Starting /dee2/code/volunteer_pipeline.sh SRR1121298 current disk space = 3049629855744 free memory = 1496126512 SRR1121298 SRAfilesize 8f8fdd5e41be6704c8c4b095fc528d62 SRR1121298.sra SRR1121298.sra file validated SRR1121298 is single end SRR1121298 is conventional basespace SRR1121298 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1121298_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3415 34.0 33.0 34.0 31.0 34.0 2 33.524 34.0 34.0 34.0 33.0 34.0 3 33.64325 34.0 34.0 34.0 33.0 34.0 4 36.78575 37.0 37.0 37.0 37.0 37.0 5 36.76125 37.0 37.0 37.0 37.0 37.0 6 36.797 37.0 37.0 37.0 37.0 37.0 7 36.753 37.0 37.0 37.0 37.0 37.0 8 36.73125 37.0 37.0 37.0 36.0 37.0 9 38.662 39.0 39.0 39.0 39.0 39.0 10-11 38.709625 39.0 39.0 39.0 39.0 39.0 12-13 38.656625000000005 39.0 39.0 39.0 38.0 39.0 14-15 39.642375 40.0 40.0 40.0 39.0 40.0 16-17 39.687 40.0 40.0 40.0 39.0 40.0 18-19 39.614125 40.0 40.0 40.0 39.0 40.0 20-21 39.612875 40.0 40.0 40.0 39.0 40.0 22-23 39.558499999999995 40.0 40.0 40.0 39.0 40.0 24-25 39.53275 40.0 40.0 40.0 39.0 40.0 26-27 39.43575 40.0 40.0 40.0 38.5 40.0 28-29 39.388374999999996 40.0 40.0 40.0 38.0 40.0 30-31 39.334125 40.0 40.0 40.0 38.0 40.0 32-33 39.258125 40.0 40.0 40.0 38.0 40.0 34-35 39.14725 40.0 40.0 40.0 37.5 40.0 36-37 39.120375 40.0 40.0 40.0 38.0 40.0 38-39 38.990375 40.0 40.0 40.0 37.5 40.0 40-41 39.115125 40.0 40.0 40.0 38.0 40.0 42-43 39.023624999999996 40.0 40.0 40.0 37.0 40.0 44-45 38.949625 40.0 40.0 40.0 37.0 40.0 46-47 39.053625 40.0 40.0 40.0 37.5 40.0 48-49 39.09325 40.0 40.0 40.0 37.5 40.0 50-51 38.964 40.0 40.0 40.0 37.0 40.0 52-53 38.9385 40.0 40.0 40.0 37.0 40.0 54-55 38.935875 40.0 40.0 40.0 37.0 40.0 56-57 38.781375 40.0 39.0 40.0 36.5 40.0 58-59 38.577 40.0 39.0 40.0 35.0 40.0 60-61 38.364375 40.0 38.5 40.0 35.0 40.0 62-63 38.081625 40.0 37.0 40.0 35.0 40.0 64-65 37.878125 39.5 37.0 40.0 35.0 40.0 66-67 37.550375 39.0 36.5 40.0 35.0 40.0 68-69 37.228875 39.0 36.0 40.0 34.5 40.0 70-71 36.797625 37.5 35.0 40.0 34.0 40.0 72-73 36.419124999999994 37.0 35.0 39.0 34.0 40.0 74-75 35.933499999999995 36.5 35.0 39.0 33.5 40.0 76-77 35.125 35.5 34.5 37.0 32.0 39.0 78-79 35.19375 35.5 35.0 37.0 33.0 39.0 80-81 34.817499999999995 35.0 35.0 37.0 33.0 38.5 82-83 34.508375 35.0 35.0 36.0 33.0 37.0 84-85 34.243125 35.0 35.0 36.0 32.5 37.0 86-87 33.922125 35.0 35.0 35.5 32.0 36.5 88-89 33.822625 35.0 34.5 35.0 32.0 36.0 90-91 33.679500000000004 35.0 34.5 35.0 32.0 36.0 92-93 33.305125 35.0 34.0 35.0 30.5 36.0 94-95 32.38175 35.0 33.5 35.0 27.5 35.0 96-97 32.021875 35.0 33.0 35.0 26.5 35.0 98-99 31.085250000000002 34.5 32.0 35.0 21.5 35.0 100 30.48825 34.0 31.0 35.0 18.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 0.0 14 1.0 15 2.0 16 4.0 17 1.0 18 2.0 19 6.0 20 5.0 21 3.0 22 2.0 23 4.0 24 9.0 25 8.0 26 15.0 27 6.0 28 16.0 29 14.0 30 13.0 31 22.0 32 28.0 33 56.0 34 82.0 35 169.0 36 431.0 37 1504.0 38 1578.0 39 16.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.49019607843137 14.957264957264957 16.691804927099042 42.86073403720462 2 19.294294294294296 23.7987987987988 36.686686686686684 20.22022022022022 3 21.775 27.900000000000002 28.175 22.15 4 24.85 33.6 20.175 21.375 5 24.925 34.849999999999994 21.675 18.55 6 18.375 36.65 24.7 20.275000000000002 7 16.0 15.325 46.175 22.5 8 19.175 23.175 27.450000000000003 30.2 9 19.8 24.575 31.0 24.625 10-11 23.0375 31.775 23.375 21.8125 12-13 20.3 25.624999999999996 30.8 23.275000000000002 14-15 21.2875 27.5125 28.237499999999997 22.9625 16-17 22.352794099262407 28.01600200025003 26.64083010376297 22.99037379672459 18-19 22.1875 27.437499999999996 27.8875 22.4875 20-21 22.35 27.500000000000004 27.125 23.025000000000002 22-23 21.375 28.037499999999998 27.5875 23.0 24-25 22.6 27.4125 27.6375 22.35 26-27 21.6875 28.725 27.437499999999996 22.15 28-29 21.45 28.7375 27.787499999999998 22.025 30-31 21.212500000000002 28.1125 28.1375 22.537499999999998 32-33 21.8 28.65 27.3375 22.2125 34-35 22.9625 27.400000000000002 27.150000000000002 22.4875 36-37 22.093023255813954 28.51962990747687 26.994248562140534 22.393098274568644 38-39 21.665208151018877 27.678459807475935 27.928491061382672 22.727840980122515 40-41 22.287499999999998 27.450000000000003 26.950000000000003 23.3125 42-43 22.425 27.8125 27.224999999999998 22.537499999999998 44-45 22.125 27.787499999999998 27.6375 22.45 46-47 21.7 27.6625 28.125 22.5125 48-49 21.4 27.987499999999997 28.249999999999996 22.3625 50-51 22.225 27.800000000000004 27.6 22.375 52-53 21.637500000000003 28.175 27.150000000000002 23.0375 54-55 21.958234337876704 27.960485181943227 27.810428910841566 22.2708515693385 56-57 22.268067016754188 27.481870467616904 28.382095523880967 21.867966991747938 58-59 22.42780347543443 27.665958244780597 27.090886360795096 22.815351918989872 60-61 21.3625 28.599999999999998 28.15 21.8875 62-63 22.3 27.650000000000002 26.6 23.45 64-65 22.325 27.450000000000003 27.55 22.675 66-67 22.3375 27.787499999999998 27.900000000000002 21.975 68-69 22.475 27.237499999999997 27.487499999999997 22.8 70-71 21.827728466058257 27.365920740092513 28.528566070758842 22.277784723090384 72-73 21.477684710588825 28.178522315289413 28.128516064508062 22.215276909613703 74-75 22.650000000000002 27.450000000000003 27.925 21.975 76-77 23.052881610201275 27.665958244780597 27.378422302787847 21.90273784223028 78-79 22.415301912739093 27.51593949243655 27.778472309038634 22.290286285785722 80-81 22.2 27.987499999999997 28.212500000000002 21.6 82-83 22.8375 27.85 27.150000000000002 22.162499999999998 84-85 22.662499999999998 27.6875 28.000000000000004 21.65 86-87 22.125 28.287499999999998 27.6375 21.95 88-89 21.85 27.5125 28.762500000000003 21.875 90-91 22.268067016754188 27.91947986996749 27.956989247311824 21.85546386596649 92-93 21.642910727681922 28.66966741685421 27.84446111527882 21.842960740185045 94-95 22.115264408051004 27.84098012251531 27.57844730591324 22.46530816352044 96-97 22.577822227778473 28.27853481685211 27.11588948618577 22.027753469183647 98-99 22.375 27.5125 27.875 22.237499999999997 100 22.525000000000002 26.775 28.15 22.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 2.0 26 4.5 27 6.0 28 5.5 29 11.0 30 19.0 31 23.0 32 26.0 33 35.0 34 44.0 35 56.0 36 74.5 37 104.5 38 129.0 39 147.5 40 187.5 41 211.0 42 218.0 43 256.0 44 269.0 45 268.0 46 291.5 47 283.0 48 231.5 49 195.0 50 189.5 51 167.0 52 135.0 53 106.5 54 79.0 55 51.5 56 37.0 57 33.0 58 23.0 59 17.5 60 13.5 61 7.0 62 4.0 63 2.5 64 5.5 65 5.5 66 1.5 67 1.5 68 3.0 69 3.0 70 2.0 71 1.0 72 0.5 73 1.5 74 1.0 75 1.0 76 1.5 77 0.5 78 0.5 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.025 38-39 0.0125 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0375 56-57 0.025 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0125 74-75 0.0 76-77 0.0125 78-79 0.0125 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.025 92-93 0.025 94-95 0.0125 96-97 0.0125 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430540 spots for SRR1121298.sra Written 430540 spots for SRR1121298.sra Read 430544 spots for SRR1121298.sra Written 430544 spots for SRR1121298.sra SRR ids: ['SRR1121298.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qz_imb70 SRR1121298.sra spots: 8610804 blocks: [[1, 430540], [430541, 861080], [861081, 1291620], [1291621, 1722160], [1722161, 2152700], [2152701, 2583240], [2583241, 3013780], [3013781, 3444320], [3444321, 3874860], [3874861, 4305400], [4305401, 4735940], [4735941, 5166480], [5166481, 5597020], [5597021, 6027560], [6027561, 6458100], [6458101, 6888640], [6888641, 7319180], [7319181, 7749720], [7749721, 8180260], [8180261, 8610804]] SRR1121298 file size 2231449 SRR1121298 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1121298 SRR1121298_1.fastq Input file: SRR1121298_1.fastq trimmed: SRR1121298-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 05:41:28 2025 >> started Wed Feb 12 05:41:34 2025 >> done (6.003s) 8610804 reads processed; of these: 1179 ( 0.01%) short reads filtered out after trimming by size control 3071 ( 0.04%) empty reads filtered out after trimming by size control 8606554 (99.95%) reads available; of these: 2373976 (27.58%) trimmed reads available after processing 6232578 (72.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 133 0.00% 19 160 0.00% 20 220 0.00% 21 247 0.00% 22 380 0.00% 23 492 0.01% 24 636 0.01% 25 881 0.01% 26 849 0.01% 27 875 0.01% 28 845 0.01% 29 868 0.01% 30 974 0.01% 31 917 0.01% 32 991 0.01% 33 964 0.01% 34 1099 0.01% 35 1083 0.01% 36 1126 0.01% 37 1139 0.01% 38 1129 0.01% 39 1200 0.01% 40 1255 0.01% 41 1172 0.01% 42 1246 0.01% 43 1302 0.02% 44 1215 0.01% 45 1249 0.01% 46 1270 0.01% 47 1271 0.01% 48 1367 0.02% 49 1294 0.02% 50 1361 0.02% 51 1496 0.02% 52 1468 0.02% 53 1620 0.02% 54 1577 0.02% 55 1699 0.02% 56 1736 0.02% 57 1801 0.02% 58 1864 0.02% 59 1908 0.02% 60 1965 0.02% 61 2025 0.02% 62 2009 0.02% 63 2101 0.02% 64 2171 0.03% 65 2206 0.03% 66 2311 0.03% 67 2435 0.03% 68 2339 0.03% 69 2480 0.03% 70 2665 0.03% 71 2744 0.03% 72 2881 0.03% 73 2914 0.03% 74 3165 0.04% 75 3031 0.04% 76 2532 0.03% 77 2757 0.03% 78 3182 0.04% 79 3671 0.04% 80 3657 0.04% 81 4096 0.05% 82 4596 0.05% 83 5284 0.06% 84 5798 0.07% 85 6699 0.08% 86 8187 0.10% 87 10883 0.13% 88 16611 0.19% 89 65592 0.76% 90 413028 4.80% 91 80348 0.93% 92 405656 4.71% 93 75924 0.88% 94 412342 4.79% 95 99920 1.16% 96 358870 4.17% 97 61097 0.71% 98 152118 1.77% 99 85307 0.99% 100 6232578 72.42% 8606554 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=25.09 fanout-score-rank=4 prefix-density=0.18 prefix-fanout=21.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=9 fanout-score=87.28 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=14.2 sequence=CCACCACCAACA Started job on | Feb 12 05:41:52 Started mapping on | Feb 12 05:41:52 Finished on | Feb 12 05:42:03 Mapping speed, Million of reads per hour | 2816.69 Number of input reads | 8606554 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 8244400 Uniquely mapped reads % | 95.79% Average mapped length | 97.38 Number of splices: Total | 2470619 Number of splices: Annotated (sjdb) | 2434912 Number of splices: GT/AG | 2434178 Number of splices: GC/AG | 30096 Number of splices: AT/AC | 2485 Number of splices: Non-canonical | 3860 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 1.96 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 190117 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 127902 % of reads mapped to too many loci | 1.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 172037 172037 172037 N_multimapping 190117 190117 190117 N_noFeature 233585 4208206 4225781 N_ambiguous 69405 12738 12746 UnstrandedReadsAssigned:7941410 PositiveStrandReadsAssigned:4023456 NegativeStrandReadsAssigned:4005873 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1121298 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR1121298-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,606,554 reads, 8,214,670 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 984 rounds 52401 SRR1121298.ke.tsv 34699 SRR1121298.se.tsv 87100 total ==> SRR1121298.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 248 20.8399 Potri.005G024800.1.v4.1 1035 936 50 8.61418 Potri.004G059700.1.v4.1 961 862 7 1.30951 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 171.158 9.70482 Potri.016G087400.1.v4.1 270 171 579 546.012 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 31 2.98625 Potri.012G127500.1.v4.1 977 878 3398 624.092 ==> SRR1121298.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1068 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 184 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR1121298 completed mapping pipeline successfully