Starting /dee2/code/volunteer_pipeline.sh SRR1121301 current disk space = 3049928142848 free memory = 1301703828 SRR1121301 SRAfilesize 209ed800ca955f28ab0f882fc83608ae SRR1121301.sra SRR1121301.sra file validated SRR1121301 is single end SRR1121301 is conventional basespace SRR1121301 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1121301_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.30875 34.0 34.0 34.0 31.0 34.0 2 33.5005 34.0 34.0 34.0 33.0 34.0 3 33.6455 34.0 34.0 34.0 33.0 34.0 4 36.80275 37.0 37.0 37.0 37.0 37.0 5 36.7565 37.0 37.0 37.0 37.0 37.0 6 36.78875 37.0 37.0 37.0 37.0 37.0 7 36.74025 37.0 37.0 37.0 37.0 37.0 8 36.6925 37.0 37.0 37.0 36.0 37.0 9 38.63525 39.0 39.0 39.0 38.0 39.0 10-11 38.713750000000005 39.0 39.0 39.0 39.0 39.0 12-13 38.60575 39.0 39.0 39.0 38.0 39.0 14-15 39.634625 40.0 40.0 40.0 39.0 40.0 16-17 39.632625000000004 40.0 40.0 40.0 39.0 40.0 18-19 39.597125 40.0 40.0 40.0 39.0 40.0 20-21 39.57875 40.0 40.0 40.0 39.0 40.0 22-23 39.531125 40.0 40.0 40.0 39.0 40.0 24-25 39.461625 40.0 40.0 40.0 39.0 40.0 26-27 39.39925 40.0 40.0 40.0 38.0 40.0 28-29 39.3885 40.0 40.0 40.0 38.0 40.0 30-31 39.26375 40.0 40.0 40.0 38.0 40.0 32-33 39.166 40.0 40.0 40.0 38.0 40.0 34-35 39.057249999999996 40.0 40.0 40.0 38.0 40.0 36-37 38.95425 40.0 40.0 40.0 37.5 40.0 38-39 38.87125 40.0 40.0 40.0 37.0 40.0 40-41 38.953375 40.0 40.0 40.0 37.0 40.0 42-43 38.8735 40.0 39.5 40.0 37.0 40.0 44-45 38.791 40.0 39.5 40.0 37.0 40.0 46-47 38.736375 40.0 39.5 40.0 36.5 40.0 48-49 38.846999999999994 40.0 40.0 40.0 37.0 40.0 50-51 38.759375000000006 40.0 39.5 40.0 36.0 40.0 52-53 38.644 40.0 39.0 40.0 35.5 40.0 54-55 38.576375 40.0 39.0 40.0 35.0 40.0 56-57 38.4325 40.0 39.0 40.0 35.0 40.0 58-59 38.16775 40.0 38.0 40.0 35.0 40.0 60-61 37.975875 40.0 37.0 40.0 35.0 40.0 62-63 37.604625 40.0 37.0 40.0 34.5 40.0 64-65 37.438125 39.0 36.0 40.0 34.5 40.0 66-67 37.116749999999996 39.0 35.5 40.0 34.0 40.0 68-69 36.765 38.5 35.0 40.0 34.0 40.0 70-71 36.442 37.0 35.0 39.5 34.0 40.0 72-73 36.076499999999996 37.0 35.0 39.0 33.5 40.0 74-75 35.608625 36.0 35.0 39.0 33.0 40.0 76-77 34.85875 35.0 34.0 37.0 31.5 39.0 78-79 34.948499999999996 35.0 35.0 37.0 33.0 39.0 80-81 34.627125 35.0 35.0 36.5 33.0 38.0 82-83 34.32025 35.0 35.0 36.0 32.0 37.0 84-85 34.02575 35.0 35.0 36.0 32.0 37.0 86-87 33.7585 35.0 35.0 35.5 31.0 36.0 88-89 33.614000000000004 35.0 34.0 35.0 31.5 36.0 90-91 33.431375 35.0 34.0 35.0 31.5 36.0 92-93 32.91325 35.0 34.0 35.0 30.0 36.0 94-95 32.07775 35.0 33.0 35.0 27.0 35.0 96-97 31.826375 35.0 33.0 35.0 26.0 35.0 98-99 30.855874999999997 34.5 32.0 35.0 20.5 35.0 100 30.25475 34.0 31.0 35.0 4.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 2.0 11 6.0 12 2.0 13 2.0 14 6.0 15 0.0 16 5.0 17 3.0 18 4.0 19 2.0 20 3.0 21 6.0 22 5.0 23 7.0 24 2.0 25 10.0 26 10.0 27 11.0 28 16.0 29 12.0 30 20.0 31 30.0 32 47.0 33 70.0 34 89.0 35 171.0 36 469.0 37 1511.0 38 1460.0 39 18.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.416918429003022 14.904330312185296 15.609264853977844 42.06948640483384 2 20.17017017017017 22.94794794794795 37.012012012012015 19.86986986986987 3 22.825 27.1 26.8 23.275000000000002 4 23.525 34.1 19.125 23.25 5 25.374999999999996 34.525 21.65 18.45 6 18.775 36.125 25.0 20.1 7 18.325 16.775000000000002 43.55 21.349999999999998 8 20.8 22.05 27.55 29.599999999999998 9 19.725 23.95 30.4 25.924999999999997 10-11 22.9875 33.6875 21.05 22.275 12-13 21.2375 25.5625 29.912499999999998 23.2875 14-15 22.6 26.25 28.249999999999996 22.900000000000002 16-17 22.345879704889335 27.84794297861698 26.997624109040892 22.808553207452796 18-19 22.95 27.650000000000002 26.924999999999997 22.475 20-21 22.1 27.800000000000004 27.625 22.475 22-23 23.1875 27.3375 27.3125 22.162499999999998 24-25 22.4625 28.199999999999996 27.075 22.2625 26-27 23.0625 27.737499999999997 26.637499999999996 22.5625 28-29 22.45 28.15 27.4125 21.987499999999997 30-31 22.225 27.3875 27.474999999999998 22.912499999999998 32-33 21.8 27.3875 28.012500000000003 22.8 34-35 22.375 28.15 26.85 22.625 36-37 22.041531148361273 27.60820615461596 28.04603452589442 22.304228171128347 38-39 22.777847230903863 27.665958244780597 27.15339417427178 22.402800350043755 40-41 22.3875 28.0625 26.4125 23.1375 42-43 22.125 28.012500000000003 26.987499999999997 22.875 44-45 22.0125 28.275 27.725 21.987499999999997 46-47 22.237499999999997 27.712500000000002 27.4125 22.6375 48-49 21.975 27.4125 27.0 23.6125 50-51 22.575 27.8125 26.974999999999998 22.6375 52-53 22.375 27.750000000000004 26.9125 22.9625 54-55 22.792094070552913 27.483112334250688 27.383037277958465 22.34175631723793 56-57 21.841381035776834 27.933450087565674 27.08281210908181 23.14235676757568 58-59 21.990248781097637 29.32866608326041 27.403425428178522 21.277659707463435 60-61 22.9875 28.175 27.3875 21.45 62-63 22.7 27.775 26.700000000000003 22.825 64-65 22.7 27.55 27.400000000000002 22.35 66-67 22.4625 27.450000000000003 26.937499999999996 23.150000000000002 68-69 22.3375 27.6125 27.3875 22.662499999999998 70-71 22.080520130032507 27.59439859964991 26.819204801200303 23.50587646911728 72-73 21.880470117529384 27.544386096524132 27.53188297074269 23.0432608152038 74-75 21.280320080020005 26.694173543385848 27.981995498874717 24.043510877719427 76-77 21.735867933966986 27.726363181590795 27.40120060030015 23.13656828414207 78-79 21.66791697924481 27.60690172543136 27.969492373093274 22.755688922230558 80-81 21.85 28.1 28.012500000000003 22.037499999999998 82-83 22.1 27.8125 27.3375 22.75 84-85 23.05 26.9625 26.437500000000004 23.549999999999997 86-87 22.25 28.3125 27.650000000000002 21.7875 88-89 22.7903487935992 28.128516064508062 27.103387923490434 21.9777472184023 90-91 21.94145609206905 27.307980985739306 28.283712784588445 22.466850137603203 92-93 22.671001625609605 27.135175690884083 27.38526947605352 22.808553207452796 94-95 22.761380690345174 27.276138069034516 27.688844422211105 22.273636818409205 96-97 23.3183295823956 27.981995498874717 26.644161040260066 22.05551387846962 98-99 22.912499999999998 27.787499999999998 27.275 22.025 100 22.925 27.250000000000004 26.775 23.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 3.0 26 2.5 27 6.0 28 11.0 29 12.0 30 14.5 31 23.5 32 32.0 33 39.0 34 56.0 35 61.5 36 67.5 37 91.5 38 120.5 39 157.0 40 203.0 41 207.5 42 213.5 43 258.0 44 250.0 45 250.5 46 260.0 47 240.0 48 221.5 49 200.5 50 166.5 51 129.0 52 123.5 53 113.0 54 90.5 55 69.5 56 50.5 57 39.0 58 28.0 59 25.0 60 23.0 61 17.0 62 16.0 63 15.5 64 13.5 65 8.5 66 5.5 67 6.0 68 5.0 69 5.5 70 9.5 71 8.0 72 3.5 73 4.5 74 4.5 75 5.0 76 4.5 77 2.5 78 2.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0375 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.075 38-39 0.0125 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.075 56-57 0.075 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.025 72-73 0.025 74-75 0.025 76-77 0.05 78-79 0.025 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.075 92-93 0.0375 94-95 0.05 96-97 0.025 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601524 spots for SRR1121301.sra Written 601524 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra Read 601522 spots for SRR1121301.sra Written 601522 spots for SRR1121301.sra SRR ids: ['SRR1121301.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cwrpdrip SRR1121301.sra spots: 12030442 blocks: [[1, 601522], [601523, 1203044], [1203045, 1804566], [1804567, 2406088], [2406089, 3007610], [3007611, 3609132], [3609133, 4210654], [4210655, 4812176], [4812177, 5413698], [5413699, 6015220], [6015221, 6616742], [6616743, 7218264], [7218265, 7819786], [7819787, 8421308], [8421309, 9022830], [9022831, 9624352], [9624353, 10225874], [10225875, 10827396], [10827397, 11428918], [11428919, 12030442]] SRR1121301 file size 3120030 SRR1121301 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1121301 SRR1121301_1.fastq Input file: SRR1121301_1.fastq trimmed: SRR1121301-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 05:55:09 2025 >> started Wed Feb 12 05:55:15 2025 >> done (6.275s) 12030442 reads processed; of these: 1406 ( 0.01%) short reads filtered out after trimming by size control 6082 ( 0.05%) empty reads filtered out after trimming by size control 12022954 (99.94%) reads available; of these: 3493341 (29.06%) trimmed reads available after processing 8529613 (70.94%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 182 0.00% 19 243 0.00% 20 303 0.00% 21 371 0.00% 22 538 0.00% 23 764 0.01% 24 1011 0.01% 25 1333 0.01% 26 1415 0.01% 27 1358 0.01% 28 1347 0.01% 29 1473 0.01% 30 1539 0.01% 31 1503 0.01% 32 1572 0.01% 33 1533 0.01% 34 1727 0.01% 35 1712 0.01% 36 1787 0.01% 37 1842 0.02% 38 1892 0.02% 39 1809 0.02% 40 1875 0.02% 41 1874 0.02% 42 2039 0.02% 43 2044 0.02% 44 1844 0.02% 45 1932 0.02% 46 1930 0.02% 47 1856 0.02% 48 2018 0.02% 49 2024 0.02% 50 2139 0.02% 51 2300 0.02% 52 2295 0.02% 53 2417 0.02% 54 2482 0.02% 55 2501 0.02% 56 2705 0.02% 57 2817 0.02% 58 2977 0.02% 59 2963 0.02% 60 3362 0.03% 61 3136 0.03% 62 3379 0.03% 63 3261 0.03% 64 3243 0.03% 65 3539 0.03% 66 3641 0.03% 67 3937 0.03% 68 3977 0.03% 69 3874 0.03% 70 4180 0.03% 71 4109 0.03% 72 4514 0.04% 73 4703 0.04% 74 4701 0.04% 75 4750 0.04% 76 3757 0.03% 77 4390 0.04% 78 5289 0.04% 79 5569 0.05% 80 5933 0.05% 81 6351 0.05% 82 7523 0.06% 83 8336 0.07% 84 9394 0.08% 85 11237 0.09% 86 13156 0.11% 87 18230 0.15% 88 27582 0.23% 89 105123 0.87% 90 623383 5.18% 91 121689 1.01% 92 578029 4.81% 93 113768 0.95% 94 578398 4.81% 95 153416 1.28% 96 532617 4.43% 97 90039 0.75% 98 214650 1.79% 99 120890 1.01% 100 8529613 70.94% 12022954 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=34 prefix-density=0.16 prefix-fanout=1.9 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=45.01 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.7 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC Started job on | Feb 12 05:55:34 Started mapping on | Feb 12 05:55:34 Finished on | Feb 12 05:55:52 Mapping speed, Million of reads per hour | 2404.59 Number of input reads | 12022954 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 10507298 Uniquely mapped reads % | 87.39% Average mapped length | 97.30 Number of splices: Total | 3062406 Number of splices: Annotated (sjdb) | 3014776 Number of splices: GT/AG | 3016982 Number of splices: GC/AG | 37471 Number of splices: AT/AC | 3084 Number of splices: Non-canonical | 4869 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 1.93 Insertion rate per base | 0.01% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283917 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 1158003 % of reads mapped to too many loci | 9.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.57% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1231739 1231739 1231739 N_multimapping 283917 283917 283917 N_noFeature 351365 5390073 5408055 N_ambiguous 93446 16292 16748 UnstrandedReadsAssigned:10062487 PositiveStrandReadsAssigned:5100933 NegativeStrandReadsAssigned:5082495 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1121301 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR1121301-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,022,954 reads, 11,304,938 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR1121301.ke.tsv 34699 SRR1121301.se.tsv 87100 total ==> SRR1121301.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 264 15.7748 Potri.005G024800.1.v4.1 1035 936 45 5.51279 Potri.004G059700.1.v4.1 961 862 10 1.33023 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 206.387 8.32122 Potri.016G087400.1.v4.1 270 171 744 498.898 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 36 2.46593 Potri.012G127500.1.v4.1 977 878 3343 436.593 ==> SRR1121301.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1116 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 218 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR1121301 completed mapping pipeline successfully