Starting /dee2/code/volunteer_pipeline.sh SRR1121302 current disk space = 3049683910656 free memory = 1578839052 SRR1121302 SRAfilesize ac46413989856ba552d7da1c5c33381a SRR1121302.sra SRR1121302.sra file validated SRR1121302 is single end SRR1121302 is conventional basespace SRR1121302 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1121302_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.016 34.0 33.0 34.0 31.0 34.0 2 33.28175 34.0 34.0 34.0 31.0 34.0 3 33.557 34.0 34.0 34.0 33.0 34.0 4 36.75825 37.0 37.0 37.0 37.0 37.0 5 36.70125 37.0 37.0 37.0 35.0 37.0 6 36.73925 37.0 37.0 37.0 37.0 37.0 7 36.75525 37.0 37.0 37.0 37.0 37.0 8 36.69325 37.0 37.0 37.0 36.0 37.0 9 38.58 39.0 39.0 39.0 38.0 39.0 10-11 38.67275 39.0 39.0 39.0 39.0 39.0 12-13 38.57925 39.0 39.0 39.0 38.0 39.0 14-15 39.589375000000004 40.0 40.0 40.0 39.0 40.0 16-17 39.634 40.0 40.0 40.0 39.0 40.0 18-19 39.573125000000005 40.0 40.0 40.0 39.0 40.0 20-21 39.56425 40.0 40.0 40.0 39.0 40.0 22-23 39.535 40.0 40.0 40.0 39.0 40.0 24-25 39.509375000000006 40.0 40.0 40.0 39.0 40.0 26-27 39.459875 40.0 40.0 40.0 38.5 40.0 28-29 39.418375 40.0 40.0 40.0 38.0 40.0 30-31 39.298500000000004 40.0 40.0 40.0 38.0 40.0 32-33 39.2195 40.0 40.0 40.0 38.0 40.0 34-35 39.106875 40.0 40.0 40.0 38.0 40.0 36-37 39.090125 40.0 40.0 40.0 38.0 40.0 38-39 38.980875 40.0 40.0 40.0 37.0 40.0 40-41 39.061625 40.0 40.0 40.0 38.0 40.0 42-43 39.006625 40.0 40.0 40.0 37.0 40.0 44-45 38.955375 40.0 40.0 40.0 37.0 40.0 46-47 38.93625 40.0 40.0 40.0 37.0 40.0 48-49 39.05437499999999 40.0 40.0 40.0 37.0 40.0 50-51 38.996750000000006 40.0 40.0 40.0 37.0 40.0 52-53 38.928625 40.0 40.0 40.0 37.0 40.0 54-55 38.86775 40.0 40.0 40.0 37.0 40.0 56-57 38.752375 40.0 39.0 40.0 36.0 40.0 58-59 38.505125 40.0 39.0 40.0 35.0 40.0 60-61 38.341 40.0 38.5 40.0 35.0 40.0 62-63 37.99425 40.0 37.0 40.0 35.0 40.0 64-65 37.78275 39.5 37.0 40.0 35.0 40.0 66-67 37.589375000000004 39.0 36.0 40.0 35.0 40.0 68-69 37.174375 39.0 36.0 40.0 34.5 40.0 70-71 36.810500000000005 37.5 35.0 40.0 34.0 40.0 72-73 36.334 37.0 35.0 39.0 34.0 40.0 74-75 35.915 36.5 35.0 39.0 33.5 40.0 76-77 35.180499999999995 36.0 34.5 37.0 32.5 39.0 78-79 35.204750000000004 35.5 35.0 37.0 33.0 39.0 80-81 34.753125 35.0 35.0 37.0 32.5 38.5 82-83 34.487750000000005 35.0 35.0 36.0 32.5 37.0 84-85 34.182875 35.0 35.0 36.0 32.0 37.0 86-87 33.91275 35.0 35.0 35.5 32.0 36.5 88-89 33.810249999999996 35.0 35.0 35.0 32.0 36.0 90-91 33.60325 35.0 34.0 35.0 31.5 36.0 92-93 33.08875 35.0 34.0 35.0 30.0 36.0 94-95 32.122375 35.0 33.5 35.0 27.0 35.0 96-97 31.644 35.0 33.0 35.0 25.5 35.0 98-99 30.357374999999998 34.5 31.5 35.0 13.5 35.0 100 29.62825 34.0 30.0 35.0 4.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 1.0 13 3.0 14 1.0 15 3.0 16 0.0 17 6.0 18 2.0 19 3.0 20 6.0 21 2.0 22 5.0 23 6.0 24 7.0 25 9.0 26 8.0 27 8.0 28 15.0 29 14.0 30 22.0 31 27.0 32 32.0 33 60.0 34 86.0 35 184.0 36 455.0 37 1524.0 38 1489.0 39 20.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.445997458703943 13.443456162642947 18.017789072426936 41.092757306226176 2 19.849812265331664 23.229036295369212 36.67083854818523 20.250312891113893 3 21.525 27.35 27.400000000000002 23.724999999999998 4 23.150000000000002 32.65 20.45 23.75 5 24.5 35.3 21.75 18.45 6 18.6 38.175 23.075000000000003 20.150000000000002 7 17.474999999999998 16.75 45.2 20.575 8 19.575 23.275000000000002 27.525 29.625 9 19.05 22.75 31.65 26.55 10-11 22.7375 33.45 21.625 22.1875 12-13 20.7875 26.1 30.1375 22.975 14-15 21.425 27.125 28.325 23.125 16-17 21.43035758939735 28.469617404351087 27.93198299574894 22.168042010502624 18-19 22.0125 27.575 28.000000000000004 22.412499999999998 20-21 22.412499999999998 27.6375 27.35 22.6 22-23 22.0125 28.425 27.375 22.1875 24-25 20.9375 28.775000000000002 27.212500000000002 23.075000000000003 26-27 21.95 28.975 26.575 22.5 28-29 21.95 28.262500000000003 27.425 22.3625 30-31 21.5625 26.5625 28.3125 23.5625 32-33 21.7375 28.749999999999996 28.037499999999998 21.475 34-35 22.7125 27.2625 27.537499999999998 22.4875 36-37 21.182943603851445 29.01087907965487 27.060147555333252 22.746029761160436 38-39 22.275 28.8625 26.200000000000003 22.662499999999998 40-41 22.6875 29.1375 26.700000000000003 21.475 42-43 21.7 27.5625 27.987499999999997 22.75 44-45 21.4125 28.1625 28.225 22.2 46-47 22.05 28.5625 27.5875 21.8 48-49 22.0625 28.375 27.700000000000003 21.8625 50-51 21.975 28.537499999999998 27.3375 22.15 52-53 22.3875 28.3875 27.625 21.6 54-55 21.660830415207606 26.788394197098548 28.289144572286144 23.261630815407706 56-57 21.92346173086543 27.56378189094547 27.71385692846423 22.798899449724864 58-59 21.465183147893487 27.87848481060132 28.57857232154019 22.077759719964995 60-61 21.925 26.75 28.7375 22.5875 62-63 21.9375 27.9375 28.050000000000004 22.075 64-65 22.35 27.787499999999998 28.037499999999998 21.825 66-67 21.6875 27.925 28.075 22.3125 68-69 21.9 27.8625 28.225 22.0125 70-71 22.277784723090384 28.291036379547442 26.92836604575572 22.502812851606453 72-73 22.815351918989872 27.065883235404424 28.366045755719465 21.752719089886234 74-75 21.349999999999998 28.449999999999996 27.950000000000003 22.25 76-77 21.9679919979995 27.819454863715933 28.00700175043761 22.20555138784696 78-79 21.802725340667585 27.090886360795096 28.27853481685211 22.82785348168521 80-81 21.912499999999998 28.1125 27.9375 22.037499999999998 82-83 22.3875 28.299999999999997 27.187499999999996 22.125 84-85 21.087500000000002 26.887499999999996 29.299999999999997 22.725 86-87 22.787499999999998 27.6625 26.937499999999996 22.6125 88-89 21.925 28.3125 27.85 21.912499999999998 90-91 22.298649324662332 27.388694347173587 27.888944472236116 22.423711855927962 92-93 22.365295661957745 27.353419177397175 28.366045755719465 21.915239404925615 94-95 23.1807951987997 27.306826706676667 28.019504876219052 21.492873218304574 96-97 22.14026753344168 27.403425428178522 28.27853481685211 22.177772221527693 98-99 22.475 27.237499999999997 29.0875 21.2 100 22.5 26.8 27.975 22.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 2.5 27 3.5 28 6.0 29 9.5 30 16.5 31 30.5 32 37.5 33 42.0 34 46.5 35 57.5 36 76.0 37 103.5 38 125.5 39 156.5 40 185.5 41 210.5 42 247.5 43 256.5 44 272.0 45 274.0 46 266.5 47 257.5 48 229.5 49 210.5 50 187.5 51 149.5 52 121.0 53 102.0 54 82.0 55 59.0 56 34.5 57 30.5 58 30.0 59 19.0 60 13.0 61 11.5 62 8.0 63 6.0 64 4.5 65 4.0 66 3.5 67 3.0 68 1.5 69 0.0 70 0.0 71 1.0 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.025 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0375 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.05 56-57 0.05 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0125 74-75 0.0 76-77 0.025 78-79 0.0125 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.05 92-93 0.0125 94-95 0.025 96-97 0.0125 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275325 spots for SRR1121302.sra Written 1275325 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra Read 1275310 spots for SRR1121302.sra Written 1275310 spots for SRR1121302.sra SRR ids: ['SRR1121302.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c5cclmc8 SRR1121302.sra spots: 25506215 blocks: [[1, 1275310], [1275311, 2550620], [2550621, 3825930], [3825931, 5101240], [5101241, 6376550], [6376551, 7651860], [7651861, 8927170], [8927171, 10202480], [10202481, 11477790], [11477791, 12753100], [12753101, 14028410], [14028411, 15303720], [15303721, 16579030], [16579031, 17854340], [17854341, 19129650], [19129651, 20404960], [20404961, 21680270], [21680271, 22955580], [22955581, 24230890], [24230891, 25506215]] SRR1121302 file size 6627033 SRR1121302 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1121302 SRR1121302_1.fastq Input file: SRR1121302_1.fastq trimmed: SRR1121302-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 05:48:08 2025 >> started Wed Feb 12 05:48:21 2025 >> done (13.344s) 25506215 reads processed; of these: 5702 ( 0.02%) short reads filtered out after trimming by size control 37232 ( 0.15%) empty reads filtered out after trimming by size control 25463281 (99.83%) reads available; of these: 7258238 (28.50%) trimmed reads available after processing 18205043 (71.50%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 673 0.00% 19 664 0.00% 20 1486 0.01% 21 1075 0.00% 22 1243 0.00% 23 1722 0.01% 24 2070 0.01% 25 2762 0.01% 26 3007 0.01% 27 3052 0.01% 28 2901 0.01% 29 3133 0.01% 30 3084 0.01% 31 3133 0.01% 32 3174 0.01% 33 3295 0.01% 34 3446 0.01% 35 3446 0.01% 36 3511 0.01% 37 3820 0.02% 38 4026 0.02% 39 3802 0.01% 40 4231 0.02% 41 3824 0.02% 42 4160 0.02% 43 4228 0.02% 44 4266 0.02% 45 4322 0.02% 46 4276 0.02% 47 4295 0.02% 48 4521 0.02% 49 4573 0.02% 50 4930 0.02% 51 5004 0.02% 52 5295 0.02% 53 5489 0.02% 54 5622 0.02% 55 5795 0.02% 56 6063 0.02% 57 6369 0.03% 58 6595 0.03% 59 6844 0.03% 60 6906 0.03% 61 6833 0.03% 62 7107 0.03% 63 7716 0.03% 64 7465 0.03% 65 7906 0.03% 66 8124 0.03% 67 8373 0.03% 68 8598 0.03% 69 8493 0.03% 70 8967 0.04% 71 8866 0.03% 72 9641 0.04% 73 9897 0.04% 74 9894 0.04% 75 9654 0.04% 76 8218 0.03% 77 9464 0.04% 78 10844 0.04% 79 11928 0.05% 80 12704 0.05% 81 13986 0.05% 82 15714 0.06% 83 17831 0.07% 84 19952 0.08% 85 23222 0.09% 86 27876 0.11% 87 37563 0.15% 88 55746 0.22% 89 206533 0.81% 90 1238422 4.86% 91 254887 1.00% 92 1233259 4.84% 93 238783 0.94% 94 1238813 4.87% 95 310783 1.22% 96 1082696 4.25% 97 189245 0.74% 98 454603 1.79% 99 251499 0.99% 100 18205043 71.50% 25463281 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=23.56 fanout-score-rank=11 prefix-density=0.17 prefix-fanout=21.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=297.00 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=28.3 sequence=TTCTTCTTCTTC Started job on | Feb 12 05:48:38 Started mapping on | Feb 12 05:48:38 Finished on | Feb 12 05:49:03 Mapping speed, Million of reads per hour | 3666.71 Number of input reads | 25463281 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 24389635 Uniquely mapped reads % | 95.78% Average mapped length | 97.27 Number of splices: Total | 7351257 Number of splices: Annotated (sjdb) | 7240204 Number of splices: GT/AG | 7242487 Number of splices: GC/AG | 90409 Number of splices: AT/AC | 7230 Number of splices: Non-canonical | 11131 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 581975 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 353798 % of reads mapped to too many loci | 1.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 491671 491671 491671 N_multimapping 581975 581975 581975 N_noFeature 751374 12497416 12506734 N_ambiguous 211330 37075 37676 UnstrandedReadsAssigned:23426931 PositiveStrandReadsAssigned:11855144 NegativeStrandReadsAssigned:11845225 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1121302 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR1121302-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,463,281 reads, 24,218,683 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR1121302.ke.tsv 34699 SRR1121302.se.tsv 87100 total ==> SRR1121302.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 609 17.4798 Potri.005G024800.1.v4.1 1035 936 117 6.885 Potri.004G059700.1.v4.1 961 862 20 1.27796 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 470.426 9.11077 Potri.016G087400.1.v4.1 270 171 1528 492.177 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 88 2.89548 Potri.012G127500.1.v4.1 977 878 7516 471.505 ==> SRR1121302.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 2444 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 472 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR1121302 completed mapping pipeline successfully