Starting /dee2/code/volunteer_pipeline.sh SRR1121300 current disk space = 3050303660032 free memory = 1579463180 SRR1121300 SRAfilesize 9f0664134fd9776ef362b5d712ef4bdc SRR1121300.sra SRR1121300.sra file validated SRR1121300 is single end SRR1121300 is conventional basespace SRR1121300 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1121300_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.231 34.0 34.0 34.0 31.0 34.0 2 33.414 34.0 34.0 34.0 31.0 34.0 3 33.60275 34.0 34.0 34.0 33.0 34.0 4 36.8315 37.0 37.0 37.0 37.0 37.0 5 36.77975 37.0 37.0 37.0 37.0 37.0 6 36.6885 37.0 37.0 37.0 37.0 37.0 7 36.7135 37.0 37.0 37.0 35.0 37.0 8 36.72675 37.0 37.0 37.0 36.0 37.0 9 38.73275 39.0 39.0 39.0 39.0 39.0 10-11 38.692625 39.0 39.0 39.0 39.0 39.0 12-13 38.692625 39.0 39.0 39.0 38.5 39.0 14-15 39.61925 40.0 40.0 40.0 39.0 40.0 16-17 39.603375 40.0 40.0 40.0 39.0 40.0 18-19 39.58075 40.0 40.0 40.0 39.0 40.0 20-21 39.54174999999999 40.0 40.0 40.0 39.0 40.0 22-23 39.536375 40.0 40.0 40.0 39.0 40.0 24-25 39.497125 40.0 40.0 40.0 39.0 40.0 26-27 39.3765 40.0 40.0 40.0 38.0 40.0 28-29 39.3275 40.0 40.0 40.0 38.0 40.0 30-31 39.2655 40.0 40.0 40.0 38.0 40.0 32-33 39.194 40.0 40.0 40.0 38.0 40.0 34-35 39.083124999999995 40.0 40.0 40.0 37.5 40.0 36-37 38.9235 40.0 39.5 40.0 37.0 40.0 38-39 38.923625 40.0 40.0 40.0 37.0 40.0 40-41 38.97475 40.0 40.0 40.0 37.0 40.0 42-43 38.928875000000005 40.0 40.0 40.0 37.0 40.0 44-45 38.82925 40.0 39.0 40.0 37.0 40.0 46-47 38.8825 40.0 39.5 40.0 37.0 40.0 48-49 38.966125000000005 40.0 40.0 40.0 37.0 40.0 50-51 38.926625 40.0 40.0 40.0 37.0 40.0 52-53 38.817625 40.0 39.0 40.0 36.5 40.0 54-55 38.632375 40.0 39.0 40.0 36.0 40.0 56-57 38.45675 40.0 39.0 40.0 35.0 40.0 58-59 38.29725 40.0 38.5 40.0 35.0 40.0 60-61 38.150000000000006 40.0 38.0 40.0 35.0 40.0 62-63 37.89275 40.0 37.0 40.0 35.0 40.0 64-65 37.643874999999994 39.5 37.0 40.0 34.5 40.0 66-67 37.342375000000004 39.0 36.0 40.0 34.0 40.0 68-69 36.9155 38.5 35.5 40.0 34.0 40.0 70-71 36.476749999999996 37.0 35.0 39.5 33.5 40.0 72-73 35.87625 37.0 35.0 39.0 33.0 40.0 74-75 35.494 36.0 35.0 39.0 32.5 40.0 76-77 34.790375 35.5 34.5 37.0 31.5 39.0 78-79 34.815375 35.5 35.0 37.0 32.0 39.0 80-81 34.634375 35.0 35.0 37.0 32.0 38.0 82-83 34.30625 35.0 35.0 36.0 32.0 37.0 84-85 33.95075 35.0 34.0 36.0 31.0 37.0 86-87 33.72325 35.0 34.0 35.5 31.0 36.5 88-89 33.384249999999994 35.0 34.0 35.0 30.5 36.0 90-91 33.165875 35.0 34.0 35.0 31.0 36.0 92-93 32.845625 35.0 34.0 35.0 29.5 36.0 94-95 32.566125 35.0 34.0 35.0 29.0 35.0 96-97 32.12587499999999 35.0 33.0 35.0 27.0 35.0 98-99 31.82225 35.0 33.0 35.0 27.0 35.0 100 30.7515 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 1.0 13 1.0 14 5.0 15 3.0 16 2.0 17 1.0 18 3.0 19 6.0 20 4.0 21 2.0 22 3.0 23 5.0 24 12.0 25 10.0 26 8.0 27 18.0 28 15.0 29 24.0 30 17.0 31 30.0 32 37.0 33 75.0 34 90.0 35 173.0 36 419.0 37 1508.0 38 1509.0 39 17.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.543203638201113 14.199090449722082 16.447700859019708 43.8100050530571 2 20.57057057057057 23.0980980980981 35.56056056056056 20.77077077077077 3 21.349999999999998 28.799999999999997 26.150000000000002 23.7 4 25.75 32.074999999999996 19.900000000000002 22.275 5 24.05 35.125 21.925 18.9 6 17.424999999999997 36.325 25.75 20.5 7 16.55 16.7 44.25 22.5 8 19.400000000000002 21.75 29.125 29.725 9 20.1 22.775000000000002 31.4 25.724999999999998 10-11 22.112499999999997 32.85 22.237499999999997 22.8 12-13 20.2625 26.075 29.562500000000004 24.099999999999998 14-15 21.3125 27.187499999999996 28.050000000000004 23.45 16-17 22.275 27.6875 28.6125 21.425 18-19 23.0375 26.674999999999997 27.525 22.7625 20-21 21.3875 28.775000000000002 26.55 23.2875 22-23 21.837500000000002 29.1875 26.8625 22.112499999999997 24-25 22.6875 28.787499999999998 25.874999999999996 22.650000000000002 26-27 22.037499999999998 28.325 27.1 22.537499999999998 28-29 21.675 28.375 27.175 22.775000000000002 30-31 21.875 27.425 27.737499999999997 22.9625 32-33 21.4 27.950000000000003 28.3625 22.287499999999998 34-35 22.3 28.3625 27.1125 22.225 36-37 21.874608935051935 27.956451007383304 27.806282067325743 22.36265799023902 38-39 21.95 27.437499999999996 27.187499999999996 23.425 40-41 22.25 28.1875 27.537499999999998 22.025 42-43 21.8625 27.575 26.974999999999998 23.5875 44-45 21.4125 27.900000000000002 28.1 22.5875 46-47 21.6125 28.787499999999998 26.437500000000004 23.1625 48-49 21.712500000000002 27.500000000000004 28.012500000000003 22.775000000000002 50-51 21.7375 28.037499999999998 27.55 22.675 52-53 22.075 28.275 27.8875 21.762500000000003 54-55 22.202731487282296 27.816063149981208 27.00162886856284 22.979576494173664 56-57 22.16933867735471 27.843186372745492 27.59268537074148 22.394789579158317 58-59 22.9375 27.85 27.325 21.8875 60-61 21.625 27.6875 28.287499999999998 22.400000000000002 62-63 21.4 28.475 27.9125 22.2125 64-65 22.725 28.075 26.35 22.85 66-67 21.7375 27.9125 28.1625 22.1875 68-69 21.987499999999997 27.5875 27.725 22.7 70-71 21.8562124248497 28.45691382765531 27.530060120240478 22.15681362725451 72-73 22.107645875251507 27.175553319919516 28.055835010060363 22.66096579476861 74-75 22.778126964173477 26.964173475801385 28.560653676932745 21.697045883092393 76-77 22.724993732765103 28.03960892454249 26.92404111306092 22.31135622963149 78-79 22.162499999999998 28.262500000000003 27.5875 21.987499999999997 80-81 22.0 27.5625 28.125 22.3125 82-83 22.525000000000002 27.487499999999997 28.000000000000004 21.987499999999997 84-85 23.0875 27.474999999999998 28.050000000000004 21.3875 86-87 22.275 27.537499999999998 27.925 22.2625 88-89 23.208917835671343 27.930861723446892 28.0811623246493 20.779058116232466 90-91 22.602911646586346 28.11244979919679 27.158634538152608 22.126004016064257 92-93 22.162499999999998 28.012500000000003 27.250000000000004 22.575 94-95 22.50751503006012 27.81813627254509 27.14178356713427 22.532565130260522 96-97 21.968937875751504 27.56763527054108 27.81813627254509 22.645290581162325 98-99 22.1375 28.925 28.025 20.9125 100 22.55 27.375 27.450000000000003 22.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 2.5 27 5.5 28 7.5 29 11.0 30 18.5 31 25.5 32 31.5 33 35.5 34 47.0 35 71.0 36 83.5 37 107.0 38 129.0 39 141.5 40 169.5 41 210.5 42 229.5 43 258.5 44 272.0 45 271.0 46 277.0 47 262.5 48 234.0 49 185.0 50 171.0 51 154.0 52 130.5 53 106.0 54 77.0 55 60.0 56 39.0 57 30.0 58 27.5 59 21.5 60 19.5 61 13.0 62 11.0 63 11.5 64 6.0 65 5.5 66 6.0 67 2.5 68 3.5 69 4.0 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 1.0 76 1.5 77 1.5 78 1.5 79 0.5 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.11249999999999999 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.2375 56-57 0.2 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.2 72-73 0.6 74-75 0.5625 76-77 0.27499999999999997 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.2 90-91 0.4 92-93 0.0 94-95 0.2 96-97 0.2 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0125 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742823 spots for SRR1121300.sra Written 742823 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra Read 742822 spots for SRR1121300.sra Written 742822 spots for SRR1121300.sra SRR ids: ['SRR1121300.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_28ty9wpt SRR1121300.sra spots: 14856441 blocks: [[1, 742822], [742823, 1485644], [1485645, 2228466], [2228467, 2971288], [2971289, 3714110], [3714111, 4456932], [4456933, 5199754], [5199755, 5942576], [5942577, 6685398], [6685399, 7428220], [7428221, 8171042], [8171043, 8913864], [8913865, 9656686], [9656687, 10399508], [10399509, 11142330], [11142331, 11885152], [11885153, 12627974], [12627975, 13370796], [13370797, 14113618], [14113619, 14856441]] SRR1121300 file size 3855438 SRR1121300 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1121300 SRR1121300_1.fastq Input file: SRR1121300_1.fastq trimmed: SRR1121300-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 06:03:13 2025 >> started Wed Feb 12 06:03:23 2025 >> done (9.809s) 14856441 reads processed; of these: 2102 ( 0.01%) short reads filtered out after trimming by size control 5648 ( 0.04%) empty reads filtered out after trimming by size control 14848691 (99.95%) reads available; of these: 2330718 (15.70%) trimmed reads available after processing 12517973 (84.30%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 301 0.00% 19 352 0.00% 20 389 0.00% 21 562 0.00% 22 752 0.01% 23 1043 0.01% 24 1351 0.01% 25 1873 0.01% 26 2392 0.02% 27 2417 0.02% 28 1982 0.01% 29 1939 0.01% 30 1940 0.01% 31 1872 0.01% 32 1983 0.01% 33 1940 0.01% 34 2112 0.01% 35 2081 0.01% 36 2159 0.01% 37 2188 0.01% 38 2264 0.02% 39 2271 0.02% 40 2236 0.02% 41 2190 0.01% 42 2477 0.02% 43 2425 0.02% 44 2377 0.02% 45 2551 0.02% 46 2538 0.02% 47 2418 0.02% 48 2512 0.02% 49 2530 0.02% 50 2646 0.02% 51 2955 0.02% 52 3069 0.02% 53 3126 0.02% 54 3229 0.02% 55 3185 0.02% 56 3325 0.02% 57 3592 0.02% 58 3608 0.02% 59 3667 0.02% 60 3996 0.03% 61 3908 0.03% 62 4080 0.03% 63 4010 0.03% 64 4066 0.03% 65 4214 0.03% 66 4511 0.03% 67 4596 0.03% 68 4816 0.03% 69 4826 0.03% 70 5036 0.03% 71 5241 0.04% 72 5522 0.04% 73 5781 0.04% 74 5817 0.04% 75 5609 0.04% 76 4751 0.03% 77 5409 0.04% 78 6248 0.04% 79 6832 0.05% 80 7083 0.05% 81 8037 0.05% 82 8796 0.06% 83 9787 0.07% 84 10858 0.07% 85 12317 0.08% 86 14165 0.10% 87 17829 0.12% 88 25518 0.17% 89 59110 0.40% 90 165674 1.12% 91 110031 0.74% 92 309400 2.08% 93 90111 0.61% 94 214681 1.45% 95 119654 0.81% 96 277517 1.87% 97 144906 0.98% 98 332684 2.24% 99 200472 1.35% 100 12517973 84.30% 14848691 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=28.12 fanout-score-rank=5 prefix-density=0.19 prefix-fanout=22.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACA criterion=fanout-score sequence-density=0.05 sequence-density-rank=11 fanout-score=95.74 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=14.5 sequence=CCACCACCAACA Started job on | Feb 12 06:03:48 Started mapping on | Feb 12 06:03:48 Finished on | Feb 12 06:04:04 Mapping speed, Million of reads per hour | 3340.96 Number of input reads | 14848691 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 14007859 Uniquely mapped reads % | 94.34% Average mapped length | 98.31 Number of splices: Total | 4313180 Number of splices: Annotated (sjdb) | 4250881 Number of splices: GT/AG | 4249724 Number of splices: GC/AG | 53038 Number of splices: AT/AC | 4232 Number of splices: Non-canonical | 6186 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 1.92 Insertion rate per base | 0.01% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331074 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 439649 % of reads mapped to too many loci | 2.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 509758 509758 509758 N_multimapping 331074 331074 331074 N_noFeature 374583 7144076 7164716 N_ambiguous 115362 20814 21036 UnstrandedReadsAssigned:13517914 PositiveStrandReadsAssigned:6842969 NegativeStrandReadsAssigned:6822107 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1121300 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR1121300-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,848,691 reads, 14,166,335 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR1121300.ke.tsv 34699 SRR1121300.se.tsv 87100 total ==> SRR1121300.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 337 15.9553 Potri.005G024800.1.v4.1 1035 936 90 8.73606 Potri.004G059700.1.v4.1 961 862 11 1.1594 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 312 9.96722 Potri.016G087400.1.v4.1 270 171 1016.5 540.083 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 58 3.1479 Potri.012G127500.1.v4.1 977 878 5172 535.196 ==> SRR1121300.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1457 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR1121300 completed mapping pipeline successfully