.0 35.0 36.0 32.0 37.0 86-87 33.8935 35.0 34.5 35.5 32.0 36.5 88-89 33.65775 35.0 34.0 35.0 31.0 36.0 90-91 33.495374999999996 35.0 34.0 35.0 31.0 36.0 92-93 33.04925 35.0 34.0 35.0 30.0 36.0 94-95 32.205625 35.0 33.5 35.0 27.0 35.0 96-97 31.67525 35.0 33.0 35.0 25.0 35.0 98-99 30.709 34.0 31.5 35.0 20.5 35.0 100 30.253 34.0 31.0 35.0 15.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 2.0 13 1.0 14 0.0 15 2.0 16 4.0 17 2.0 18 3.0 19 3.0 20 3.0 21 5.0 22 6.0 23 5.0 24 4.0 25 7.0 26 13.0 27 12.0 28 17.0 29 10.0 30 25.0 31 27.0 32 46.0 33 52.0 34 98.0 35 184.0 36 467.0 37 1506.0 38 1478.0 39 16.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.13319827804507 14.585971131932135 16.68776905545708 42.59306153456571 2 19.474342928660825 23.153942428035045 37.32165206508135 20.05006257822278 3 21.025 26.825 28.599999999999998 23.549999999999997 4 23.7 32.35 20.375 23.575 5 24.65 34.475 21.9 18.975 6 18.7 36.275 24.55 20.474999999999998 7 15.775 17.45 45.2 21.575 8 18.6 23.599999999999998 29.175 28.625 9 20.925 22.175 31.75 25.15 10-11 23.45 31.724999999999998 22.037499999999998 22.787499999999998 12-13 20.0125 26.525 29.099999999999998 24.3625 14-15 21.2875 26.7125 29.5875 22.412499999999998 16-17 21.717929482370593 27.781945486371594 26.39409852463116 24.10602650662666 18-19 22.4375 28.15 26.05 23.3625 20-21 21.637500000000003 28.000000000000004 27.787499999999998 22.575 22-23 21.4 27.650000000000002 28.1625 22.787499999999998 24-25 21.275 28.799999999999997 27.525 22.400000000000002 26-27 22.400000000000002 27.6375 26.950000000000003 23.0125 28-29 22.900000000000002 27.675 26.937499999999996 22.4875 30-31 21.075 28.275 27.3375 23.3125 32-33 22.5875 27.900000000000002 27.075 22.4375 34-35 22.475 27.6375 27.35 22.537499999999998 36-37 22.163852407754845 28.005003126954346 26.504065040650403 23.327079424640402 38-39 23.39042380297537 27.753469183647955 27.19089886235779 21.665208151018877 40-41 22.675 27.2625 27.3125 22.75 42-43 21.9375 28.487499999999997 27.150000000000002 22.425 44-45 22.425 28.1875 26.5125 22.875 46-47 22.0 28.6125 26.400000000000002 22.9875 48-49 22.5875 27.5625 27.325 22.525000000000002 50-51 22.162499999999998 28.000000000000004 27.8125 22.025 52-53 22.8 28.15 26.85 22.2 54-55 21.88868042526579 28.580362726704188 27.21701063164478 22.31394621638524 56-57 22.401500938086304 28.117573483427144 26.816760475297063 22.664165103189493 58-59 22.95286910863858 27.928491061382672 27.078384798099762 22.040255031878985 60-61 22.975 27.1125 27.35 22.5625 62-63 21.85 28.475 27.5125 22.162499999999998 64-65 22.787499999999998 27.9375 27.1 22.175 66-67 21.875 28.3125 26.700000000000003 23.1125 68-69 23.4625 27.0625 28.037499999999998 21.4375 70-71 22.91536442055257 26.778347293411674 27.97849731216402 22.327790973871732 72-73 22.052756594574323 28.103512939117394 26.92836604575572 22.91536442055257 74-75 22.940367545943243 27.69096137017127 26.715839479934996 22.652831603950492 76-77 22.158309366012254 27.485306990121295 28.198074277854197 22.158309366012254 78-79 22.027753469183647 27.265908238529818 27.815976997124643 22.890361295161895 80-81 23.0 28.475 27.750000000000004 20.775 82-83 22.7375 26.2625 27.650000000000002 23.35 84-85 22.4625 27.200000000000003 27.250000000000004 23.0875 86-87 23.4125 27.275 26.85 22.4625 88-89 22.127765970746342 27.17839729966246 28.641080135016878 22.052756594574323 90-91 22.05128205128205 27.4671669793621 27.72983114446529 22.751719824890557 92-93 22.193048262065513 27.656914228557138 27.781945486371594 22.36809202300575 94-95 23.633862698511944 27.897961735650867 26.297361510566464 22.170814055270725 96-97 22.46530816352044 27.415926990873857 27.403425428178522 22.715339417427177 98-99 22.112499999999997 27.6625 27.3125 22.912499999999998 100 22.175 27.35 28.025 22.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.0 25 1.0 26 2.0 27 2.0 28 5.5 29 11.5 30 18.0 31 20.5 32 25.0 33 36.5 34 50.5 35 60.5 36 76.5 37 99.0 38 113.5 39 143.5 40 187.5 41 199.5 42 208.5 43 236.5 44 272.0 45 278.5 46 267.0 47 262.0 48 238.5 49 218.0 50 184.5 51 152.0 52 124.0 53 96.5 54 84.5 55 71.5 56 47.0 57 39.0 58 33.5 59 18.0 60 15.5 61 15.0 62 11.5 63 6.0 64 7.5 65 7.5 66 4.5 67 6.5 68 9.0 69 8.0 70 6.5 71 5.5 72 2.5 73 0.5 74 0.5 75 1.5 76 1.5 77 1.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.025 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0625 38-39 0.0125 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0625 56-57 0.0625 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0125 74-75 0.0125 76-77 0.0375 78-79 0.0125 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0625 92-93 0.025 94-95 0.0375 96-97 0.0125 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847636 spots for SRR1121296.sra Written 847636 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra Read 847617 spots for SRR1121296.sra Written 847617 spots for SRR1121296.sra SRR ids: ['SRR1121296.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fhy3ej1d SRR1121296.sra spots: 16952359 blocks: [[1, 847617], [847618, 1695234], [1695235, 2542851], [2542852, 3390468], [3390469, 4238085], [4238086, 5085702], [5085703, 5933319], [5933320, 6780936], [6780937, 7628553], [7628554, 8476170], [8476171, 9323787], [9323788, 10171404], [10171405, 11019021], [11019022, 11866638], [11866639, 12714255], [12714256, 13561872], [13561873, 14409489], [14409490, 15257106], [15257107, 16104723], [16104724, 16952359]] SRR1121296 file size 4400946 SRR1121296 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1121296 SRR1121296_1.fastq Input file: SRR1121296_1.fastq trimmed: SRR1121296-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:41:43 2025 >> started Tue Feb 11 11:41:52 2025 >> done (9.145s) 16952359 reads processed; of these: 2400 ( 0.01%) short reads filtered out after trimming by size control 10122 ( 0.06%) empty reads filtered out after trimming by size control 16939837 (99.93%) reads available; of these: 4806845 (28.38%) trimmed reads available after processing 12132992 (71.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 327 0.00% 19 325 0.00% 20 461 0.00% 21 520 0.00% 22 722 0.00% 23 1088 0.01% 24 1395 0.01% 25 1837 0.01% 26 1870 0.01% 27 1947 0.01% 28 1866 0.01% 29 2062 0.01% 30 2065 0.01% 31 2043 0.01% 32 2259 0.01% 33 2060 0.01% 34 2372 0.01% 35 2243 0.01% 36 2354 0.01% 37 2426 0.01% 38 2528 0.01% 39 2476 0.01% 40 2496 0.01% 41 2532 0.01% 42 2638 0.02% 43 2671 0.02% 44 2498 0.01% 45 2683 0.02% 46 2721 0.02% 47 2643 0.02% 48 2661 0.02% 49 2781 0.02% 50 2974 0.02% 51 2990 0.02% 52 3201 0.02% 53 3192 0.02% 54 3451 0.02% 55 3529 0.02% 56 3700 0.02% 57 3799 0.02% 58 4063 0.02% 59 3934 0.02% 60 4354 0.03% 61 4394 0.03% 62 4656 0.03% 63 4434 0.03% 64 4471 0.03% 65 4893 0.03% 66 4899 0.03% 67 5191 0.03% 68 5431 0.03% 69 5317 0.03% 70 5717 0.03% 71 5853 0.03% 72 6183 0.04% 73 6324 0.04% 74 6414 0.04% 75 6614 0.04% 76 4960 0.03% 77 6037 0.04% 78 6970 0.04% 79 7480 0.04% 80 7974 0.05% 81 8666 0.05% 82 9923 0.06% 83 11494 0.07% 84 12462 0.07% 85 14556 0.09% 86 17914 0.11% 87 24010 0.14% 88 36086 0.21% 89 138312 0.82% 90 806214 4.76% 91 168268 0.99% 92 822741 4.86% 93 158210 0.93% 94 826892 4.88% 95 209914 1.24% 96 729103 4.30% 97 125521 0.74% 98 301097 1.78% 99 168493 0.99% 100 12132992 71.62% 16939837 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=15.89 fanout-score-rank=5 prefix-density=0.13 prefix-fanout=15.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=11 fanout-score=86.48 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=14.7 sequence=CCACCACCAACA Started job on | Feb 11 11:42:11 Started mapping on | Feb 11 11:42:11 Finished on | Feb 11 11:42:32 Mapping speed, Million of reads per hour | 2903.97 Number of input reads | 16939837 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 15407208 Uniquely mapped reads % | 90.95% Average mapped length | 97.36 Number of splices: Total | 4663902 Number of splices: Annotated (sjdb) | 4597303 Number of splices: GT/AG | 4596774 Number of splices: GC/AG | 55872 Number of splices: AT/AC | 4423 Number of splices: Non-canonical | 6833 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.93 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 378050 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 1075384 % of reads mapped to too many loci | 6.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.46% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1154579 1154579 1154579 N_multimapping 378050 378050 378050 N_noFeature 439121 7868003 7894655 N_ambiguous 129034 22472 23024 UnstrandedReadsAssigned:14839053 PositiveStrandReadsAssigned:7516733 NegativeStrandReadsAssigned:7489529 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1121296 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR1121296-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,939,837 reads, 16,089,700 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR1121296.ke.tsv 34699 SRR1121296.se.tsv 87100 total ==> SRR1121296.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 351 14.4947 Potri.005G024800.1.v4.1 1035 936 77 6.51915 Potri.004G059700.1.v4.1 961 862 8 0.735459 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 350.051 9.75388 Potri.016G087400.1.v4.1 270 171 1151 533.403 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 49 2.31962 Potri.012G127500.1.v4.1 977 878 5886 531.253 ==> SRR1121296.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1618 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 302 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR1121296 completed mapping pipeline successfully