Starting /dee2/code/volunteer_pipeline.sh SRR1121299 current disk space = 3048886112256 free memory = 1297858996 SRR1121299 SRAfilesize 82d33b94a4f3b7b25ac4cf0c90b8e8d3 SRR1121299.sra SRR1121299.sra file validated SRR1121299 is single end SRR1121299 is conventional basespace SRR1121299 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1121299_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2695 34.0 34.0 34.0 31.0 34.0 2 33.411 34.0 34.0 34.0 31.0 34.0 3 33.5815 34.0 34.0 34.0 33.0 34.0 4 36.81725 37.0 37.0 37.0 37.0 37.0 5 36.7535 37.0 37.0 37.0 37.0 37.0 6 36.67975 37.0 37.0 37.0 36.0 37.0 7 36.67475 37.0 37.0 37.0 35.0 37.0 8 36.696 37.0 37.0 37.0 36.0 37.0 9 38.68275 39.0 39.0 39.0 38.0 39.0 10-11 38.68925 39.0 39.0 39.0 38.5 39.0 12-13 38.67125 39.0 39.0 39.0 38.0 39.0 14-15 39.62625 40.0 40.0 40.0 39.0 40.0 16-17 39.574125 40.0 40.0 40.0 39.0 40.0 18-19 39.551 40.0 40.0 40.0 39.0 40.0 20-21 39.562124999999995 40.0 40.0 40.0 39.0 40.0 22-23 39.513374999999996 40.0 40.0 40.0 39.0 40.0 24-25 39.460499999999996 40.0 40.0 40.0 39.0 40.0 26-27 39.39125 40.0 40.0 40.0 38.0 40.0 28-29 39.294124999999994 40.0 40.0 40.0 38.0 40.0 30-31 39.226 40.0 40.0 40.0 38.0 40.0 32-33 39.186125000000004 40.0 40.0 40.0 38.0 40.0 34-35 39.001374999999996 40.0 40.0 40.0 37.0 40.0 36-37 38.88775 40.0 39.0 40.0 37.0 40.0 38-39 38.90525 40.0 40.0 40.0 37.0 40.0 40-41 39.01975 40.0 40.0 40.0 38.0 40.0 42-43 38.9585 40.0 40.0 40.0 37.0 40.0 44-45 38.812625 40.0 39.0 40.0 37.0 40.0 46-47 38.880750000000006 40.0 39.0 40.0 37.0 40.0 48-49 38.949124999999995 40.0 40.0 40.0 37.0 40.0 50-51 38.915625 40.0 40.0 40.0 37.0 40.0 52-53 38.803125 40.0 39.5 40.0 36.5 40.0 54-55 38.638374999999996 40.0 39.0 40.0 36.0 40.0 56-57 38.521375000000006 40.0 39.0 40.0 35.0 40.0 58-59 38.43925 40.0 39.0 40.0 35.0 40.0 60-61 38.234875 40.0 38.0 40.0 35.0 40.0 62-63 37.936875 40.0 37.0 40.0 35.0 40.0 64-65 37.684 39.5 37.0 40.0 35.0 40.0 66-67 37.378 39.0 36.0 40.0 34.0 40.0 68-69 37.038875000000004 38.5 36.0 40.0 34.0 40.0 70-71 36.623625000000004 37.5 35.0 39.5 34.0 40.0 72-73 36.043625 37.0 35.0 39.0 33.0 40.0 74-75 35.62625 36.5 35.0 39.0 32.5 40.0 76-77 34.964749999999995 36.0 34.5 37.0 31.5 39.0 78-79 34.88975000000001 35.5 35.0 37.0 32.0 39.0 80-81 34.68575 35.0 35.0 37.0 32.0 38.5 82-83 34.3755 35.0 35.0 36.0 32.0 37.0 84-85 33.98925 35.0 34.0 36.0 31.5 37.0 86-87 33.80375 35.0 34.0 35.5 31.0 36.5 88-89 33.561875 35.0 34.0 35.0 31.0 36.0 90-91 33.36475 35.0 34.0 35.0 31.0 36.0 92-93 33.117125 35.0 34.0 35.0 30.0 36.0 94-95 32.730374999999995 35.0 34.0 35.0 29.0 35.0 96-97 32.279250000000005 35.0 33.0 35.0 28.0 35.0 98-99 31.74875 35.0 33.0 35.0 25.5 35.0 100 30.686 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 2.0 12 1.0 13 6.0 14 1.0 15 4.0 16 2.0 17 1.0 18 4.0 19 1.0 20 2.0 21 2.0 22 6.0 23 6.0 24 9.0 25 3.0 26 6.0 27 13.0 28 16.0 29 23.0 30 28.0 31 39.0 32 43.0 33 49.0 34 80.0 35 172.0 36 419.0 37 1472.0 38 1569.0 39 19.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.736590279526567 14.908083606144547 17.174515235457065 42.180810878871824 2 18.96896896896897 24.0990990990991 38.93893893893894 17.992992992992992 3 21.375 26.85 27.575 24.2 4 23.425 33.074999999999996 20.45 23.05 5 24.325 34.9 21.775 19.0 6 19.400000000000002 35.975 23.425 21.2 7 16.125 16.775000000000002 44.375 22.725 8 18.85 22.475 28.675 30.0 9 19.525000000000002 23.075000000000003 31.924999999999997 25.474999999999998 10-11 22.537499999999998 33.637499999999996 21.9 21.925 12-13 20.150000000000002 26.2625 30.3875 23.200000000000003 14-15 21.0375 27.762500000000003 27.9125 23.2875 16-17 21.627703462932867 28.19102387798475 27.678459807475935 22.502812851606453 18-19 22.425 27.712500000000002 26.974999999999998 22.8875 20-21 21.7 28.7375 27.287499999999998 22.275 22-23 22.287499999999998 28.825 26.687499999999996 22.2 24-25 20.75 29.275000000000002 27.212500000000002 22.7625 26-27 21.275 28.15 27.750000000000004 22.825 28-29 21.8125 28.599999999999998 26.8375 22.75 30-31 21.725 28.012500000000003 28.1875 22.075 32-33 21.9375 28.212500000000002 28.075 21.775 34-35 22.25 27.8125 27.725 22.2125 36-37 21.26594946209657 27.595696772579437 27.733299974981236 23.405053790342755 38-39 21.2625 28.375 28.037499999999998 22.325 40-41 21.975 27.3 27.8375 22.8875 42-43 21.7375 27.1 28.4 22.7625 44-45 21.85 28.0625 27.800000000000004 22.287499999999998 46-47 22.2 27.725 27.474999999999998 22.6 48-49 21.275 27.787499999999998 28.1 22.8375 50-51 21.637500000000003 28.349999999999998 28.325 21.6875 52-53 22.275 27.437499999999996 28.4125 21.875 54-55 21.89534301452178 27.641462193289932 27.791687531296944 22.67150726089134 56-57 22.275059441872106 27.668627205606306 27.84382430234013 22.212489050181457 58-59 21.8625 28.050000000000004 27.537499999999998 22.55 60-61 22.0 27.987499999999997 27.537499999999998 22.475 62-63 21.825 28.15 27.9375 22.0875 64-65 21.3625 27.675 28.875 22.0875 66-67 21.775 27.1 28.462500000000002 22.662499999999998 68-69 22.0 28.875 27.462500000000002 21.6625 70-71 21.101376720901126 27.62202753441802 28.247809762202753 23.028785982478098 72-73 21.804039643708442 27.888596161083928 28.7040521891858 21.60331200602183 74-75 22.2751787282077 27.756177097704754 26.9660102847109 23.002633889376646 76-77 23.600851383498185 28.17077751345937 27.63240265431326 20.595968448729185 78-79 22.162499999999998 27.037499999999998 28.4125 22.3875 80-81 22.625 27.6625 27.6625 22.05 82-83 22.400000000000002 27.5875 27.650000000000002 22.3625 84-85 21.1625 28.449999999999996 28.199999999999996 22.1875 86-87 21.512500000000003 27.712500000000002 28.349999999999998 22.425 88-89 21.887123013390063 27.40583156050557 27.543486422225005 23.163559003879364 90-91 22.81954887218045 28.358395989974937 27.18045112781955 21.641604010025063 92-93 22.0 28.1125 28.3625 21.525 94-95 22.155463762673676 28.389034923019153 27.17486543997997 22.2806358743272 96-97 22.863221123764234 27.84382430234013 27.543486422225005 21.74946815167063 98-99 22.8125 28.1875 27.237499999999997 21.762500000000003 100 21.45 28.349999999999998 26.450000000000003 23.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 2.5 25 3.5 26 7.0 27 10.0 28 11.0 29 15.0 30 18.5 31 26.0 32 30.0 33 34.0 34 48.0 35 65.0 36 91.0 37 110.5 38 121.5 39 158.0 40 212.0 41 225.5 42 219.5 43 254.0 44 267.0 45 254.5 46 257.0 47 243.0 48 224.0 49 214.0 50 190.5 51 143.5 52 109.0 53 98.0 54 76.0 55 54.5 56 39.0 57 30.5 58 26.5 59 20.0 60 18.0 61 16.0 62 12.0 63 8.0 64 6.0 65 4.0 66 3.5 67 2.5 68 1.0 69 0.0 70 0.0 71 1.5 72 2.5 73 3.0 74 2.5 75 1.0 76 1.0 77 1.0 78 1.5 79 1.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.075 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.15 56-57 0.11249999999999999 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.125 72-73 0.36250000000000004 74-75 0.3375 76-77 0.1625 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.11249999999999999 90-91 0.25 92-93 0.0 94-95 0.13749999999999998 96-97 0.11249999999999999 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686491 spots for SRR1121299.sra Written 686491 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra Read 686475 spots for SRR1121299.sra Written 686475 spots for SRR1121299.sra SRR ids: ['SRR1121299.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qlc62tre SRR1121299.sra spots: 13729516 blocks: [[1, 686475], [686476, 1372950], [1372951, 2059425], [2059426, 2745900], [2745901, 3432375], [3432376, 4118850], [4118851, 4805325], [4805326, 5491800], [5491801, 6178275], [6178276, 6864750], [6864751, 7551225], [7551226, 8237700], [8237701, 8924175], [8924176, 9610650], [9610651, 10297125], [10297126, 10983600], [10983601, 11670075], [11670076, 12356550], [12356551, 13043025], [13043026, 13729516]] SRR1121299 file size 3562234 SRR1121299 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1121299 SRR1121299_1.fastq Input file: SRR1121299_1.fastq trimmed: SRR1121299-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 05:34:41 2025 >> started Wed Feb 12 05:34:50 2025 >> done (9.441s) 13729516 reads processed; of these: 2101 ( 0.02%) short reads filtered out after trimming by size control 7654 ( 0.06%) empty reads filtered out after trimming by size control 13719761 (99.93%) reads available; of these: 2322611 (16.93%) trimmed reads available after processing 11397150 (83.07%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 249 0.00% 19 289 0.00% 20 452 0.00% 21 535 0.00% 22 663 0.00% 23 950 0.01% 24 1254 0.01% 25 1648 0.01% 26 2323 0.02% 27 2356 0.02% 28 1914 0.01% 29 1841 0.01% 30 1751 0.01% 31 1733 0.01% 32 1889 0.01% 33 1788 0.01% 34 1942 0.01% 35 1992 0.01% 36 1959 0.01% 37 2038 0.01% 38 2166 0.02% 39 2164 0.02% 40 2019 0.01% 41 2035 0.01% 42 2188 0.02% 43 2285 0.02% 44 2282 0.02% 45 2365 0.02% 46 2335 0.02% 47 2126 0.02% 48 2345 0.02% 49 2436 0.02% 50 2638 0.02% 51 2813 0.02% 52 2865 0.02% 53 2937 0.02% 54 3105 0.02% 55 3152 0.02% 56 3195 0.02% 57 3356 0.02% 58 3365 0.02% 59 3477 0.03% 60 3507 0.03% 61 3517 0.03% 62 3730 0.03% 63 3753 0.03% 64 3843 0.03% 65 4120 0.03% 66 4261 0.03% 67 4489 0.03% 68 4665 0.03% 69 4567 0.03% 70 4734 0.03% 71 5046 0.04% 72 5233 0.04% 73 5335 0.04% 74 5505 0.04% 75 5351 0.04% 76 4430 0.03% 77 5138 0.04% 78 5921 0.04% 79 6419 0.05% 80 6927 0.05% 81 7446 0.05% 82 8349 0.06% 83 9454 0.07% 84 10427 0.08% 85 11575 0.08% 86 13789 0.10% 87 17332 0.13% 88 25133 0.18% 89 59406 0.43% 90 177759 1.30% 91 109086 0.80% 92 302092 2.20% 93 84709 0.62% 94 200392 1.46% 95 119801 0.87% 96 288408 2.10% 97 146804 1.07% 98 355033 2.59% 99 187910 1.37% 100 11397150 83.07% 13719761 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=41.73 fanout-score-rank=6 prefix-density=0.27 prefix-fanout=29.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=236.25 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=25.6 sequence=CTTCTTCTTCTT Started job on | Feb 12 05:35:13 Started mapping on | Feb 12 05:35:13 Finished on | Feb 12 05:35:28 Mapping speed, Million of reads per hour | 3292.74 Number of input reads | 13719761 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 13093484 Uniquely mapped reads % | 95.44% Average mapped length | 98.20 Number of splices: Total | 3996820 Number of splices: Annotated (sjdb) | 3934435 Number of splices: GT/AG | 3937381 Number of splices: GC/AG | 49191 Number of splices: AT/AC | 3904 Number of splices: Non-canonical | 6344 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 1.88 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297542 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 257522 % of reads mapped to too many loci | 1.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 328735 328735 328735 N_multimapping 297542 297542 297542 N_noFeature 403701 6716931 6706587 N_ambiguous 114142 20126 20496 UnstrandedReadsAssigned:12575641 PositiveStrandReadsAssigned:6356427 NegativeStrandReadsAssigned:6366401 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1121299 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR1121299-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,719,761 reads, 13,044,688 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,238 rounds 52401 SRR1121299.ke.tsv 34699 SRR1121299.se.tsv 87100 total ==> SRR1121299.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 315 16.2344 Potri.005G024800.1.v4.1 1035 936 54 5.70584 Potri.004G059700.1.v4.1 961 862 13 1.49155 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 295.054 10.2606 Potri.016G087400.1.v4.1 270 171 965 558.127 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 54 3.19036 Potri.012G127500.1.v4.1 977 878 5116 576.286 ==> SRR1121299.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1423 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR1121299 completed mapping pipeline successfully