Starting /dee2/code/volunteer_pipeline.sh SRR1121303 current disk space = 3050288746496 free memory = 1579263048 SRR1121303 SRAfilesize 9bfec8b8c7fcf06895008bacd1c7b918 SRR1121303.sra SRR1121303.sra file validated SRR1121303 is single end SRR1121303 is conventional basespace SRR1121303 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1121303_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.29975 34.0 34.0 34.0 31.0 34.0 2 33.48825 34.0 34.0 34.0 33.0 34.0 3 33.6325 34.0 34.0 34.0 33.0 34.0 4 36.80075 37.0 37.0 37.0 37.0 37.0 5 36.72425 37.0 37.0 37.0 37.0 37.0 6 36.775 37.0 37.0 37.0 37.0 37.0 7 36.77 37.0 37.0 37.0 37.0 37.0 8 36.727 37.0 37.0 37.0 37.0 37.0 9 38.6345 39.0 39.0 39.0 38.0 39.0 10-11 38.701375 39.0 39.0 39.0 39.0 39.0 12-13 38.63225 39.0 39.0 39.0 38.0 39.0 14-15 39.61275 40.0 40.0 40.0 39.0 40.0 16-17 39.63925 40.0 40.0 40.0 39.0 40.0 18-19 39.585875 40.0 40.0 40.0 39.0 40.0 20-21 39.61025 40.0 40.0 40.0 39.0 40.0 22-23 39.58475 40.0 40.0 40.0 39.0 40.0 24-25 39.477000000000004 40.0 40.0 40.0 39.0 40.0 26-27 39.4135 40.0 40.0 40.0 38.5 40.0 28-29 39.374875 40.0 40.0 40.0 38.0 40.0 30-31 39.29900000000001 40.0 40.0 40.0 38.0 40.0 32-33 39.230374999999995 40.0 40.0 40.0 38.0 40.0 34-35 39.129374999999996 40.0 40.0 40.0 37.5 40.0 36-37 39.157250000000005 40.0 40.0 40.0 38.0 40.0 38-39 39.052875 40.0 40.0 40.0 37.5 40.0 40-41 39.120374999999996 40.0 40.0 40.0 38.0 40.0 42-43 39.06175 40.0 40.0 40.0 37.5 40.0 44-45 38.990375 40.0 40.0 40.0 37.0 40.0 46-47 38.9895 40.0 40.0 40.0 37.5 40.0 48-49 39.081625 40.0 40.0 40.0 37.0 40.0 50-51 38.995374999999996 40.0 40.0 40.0 37.0 40.0 52-53 38.971999999999994 40.0 40.0 40.0 37.0 40.0 54-55 38.917500000000004 40.0 39.5 40.0 36.5 40.0 56-57 38.771125 40.0 39.0 40.0 35.5 40.0 58-59 38.480500000000006 40.0 39.0 40.0 35.0 40.0 60-61 38.334125 40.0 38.0 40.0 35.0 40.0 62-63 37.9875 40.0 37.0 40.0 35.0 40.0 64-65 37.7775 39.0 37.0 40.0 35.0 40.0 66-67 37.46375 39.0 36.0 40.0 35.0 40.0 68-69 37.1625 39.0 35.5 40.0 34.0 40.0 70-71 36.802875 37.0 35.0 39.5 34.0 40.0 72-73 36.426625 37.0 35.0 39.0 34.0 40.0 74-75 35.988 36.5 35.0 39.0 33.0 40.0 76-77 35.20925 35.5 34.5 37.0 32.5 39.0 78-79 35.253125 35.5 35.0 37.0 33.0 39.0 80-81 34.866 35.0 35.0 37.0 33.0 39.0 82-83 34.58175 35.0 35.0 36.0 33.0 37.0 84-85 34.246750000000006 35.0 35.0 36.0 32.0 37.0 86-87 33.991 35.0 35.0 35.5 32.0 36.5 88-89 33.873374999999996 35.0 34.5 35.0 32.0 36.0 90-91 33.679 35.0 34.0 35.0 32.0 36.0 92-93 33.149249999999995 35.0 34.0 35.0 30.0 36.0 94-95 32.300625 35.0 33.5 35.0 27.0 35.5 96-97 31.905124999999998 35.0 33.0 35.0 26.0 35.0 98-99 31.056625 34.5 32.0 35.0 21.5 35.0 100 30.473 34.0 32.0 35.0 18.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 2.0 14 1.0 15 3.0 16 0.0 17 3.0 18 3.0 19 1.0 20 2.0 21 3.0 22 6.0 23 6.0 24 5.0 25 7.0 26 4.0 27 16.0 28 11.0 29 16.0 30 14.0 31 34.0 32 46.0 33 59.0 34 77.0 35 146.0 36 452.0 37 1508.0 38 1548.0 39 24.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.80100755667506 13.249370277078084 16.297229219143578 43.65239294710327 2 18.81881881881882 23.023023023023022 37.712712712712715 20.445445445445447 3 21.425 26.900000000000002 28.825 22.85 4 25.2 31.4 19.575 23.825 5 23.549999999999997 35.9 21.85 18.7 6 18.275 37.775 23.7 20.25 7 16.525000000000002 16.25 44.7 22.525000000000002 8 19.400000000000002 22.875 28.999999999999996 28.725 9 19.825 21.75 31.775 26.650000000000002 10-11 22.525000000000002 33.637499999999996 21.8 22.037499999999998 12-13 20.225 26.237500000000004 30.049999999999997 23.4875 14-15 21.6875 26.2875 28.299999999999997 23.724999999999998 16-17 22.768192048012004 27.731932983245812 26.78169542385596 22.718179544886222 18-19 22.5 27.8625 27.0125 22.625 20-21 21.075 28.775000000000002 27.224999999999998 22.925 22-23 22.975 28.075 26.650000000000002 22.3 24-25 21.575 28.575 26.674999999999997 23.175 26-27 21.825 28.512500000000003 27.3 22.3625 28-29 22.650000000000002 27.474999999999998 27.05 22.825 30-31 21.725 27.150000000000002 27.9125 23.2125 32-33 21.875 28.712500000000002 26.85 22.5625 34-35 21.575 28.199999999999996 27.675 22.55 36-37 21.773386693346673 27.97648824412206 27.60130065032516 22.648824412206103 38-39 22.0 28.599999999999998 26.900000000000002 22.5 40-41 22.0125 27.900000000000002 26.987499999999997 23.1 42-43 21.3625 27.6875 27.775 23.175 44-45 22.2 28.050000000000004 27.575 22.175 46-47 22.225 27.450000000000003 27.8875 22.4375 48-49 21.8 28.6875 27.437499999999996 22.075 50-51 22.225 28.425 26.637499999999996 22.7125 52-53 22.1875 28.1375 26.637499999999996 23.0375 54-55 21.64832416208104 27.863931965982992 27.988994497248626 22.498749374687343 56-57 23.974487243621812 26.738369184592298 26.738369184592298 22.548774387193596 58-59 21.337500000000002 28.6625 27.8625 22.1375 60-61 22.5625 27.762500000000003 27.700000000000003 21.975 62-63 22.7125 28.15 27.55 21.587500000000002 64-65 22.9625 27.975 26.6125 22.45 66-67 21.9375 27.35 27.85 22.8625 68-69 21.762500000000003 27.9375 27.625 22.675 70-71 22.240280035004375 28.90361295161895 26.778347293411674 22.077759719964995 72-73 21.61520190023753 27.728466058257283 28.19102387798475 22.46530816352044 74-75 22.025 27.3125 28.1 22.5625 76-77 22.455613903475868 27.881970492623154 27.169292323080768 22.493123280820203 78-79 22.8625 27.875 27.125 22.1375 80-81 21.9 29.1375 26.5125 22.45 82-83 22.112499999999997 28.125 27.55 22.2125 84-85 22.3 27.875 27.487499999999997 22.3375 86-87 21.587500000000002 28.5875 27.0625 22.7625 88-89 22.4625 28.262500000000003 27.650000000000002 21.625 90-91 22.548774387193596 28.16408204102051 27.163581790895446 22.123561780890444 92-93 22.352794099262407 27.140892611576444 28.328541067633456 22.177772221527693 94-95 22.418104526131533 28.219554888722183 26.78169542385596 22.58064516129032 96-97 22.2125 27.1375 27.800000000000004 22.85 98-99 22.8 28.1 27.224999999999998 21.875 100 23.549999999999997 26.0 27.400000000000002 23.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 2.0 26 4.5 27 7.5 28 9.0 29 9.5 30 14.0 31 23.0 32 27.5 33 35.0 34 49.0 35 56.0 36 74.0 37 101.0 38 123.5 39 142.0 40 175.5 41 209.0 42 240.0 43 259.0 44 261.5 45 270.0 46 263.5 47 251.5 48 230.5 49 203.0 50 186.0 51 162.0 52 130.5 53 112.0 54 86.0 55 57.0 56 42.0 57 37.5 58 32.5 59 26.5 60 17.5 61 9.5 62 11.5 63 9.5 64 4.0 65 3.0 66 3.5 67 3.5 68 3.5 69 3.5 70 2.0 71 1.5 72 2.0 73 2.0 74 2.0 75 1.5 76 2.0 77 1.5 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.025 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.05 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.05 56-57 0.05 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0125 74-75 0.0 76-77 0.025 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.05 92-93 0.0125 94-95 0.025 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra Read 588557 spots for SRR1121303.sra Written 588557 spots for SRR1121303.sra Read 588552 spots for SRR1121303.sra Written 588552 spots for SRR1121303.sra SRR ids: ['SRR1121303.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gnygsywk SRR1121303.sra spots: 11771045 blocks: [[1, 588552], [588553, 1177104], [1177105, 1765656], [1765657, 2354208], [2354209, 2942760], [2942761, 3531312], [3531313, 4119864], [4119865, 4708416], [4708417, 5296968], [5296969, 5885520], [5885521, 6474072], [6474073, 7062624], [7062625, 7651176], [7651177, 8239728], [8239729, 8828280], [8828281, 9416832], [9416833, 10005384], [10005385, 10593936], [10593937, 11182488], [11182489, 11771045]] SRR1121303 file size 3052537 SRR1121303 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1121303 SRR1121303_1.fastq Input file: SRR1121303_1.fastq trimmed: SRR1121303-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 06:13:55 2025 >> started Wed Feb 12 06:14:00 2025 >> done (5.875s) 11771045 reads processed; of these: 1724 ( 0.01%) short reads filtered out after trimming by size control 8729 ( 0.07%) empty reads filtered out after trimming by size control 11760592 (99.91%) reads available; of these: 3341120 (28.41%) trimmed reads available after processing 8419472 (71.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 231 0.00% 19 250 0.00% 20 299 0.00% 21 366 0.00% 22 519 0.00% 23 711 0.01% 24 936 0.01% 25 1173 0.01% 26 1280 0.01% 27 1247 0.01% 28 1270 0.01% 29 1310 0.01% 30 1341 0.01% 31 1357 0.01% 32 1415 0.01% 33 1387 0.01% 34 1581 0.01% 35 1556 0.01% 36 1603 0.01% 37 1583 0.01% 38 1714 0.01% 39 1583 0.01% 40 1696 0.01% 41 1752 0.01% 42 1816 0.02% 43 1779 0.02% 44 1768 0.02% 45 1802 0.02% 46 1811 0.02% 47 1830 0.02% 48 1838 0.02% 49 1939 0.02% 50 1966 0.02% 51 2118 0.02% 52 2037 0.02% 53 2294 0.02% 54 2313 0.02% 55 2264 0.02% 56 2525 0.02% 57 2606 0.02% 58 2681 0.02% 59 2733 0.02% 60 2975 0.03% 61 2924 0.02% 62 3074 0.03% 63 3102 0.03% 64 2965 0.03% 65 3343 0.03% 66 3209 0.03% 67 3352 0.03% 68 3641 0.03% 69 3639 0.03% 70 3826 0.03% 71 3900 0.03% 72 4260 0.04% 73 4309 0.04% 74 4323 0.04% 75 4369 0.04% 76 3484 0.03% 77 4110 0.03% 78 4746 0.04% 79 5105 0.04% 80 5337 0.05% 81 6048 0.05% 82 6815 0.06% 83 7731 0.07% 84 8574 0.07% 85 9965 0.08% 86 12132 0.10% 87 16531 0.14% 88 24258 0.21% 89 95825 0.81% 90 589203 5.01% 91 113320 0.96% 92 557546 4.74% 93 106836 0.91% 94 564288 4.80% 95 146719 1.25% 96 518205 4.41% 97 85301 0.73% 98 207280 1.76% 99 118270 1.01% 100 8419472 71.59% 11760592 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=25.45 fanout-score-rank=3 prefix-density=0.18 prefix-fanout=21.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=11 fanout-score=108.62 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=16.4 sequence=CCACCACCAACA Started job on | Feb 12 06:14:17 Started mapping on | Feb 12 06:14:17 Finished on | Feb 12 06:14:34 Mapping speed, Million of reads per hour | 2490.48 Number of input reads | 11760592 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 10849232 Uniquely mapped reads % | 92.25% Average mapped length | 97.35 Number of splices: Total | 3246442 Number of splices: Annotated (sjdb) | 3200066 Number of splices: GT/AG | 3198574 Number of splices: GC/AG | 39770 Number of splices: AT/AC | 3189 Number of splices: Non-canonical | 4909 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.96 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271219 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 584051 % of reads mapped to too many loci | 4.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 640141 640141 640141 N_multimapping 271219 271219 271219 N_noFeature 318227 5540855 5566636 N_ambiguous 91977 16066 16050 UnstrandedReadsAssigned:10439028 PositiveStrandReadsAssigned:5292311 NegativeStrandReadsAssigned:5266546 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1121303 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR1121303-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,760,592 reads, 11,176,104 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 980 rounds 52401 SRR1121303.ke.tsv 34699 SRR1121303.se.tsv 87100 total ==> SRR1121303.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 244 14.7088 Potri.005G024800.1.v4.1 1035 936 37 4.57286 Potri.004G059700.1.v4.1 961 862 12 1.61041 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 179.042 7.28262 Potri.016G087400.1.v4.1 270 171 776 524.962 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 31 2.14224 Potri.012G127500.1.v4.1 977 878 3548 467.467 ==> SRR1121303.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1016 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 202 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR1121303 completed mapping pipeline successfully