Starting /dee2/code/volunteer_pipeline.sh SRR1121297 current disk space = 3051046785024 free memory = 1500645940 SRR1121297 SRAfilesize 203694b16af067f33f984b215deaa88a SRR1121297.sra SRR1121297.sra file validated SRR1121297 is single end SRR1121297 is conventional basespace SRR1121297 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1121297_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.20775 34.0 34.0 34.0 31.0 34.0 2 33.363 34.0 34.0 34.0 31.0 34.0 3 33.56175 34.0 34.0 34.0 33.0 34.0 4 36.801 37.0 37.0 37.0 37.0 37.0 5 36.73175 37.0 37.0 37.0 37.0 37.0 6 36.674 37.0 37.0 37.0 36.0 37.0 7 36.68075 37.0 37.0 37.0 35.0 37.0 8 36.69225 37.0 37.0 37.0 35.0 37.0 9 38.68525 39.0 39.0 39.0 38.0 39.0 10-11 38.670625 39.0 39.0 39.0 39.0 39.0 12-13 38.666375 39.0 39.0 39.0 38.0 39.0 14-15 39.5945 40.0 40.0 40.0 39.0 40.0 16-17 39.554874999999996 40.0 40.0 40.0 39.0 40.0 18-19 39.52175 40.0 40.0 40.0 39.0 40.0 20-21 39.523624999999996 40.0 40.0 40.0 39.0 40.0 22-23 39.458375000000004 40.0 40.0 40.0 39.0 40.0 24-25 39.409499999999994 40.0 40.0 40.0 38.0 40.0 26-27 39.382000000000005 40.0 40.0 40.0 38.0 40.0 28-29 39.266875 40.0 40.0 40.0 38.0 40.0 30-31 39.25275 40.0 40.0 40.0 38.0 40.0 32-33 39.17075 40.0 40.0 40.0 38.0 40.0 34-35 38.995125 40.0 40.0 40.0 37.0 40.0 36-37 38.909625000000005 40.0 39.5 40.0 37.0 40.0 38-39 38.95225 40.0 40.0 40.0 37.0 40.0 40-41 39.0385 40.0 40.0 40.0 38.0 40.0 42-43 38.946875000000006 40.0 40.0 40.0 37.0 40.0 44-45 38.8145 40.0 39.0 40.0 37.0 40.0 46-47 38.838625 40.0 39.0 40.0 37.0 40.0 48-49 38.8935 40.0 40.0 40.0 37.0 40.0 50-51 38.882625000000004 40.0 40.0 40.0 37.0 40.0 52-53 38.727625 40.0 39.0 40.0 36.0 40.0 54-55 38.527249999999995 40.0 39.0 40.0 35.5 40.0 56-57 38.414500000000004 40.0 39.0 40.0 35.0 40.0 58-59 38.311625 40.0 38.5 40.0 35.0 40.0 60-61 38.182874999999996 40.0 38.0 40.0 35.0 40.0 62-63 37.845375000000004 40.0 37.0 40.0 35.0 40.0 64-65 37.628875 39.0 36.5 40.0 35.0 40.0 66-67 37.29275 39.0 36.0 40.0 34.0 40.0 68-69 36.83525 38.5 35.5 40.0 34.0 40.0 70-71 36.4715 37.0 35.0 39.5 34.0 40.0 72-73 35.942750000000004 37.0 35.0 39.0 33.0 40.0 74-75 35.495125 36.0 35.0 39.0 32.0 40.0 76-77 34.80075 35.5 34.5 37.0 31.5 39.0 78-79 34.9275 35.5 35.0 37.0 32.0 39.0 80-81 34.6115 35.0 35.0 37.0 32.0 38.5 82-83 34.334125 35.0 35.0 36.0 32.0 37.0 84-85 33.948 35.0 34.0 36.0 31.5 37.0 86-87 33.72825 35.0 34.0 35.5 31.0 36.5 88-89 33.46025 35.0 34.0 35.0 31.0 36.0 90-91 33.243125 35.0 34.0 35.0 31.0 36.0 92-93 32.971125 35.0 34.0 35.0 30.0 36.0 94-95 32.609375 35.0 34.0 35.0 29.0 35.0 96-97 32.20225 35.0 33.0 35.0 28.0 35.0 98-99 31.826375 35.0 33.0 35.0 27.0 35.0 100 30.72075 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 1.0 12 4.0 13 1.0 14 0.0 15 0.0 16 1.0 17 4.0 18 2.0 19 5.0 20 5.0 21 8.0 22 9.0 23 9.0 24 5.0 25 10.0 26 9.0 27 13.0 28 16.0 29 25.0 30 29.0 31 26.0 32 42.0 33 62.0 34 68.0 35 171.0 36 426.0 37 1517.0 38 1507.0 39 23.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.943253467843633 14.527112232030264 17.099621689785625 43.430012610340476 2 19.103655483224838 23.71056584877316 37.63144717075613 19.55433149724587 3 21.875 27.474999999999998 27.6 23.05 4 24.099999999999998 31.674999999999997 20.175 24.05 5 24.474999999999998 36.25 21.2 18.075 6 18.2 36.5 23.9 21.4 7 15.45 17.599999999999998 44.474999999999994 22.475 8 18.4 24.0 28.525 29.075 9 20.8 21.95 30.4 26.85 10-11 22.1875 33.387499999999996 22.25 22.175 12-13 19.975 27.150000000000002 29.299999999999997 23.575 14-15 21.375 27.425 28.962500000000002 22.237499999999997 16-17 21.6875 28.262500000000003 26.5 23.549999999999997 18-19 21.925 27.3625 28.012500000000003 22.7 20-21 22.175 28.3125 26.55 22.9625 22-23 21.3875 29.4125 27.075 22.125 24-25 22.2125 28.050000000000004 27.212500000000002 22.525000000000002 26-27 22.15 28.075 27.0875 22.6875 28-29 21.5 27.725 28.175 22.6 30-31 21.3625 28.1625 27.212500000000002 23.2625 32-33 21.9625 28.175 27.05 22.8125 34-35 21.925 28.025 27.537499999999998 22.5125 36-37 21.673336668334166 28.339169584792394 27.351175587793897 22.63631815907954 38-39 21.1125 28.3625 28.0625 22.4625 40-41 21.2375 28.499999999999996 27.3625 22.900000000000002 42-43 20.6125 28.375 28.7375 22.275 44-45 21.912499999999998 27.8625 28.012500000000003 22.2125 46-47 21.087500000000002 28.262500000000003 28.050000000000004 22.6 48-49 22.05 27.9125 27.287499999999998 22.75 50-51 22.3875 27.500000000000004 27.700000000000003 22.412499999999998 52-53 22.6375 27.925 27.2625 22.175 54-55 21.914893617021278 28.735919899874844 27.108886107634543 22.24030037546934 56-57 21.499186584908024 28.394443749217867 27.71868351895883 22.387686146915282 58-59 21.6 27.1125 28.875 22.412499999999998 60-61 22.112499999999997 27.787499999999998 27.487499999999997 22.6125 62-63 21.25 28.5875 27.800000000000004 22.3625 64-65 21.1625 28.000000000000004 27.987499999999997 22.85 66-67 22.1 28.237499999999997 27.8875 21.775 68-69 22.0625 28.425 27.450000000000003 22.0625 70-71 21.374045801526716 28.494556375922915 27.956451007383304 22.17494681516706 72-73 21.04404567699837 28.52302672857322 27.506588028610867 22.926339565817543 74-75 22.190165579528347 28.161063723030605 28.060712493728047 21.588058203712997 76-77 21.48667250656989 28.069077712426484 28.019021399073957 22.42522838192967 78-79 21.75 27.55 28.812500000000004 21.8875 80-81 22.2125 28.8625 27.05 21.875 82-83 22.6375 28.1625 27.075 22.125 84-85 22.7625 28.037499999999998 27.85 21.349999999999998 86-87 22.95 28.499999999999996 26.8125 21.7375 88-89 23.185685685685687 27.927927927927925 27.002002002002 21.884384384384383 90-91 22.70107742420446 27.712352793786017 28.113254823352545 21.473314958656978 92-93 21.575 28.349999999999998 27.425 22.650000000000002 94-95 23.053817271589487 27.872340425531917 27.55944931163955 21.51439299123905 96-97 22.30980980980981 27.69019019019019 28.315815815815814 21.684184184184186 98-99 22.400000000000002 26.775 27.9125 22.912499999999998 100 22.400000000000002 27.900000000000002 29.049999999999997 20.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 3.5 25 3.5 26 2.0 27 3.5 28 7.5 29 14.0 30 18.0 31 19.5 32 25.0 33 39.5 34 54.5 35 66.5 36 87.0 37 108.5 38 129.5 39 155.0 40 189.5 41 225.5 42 237.0 43 257.5 44 272.0 45 263.5 46 255.5 47 244.0 48 231.5 49 216.0 50 179.5 51 146.5 52 127.0 53 99.5 54 74.5 55 55.0 56 40.5 57 33.5 58 24.5 59 16.0 60 12.0 61 8.5 62 12.0 63 7.5 64 4.5 65 5.5 66 3.5 67 1.0 68 1.5 69 3.0 70 2.0 71 0.5 72 0.0 73 2.0 74 2.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.05 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.125 56-57 0.11249999999999999 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.11249999999999999 72-73 0.3875 74-75 0.35000000000000003 76-77 0.11249999999999999 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.1 90-91 0.22499999999999998 92-93 0.0 94-95 0.125 96-97 0.1 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719354 spots for SRR1121297.sra Written 719354 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra Read 719336 spots for SRR1121297.sra Written 719336 spots for SRR1121297.sra SRR ids: ['SRR1121297.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mckf2xp2 SRR1121297.sra spots: 14386738 blocks: [[1, 719336], [719337, 1438672], [1438673, 2158008], [2158009, 2877344], [2877345, 3596680], [3596681, 4316016], [4316017, 5035352], [5035353, 5754688], [5754689, 6474024], [6474025, 7193360], [7193361, 7912696], [7912697, 8632032], [8632033, 9351368], [9351369, 10070704], [10070705, 10790040], [10790041, 11509376], [11509377, 12228712], [12228713, 12948048], [12948049, 13667384], [13667385, 14386738]] SRR1121297 file size 3733263 SRR1121297 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1121297 SRR1121297_1.fastq Input file: SRR1121297_1.fastq trimmed: SRR1121297-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:09:52 2025 >> started Tue Feb 11 12:10:00 2025 >> done (7.716s) 14386738 reads processed; of these: 2076 ( 0.01%) short reads filtered out after trimming by size control 7011 ( 0.05%) empty reads filtered out after trimming by size control 14377651 (99.94%) reads available; of these: 2575155 (17.91%) trimmed reads available after processing 11802496 (82.09%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 298 0.00% 19 443 0.00% 20 650 0.00% 21 494 0.00% 22 623 0.00% 23 994 0.01% 24 1263 0.01% 25 1710 0.01% 26 2315 0.02% 27 2272 0.02% 28 1899 0.01% 29 1823 0.01% 30 1749 0.01% 31 1720 0.01% 32 1914 0.01% 33 1760 0.01% 34 1971 0.01% 35 2080 0.01% 36 2174 0.02% 37 2254 0.02% 38 2181 0.02% 39 2200 0.02% 40 2106 0.01% 41 2119 0.01% 42 2375 0.02% 43 2309 0.02% 44 2405 0.02% 45 2357 0.02% 46 2448 0.02% 47 2329 0.02% 48 2402 0.02% 49 2533 0.02% 50 2637 0.02% 51 3002 0.02% 52 2839 0.02% 53 3102 0.02% 54 3173 0.02% 55 3147 0.02% 56 3298 0.02% 57 3396 0.02% 58 3457 0.02% 59 3721 0.03% 60 3818 0.03% 61 3808 0.03% 62 3872 0.03% 63 4045 0.03% 64 4047 0.03% 65 4233 0.03% 66 4444 0.03% 67 4539 0.03% 68 4926 0.03% 69 4875 0.03% 70 5069 0.04% 71 5148 0.04% 72 5454 0.04% 73 5660 0.04% 74 5788 0.04% 75 5717 0.04% 76 4836 0.03% 77 5395 0.04% 78 6189 0.04% 79 6799 0.05% 80 7378 0.05% 81 8052 0.06% 82 8878 0.06% 83 10210 0.07% 84 10963 0.08% 85 12409 0.09% 86 14669 0.10% 87 18607 0.13% 88 27706 0.19% 89 67509 0.47% 90 222701 1.55% 91 125998 0.88% 92 373683 2.60% 93 95794 0.67% 94 230219 1.60% 95 122597 0.85% 96 299424 2.08% 97 153374 1.07% 98 383173 2.67% 99 193207 1.34% 100 11802496 82.09% 14377651 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=36.92 fanout-score-rank=2 prefix-density=0.25 prefix-fanout=27.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=6 fanout-score=105.24 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=15.6 sequence=CCACCACCAACA Started job on | Feb 11 12:10:15 Started mapping on | Feb 11 12:10:15 Finished on | Feb 11 12:10:31 Mapping speed, Million of reads per hour | 3234.97 Number of input reads | 14377651 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 13823576 Uniquely mapped reads % | 96.15% Average mapped length | 98.14 Number of splices: Total | 4125484 Number of splices: Annotated (sjdb) | 4061684 Number of splices: GT/AG | 4064966 Number of splices: GC/AG | 50206 Number of splices: AT/AC | 4095 Number of splices: Non-canonical | 6217 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313164 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 172964 % of reads mapped to too many loci | 1.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 240911 240911 240911 N_multimapping 313164 313164 313164 N_noFeature 439018 7080556 7100110 N_ambiguous 125583 21648 22167 UnstrandedReadsAssigned:13258975 PositiveStrandReadsAssigned:6721372 NegativeStrandReadsAssigned:6701299 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1121297 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR1121297-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,377,651 reads, 13,672,901 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52401 SRR1121297.ke.tsv 34699 SRR1121297.se.tsv 87100 total ==> SRR1121297.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 423 21.7803 Potri.005G024800.1.v4.1 1035 936 61 6.43952 Potri.004G059700.1.v4.1 961 862 11 1.26091 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 287.467 9.98751 Potri.016G087400.1.v4.1 270 171 782 451.866 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 80.5736 4.75594 Potri.012G127500.1.v4.1 977 878 4374 492.247 ==> SRR1121297.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1721 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 344 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR1121297 completed mapping pipeline successfully