Starting /dee2/code/volunteer_pipeline.sh SRR11462690 current disk space = 3050305122304 free memory = 1578361408 SRR11462690 SRAfilesize 00253985a2644070ba4cc2453c8247cd SRR11462690.sra SRR11462690.sra file validated SRR11462690 is single end SRR11462690 is conventional basespace SRR11462690 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11462690_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.8925 32.0 32.0 32.0 2.0 32.0 2 31.84375 32.0 32.0 32.0 32.0 32.0 3 34.93625 37.0 32.0 37.0 32.0 37.0 4 36.38 37.0 37.0 37.0 37.0 37.0 5 36.50875 37.0 37.0 37.0 37.0 37.0 6 40.078 41.0 41.0 41.0 37.0 41.0 7 40.36625 41.0 41.0 41.0 41.0 41.0 8 40.3175 41.0 41.0 41.0 41.0 41.0 9 40.40475 41.0 41.0 41.0 41.0 41.0 10-14 40.40935 41.0 41.0 41.0 41.0 41.0 15-19 40.364399999999996 41.0 41.0 41.0 41.0 41.0 20-24 40.32965 41.0 41.0 41.0 40.2 41.0 25-29 40.3029 41.0 41.0 41.0 40.2 41.0 30-34 40.356550000000006 41.0 41.0 41.0 41.0 41.0 35-39 40.37115000000001 41.0 41.0 41.0 41.0 41.0 40-44 40.3032 41.0 41.0 41.0 41.0 41.0 45-49 40.2714 41.0 41.0 41.0 41.0 41.0 50-54 40.26975 41.0 41.0 41.0 41.0 41.0 55-59 40.27745 41.0 41.0 41.0 41.0 41.0 60-64 40.14385 41.0 41.0 41.0 39.4 41.0 65-69 40.118700000000004 41.0 41.0 41.0 37.0 41.0 70-74 40.12365 41.0 41.0 41.0 37.8 41.0 75-79 39.7707 41.0 40.2 41.0 37.0 41.0 80-84 40.265299999999996 41.0 41.0 41.0 39.4 41.0 85-89 40.27475 41.0 41.0 41.0 40.2 41.0 90-94 40.233250000000005 41.0 41.0 41.0 40.2 41.0 95-99 40.0517 41.0 41.0 41.0 37.8 41.0 100-104 40.0712 41.0 41.0 41.0 38.6 41.0 105-109 40.013799999999996 41.0 41.0 41.0 37.0 41.0 110-114 40.0449 41.0 41.0 41.0 37.8 41.0 115-119 39.86275 41.0 41.0 41.0 37.0 41.0 120-124 39.7174 41.0 41.0 41.0 37.0 41.0 125-129 39.5593 41.0 41.0 41.0 37.0 41.0 130-134 39.40305 41.0 41.0 41.0 37.0 41.0 135-139 39.187400000000004 41.0 41.0 41.0 37.0 41.0 140-144 38.8828 41.0 41.0 41.0 36.0 41.0 145-149 38.66225 41.0 41.0 41.0 33.0 41.0 150-151 37.65525 41.0 39.0 41.0 29.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 2.0 25 2.0 26 3.0 27 5.0 28 6.0 29 7.0 30 12.0 31 17.0 32 22.0 33 47.0 34 58.0 35 53.0 36 107.0 37 125.0 38 197.0 39 361.0 40 2972.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 6.154842889536767 37.836086815678655 40.71914480077745 15.289925494007125 2 26.474999999999998 41.375 20.3 11.85 3 22.85 29.95 36.775000000000006 10.424999999999999 4 33.275 25.924999999999997 25.55 15.25 5 26.900000000000002 27.700000000000003 27.55 17.849999999999998 6 24.45 27.825 29.299999999999997 18.425 7 22.475 28.325 29.525000000000002 19.675 8 23.3 27.05 30.349999999999998 19.3 9 22.400000000000002 22.45 32.324999999999996 22.825 10-14 24.13 25.924999999999997 30.099999999999998 19.845 15-19 24.395 27.744999999999997 28.355000000000004 19.505 20-24 24.095 27.67 28.21 20.025000000000002 25-29 24.795 26.55 29.215000000000003 19.439999999999998 30-34 24.01 25.935000000000002 29.065 20.990000000000002 35-39 24.58 25.919999999999998 28.95 20.549999999999997 40-44 24.0 26.889999999999997 28.860000000000003 20.25 45-49 24.51 26.915 28.444999999999997 20.13 50-54 24.625 26.650000000000002 28.38 20.345 55-59 24.465 27.185 28.46 19.89 60-64 24.815 26.669999999999998 28.970000000000002 19.545 65-69 24.705 26.240000000000002 28.439999999999998 20.615 70-74 24.654999999999998 26.805 28.115000000000002 20.424999999999997 75-79 24.404999999999998 26.834999999999997 29.025000000000002 19.735 80-84 23.335 27.57 28.425 20.669999999999998 85-89 24.685000000000002 27.175 28.349999999999998 19.79 90-94 24.145 27.365000000000002 28.000000000000004 20.49 95-99 23.75 27.365000000000002 28.225 20.66 100-104 24.52 27.474999999999998 28.015 19.99 105-109 23.455000000000002 27.939999999999998 27.47 21.135 110-114 23.355 28.23 26.85 21.565 115-119 23.805 27.785 27.185 21.224999999999998 120-124 23.98 28.455000000000002 25.835 21.73 125-129 23.375 29.630000000000003 25.074999999999996 21.92 130-134 23.380000000000003 29.604999999999997 25.174999999999997 21.84 135-139 22.7 29.525000000000002 24.47 23.305 140-144 22.38 29.93 23.815 23.875 145-149 21.834999999999997 30.185000000000002 23.794999999999998 24.185000000000002 150-151 20.65 30.75 24.175 24.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 2.5 25 4.5 26 3.0 27 3.0 28 11.0 29 14.0 30 13.5 31 21.0 32 35.0 33 54.0 34 74.5 35 100.5 36 118.0 37 128.0 38 147.5 39 165.0 40 179.5 41 210.0 42 230.0 43 245.5 44 268.0 45 264.5 46 229.0 47 219.5 48 225.0 49 193.5 50 155.5 51 114.5 52 102.5 53 96.0 54 68.0 55 71.5 56 63.0 57 37.0 58 34.0 59 22.5 60 13.5 61 12.0 62 7.5 63 10.0 64 8.5 65 3.0 66 1.5 67 2.0 68 2.5 69 2.0 70 1.0 71 3.5 72 3.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 22.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.975 #Duplication Level Percentage of deduplicated Percentage of total 1 94.12883935852133 86.575 2 4.403370481108997 8.1 3 0.8154389779831475 2.25 4 0.46208208752378366 1.7000000000000002 5 0.10872519706441967 0.5 6 0.02718129926610492 0.15 7 0.02718129926610492 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02718129926610492 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGG 22 0.5499999999999999 No Hit TATTTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACA 7 0.17500000000000002 No Hit ACCTGGGGCTGTAGTATGTTCCAAGGGTTGGGCTGTTCGCCCATTAAAGC 6 0.15 No Hit AATCCGGGCTAGATGCGACGCGTGCGCCCGCCGTCCGATTGCCGACCTGC 5 0.125 No Hit NTGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTTACTT 5 0.125 No Hit TATTTTACTTATTCCGTGAATCGGAGGCGGGGCGCTGCCCCTCTTTTTGG 5 0.125 No Hit TGGAACAAAAGGGTAAAAGCTCGTTTGATTCTGATTTCCAGTACGAATAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0125 0.0 0.0 0.0 0.0 20-21 0.037500000000000006 0.0 0.0 0.0 0.0 22-23 0.0625 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.0875 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0125 0.0 0.0 30-31 0.15 0.0 0.025 0.0 0.0 32-33 0.2 0.0 0.025 0.0 0.0 34-35 0.25 0.0 0.025 0.0 0.0 36-37 0.30000000000000004 0.0 0.025 0.0 0.0 38-39 0.4125 0.0 0.025 0.0 0.0 40-41 0.4875 0.0 0.025 0.0 0.0 42-43 0.55 0.0 0.025 0.0 0.0 44-45 0.5874999999999999 0.0 0.025 0.0 0.0 46-47 0.675 0.0 0.025 0.0 0.0 48-49 0.7625 0.0 0.025 0.0 0.0 50-51 0.875 0.0 0.025 0.0 0.0 52-53 0.975 0.0 0.025 0.0 0.0 54-55 1.15 0.0 0.025 0.0 0.0 56-57 1.3875 0.0 0.025 0.0 0.0 58-59 1.6124999999999998 0.0 0.025 0.0 0.0 60-61 1.825 0.0 0.025 0.0 0.0 62-63 2.075 0.0 0.025 0.0 0.0 64-65 2.1500000000000004 0.0 0.025 0.0 0.0 66-67 2.325 0.0 0.025 0.0 0.0 68-69 2.55 0.0 0.025 0.0 0.0 70-71 2.825 0.0 0.025 0.0 0.0 72-73 3.175 0.0 0.025 0.0 0.0 74-75 3.4749999999999996 0.0 0.025 0.0 0.0 76-77 3.8625 0.0 0.025 0.0 0.0 78-79 4.262499999999999 0.0 0.025 0.0 0.0 80-81 4.762499999999999 0.0 0.025 0.0 0.0 82-83 5.2625 0.0 0.025 0.0 0.0 84-85 5.7125 0.0 0.025 0.0 0.0 86-87 6.125 0.0 0.025 0.0 0.0 88-89 6.6 0.0 0.025 0.0 0.0 90-91 7.2375 0.0 0.025 0.0 0.0 92-93 7.95 0.0 0.025 0.0 0.0 94-95 8.675 0.0 0.025 0.0 0.0 96-97 9.462499999999999 0.0 0.025 0.0 0.0 98-99 10.4 0.0 0.025 0.0 0.0 100-101 11.1 0.0 0.025 0.0 0.0 102-103 11.8625 0.0 0.025 0.0 0.0 104-105 12.7625 0.0 0.025 0.0 0.0 106-107 13.625 0.0 0.025 0.0 0.0 108-109 14.7625 0.0 0.025 0.0 0.0 110-111 15.975 0.0 0.025 0.0 0.0 112-113 17.4 0.0 0.025 0.0 0.0 114-115 18.9 0.0 0.025 0.0 0.0 116-117 20.475 0.0 0.025 0.0 0.0 118-119 21.8125 0.0 0.025 0.0 0.0 120-121 23.0625 0.0 0.025 0.0 0.0 122-123 24.4 0.0 0.025 0.0 0.0 124-125 26.125 0.0 0.025 0.0 0.0 126-127 27.7625 0.0 0.025 0.0 0.0 128-129 29.575000000000003 0.0 0.025 0.0 0.0 130-131 31.1375 0.0 0.025 0.0 0.0 132-133 32.6125 0.0 0.025 0.0 0.0 134-135 34.35 0.0 0.025 0.0 0.0 136-137 36.1375 0.0 0.025 0.0 0.0 138-139 38.075 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAACCC 10 0.006862618 144.77501 6 >>END_MODULE Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1701007 READS because READLEN < 1 Read 1701007 spots for SRR11462690.sra Written 1701007 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra Rejected 1700993 READS because READLEN < 1 Read 1700993 spots for SRR11462690.sra Written 1700993 spots for SRR11462690.sra SRR ids: ['SRR11462690.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9w3uo7mx SRR11462690.sra spots: 34019874 blocks: [[1, 1700993], [1700994, 3401986], [3401987, 5102979], [5102980, 6803972], [6803973, 8504965], [8504966, 10205958], [10205959, 11906951], [11906952, 13607944], [13607945, 15308937], [15308938, 17009930], [17009931, 18710923], [18710924, 20411916], [20411917, 22112909], [22112910, 23813902], [23813903, 25514895], [25514896, 27215888], [27215889, 28916881], [28916882, 30617874], [30617875, 32318867], [32318868, 34019874]] SRR11462690 file size 11539741 SRR11462690 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11462690 SRR11462690_1.fastq Input file: SRR11462690_1.fastq trimmed: SRR11462690-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 06:12:52 2025 >> started Wed Feb 12 06:13:10 2025 >> done (18.603s) 34019874 reads processed; of these: 16914 ( 0.05%) short reads filtered out after trimming by size control 2391 ( 0.01%) empty reads filtered out after trimming by size control 34000569 (99.94%) reads available; of these: 7947278 (23.37%) trimmed reads available after processing 26053291 (76.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3777 0.01% 19 4124 0.01% 20 4476 0.01% 21 4946 0.01% 22 5580 0.02% 23 5855 0.02% 24 6393 0.02% 25 6444 0.02% 26 6637 0.02% 27 7121 0.02% 28 7480 0.02% 29 7857 0.02% 30 8105 0.02% 31 8650 0.03% 32 8580 0.03% 33 9092 0.03% 34 10140 0.03% 35 9900 0.03% 36 10279 0.03% 37 12370 0.04% 38 11017 0.03% 39 11802 0.03% 40 12276 0.04% 41 12304 0.04% 42 13679 0.04% 43 14328 0.04% 44 14480 0.04% 45 15678 0.05% 46 16943 0.05% 47 24191 0.07% 48 18402 0.05% 49 21464 0.06% 50 18881 0.06% 51 20234 0.06% 52 21036 0.06% 53 21869 0.06% 54 24343 0.07% 55 24791 0.07% 56 26172 0.08% 57 28866 0.08% 58 27569 0.08% 59 30243 0.09% 60 30895 0.09% 61 32437 0.10% 62 41317 0.12% 63 34545 0.10% 64 37010 0.11% 65 36060 0.11% 66 38010 0.11% 67 41100 0.12% 68 41237 0.12% 69 48520 0.14% 70 47102 0.14% 71 51832 0.15% 72 53853 0.16% 73 59106 0.17% 74 62373 0.18% 75 57773 0.17% 76 57723 0.17% 77 62835 0.18% 78 64870 0.19% 79 77810 0.23% 80 69720 0.21% 81 73286 0.22% 82 76776 0.23% 83 78442 0.23% 84 87874 0.26% 85 88680 0.26% 86 95602 0.28% 87 99100 0.29% 88 97828 0.29% 89 109402 0.32% 90 106293 0.31% 91 111246 0.33% 92 111516 0.33% 93 115598 0.34% 94 124260 0.37% 95 128207 0.38% 96 157726 0.46% 97 150968 0.44% 98 142159 0.42% 99 150034 0.44% 100 152590 0.45% 101 160447 0.47% 102 186855 0.55% 103 170687 0.50% 104 171665 0.50% 105 178375 0.52% 106 186147 0.55% 107 190002 0.56% 108 201049 0.59% 109 220986 0.65% 110 210576 0.62% 111 216458 0.64% 112 287748 0.85% 113 225085 0.66% 114 224414 0.66% 115 229187 0.67% 116 238214 0.70% 117 250179 0.74% 118 255734 0.75% 119 261381 0.77% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 0 0.00% 140 0 0.00% 141 0 0.00% 142 0 0.00% 143 0 0.00% 144 0 0.00% 145 0 0.00% 146 0 0.00% 147 0 0.00% 148 0 0.00% 149 0 0.00% 150 0 0.00% 151 26053291 76.63% 34000569 reads passed initial QC criterion=sequence-density sequence-density=16.56 sequence-density-rank=1 fanout-score=37.97 fanout-score-rank=1 prefix-density=19.49 prefix-fanout=32.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=16.56 sequence-density-rank=1 fanout-score=37.97 fanout-score-rank=1 prefix-density=19.49 prefix-fanout=32.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR11462690 - Input file: STDIN trimmed: SRR11462690-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAACAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 06:14:52 2025 >> started Wed Feb 12 06:15:25 2025 >> done (33.139s) 30000502 reads processed; of these: 609 ( 0.00%) short reads filtered out after trimming by size control 15 ( 0.00%) empty reads filtered out after trimming by size control 29999878 (100.00%) reads available; of these: 8638531 (28.80%) trimmed reads available after processing 21361347 (71.20%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3426 0.01% 19 3743 0.01% 20 4042 0.01% 21 4460 0.01% 22 4984 0.02% 23 5255 0.02% 24 5733 0.02% 25 5723 0.02% 26 5902 0.02% 27 6339 0.02% 28 6711 0.02% 29 7024 0.02% 30 7181 0.02% 31 7647 0.03% 32 7632 0.03% 33 8080 0.03% 34 8951 0.03% 35 8843 0.03% 36 9219 0.03% 37 11034 0.04% 38 9820 0.03% 39 10516 0.04% 40 10950 0.04% 41 11016 0.04% 42 12273 0.04% 43 12725 0.04% 44 12846 0.04% 45 14030 0.05% 46 15198 0.05% 47 21556 0.07% 48 16450 0.05% 49 19216 0.06% 50 17043 0.06% 51 18060 0.06% 52 18831 0.06% 53 19647 0.07% 54 21753 0.07% 55 21922 0.07% 56 23241 0.08% 57 25746 0.09% 58 24545 0.08% 59 26948 0.09% 60 27760 0.09% 61 28961 0.10% 62 36694 0.12% 63 31010 0.10% 64 32941 0.11% 65 32215 0.11% 66 33974 0.11% 67 36670 0.12% 68 37038 0.12% 69 43167 0.14% 70 42082 0.14% 71 45960 0.15% 72 48129 0.16% 73 52751 0.18% 74 55502 0.19% 75 51297 0.17% 76 51455 0.17% 77 56077 0.19% 78 57748 0.19% 79 69199 0.23% 80 62121 0.21% 81 68252 0.23% 82 68381 0.23% 83 69998 0.23% 84 75604 0.25% 85 79117 0.26% 86 85556 0.29% 87 88620 0.30% 88 87523 0.29% 89 97487 0.32% 90 95248 0.32% 91 99046 0.33% 92 99255 0.33% 93 102772 0.34% 94 110884 0.37% 95 114346 0.38% 96 140399 0.47% 97 134417 0.45% 98 126524 0.42% 99 134252 0.45% 100 135785 0.45% 101 143897 0.48% 102 166688 0.56% 103 152217 0.51% 104 152249 0.51% 105 158285 0.53% 106 165423 0.55% 107 168567 0.56% 108 179143 0.60% 109 196520 0.66% 110 187038 0.62% 111 192158 0.64% 112 256661 0.86% 113 199787 0.67% 114 199676 0.67% 115 201759 0.67% 116 210849 0.70% 117 214187 0.71% 118 219278 0.73% 119 227719 0.76% 120 251134 0.84% 121 243350 0.81% 122 238820 0.80% 123 287099 0.96% 124 280881 0.94% 125 249899 0.83% 126 258357 0.86% 127 262827 0.88% 128 265166 0.88% 129 273127 0.91% 130 258859 0.86% 131 279977 0.93% 132 289802 0.97% 133 327480 1.09% 134 268833 0.90% 135 282391 0.94% 136 268863 0.90% 137 287798 0.96% 138 319077 1.06% 139 280568 0.94% 140 282265 0.94% 141 263314 0.88% 142 291520 0.97% 143 296821 0.99% 144 266423 0.89% 145 285708 0.95% 146 272219 0.91% 147 362604 1.21% 148 578773 1.93% 149 0 0.00% 150 0 0.00% 151 14571344 48.57% criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=34 prefix-density=1.10 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATTGTTATGTATTGGCCATGTCTGTGGCCTCTGGTGTGGTTTTAATGAAGTCTTATAATTAGTGTAGTACTCTGCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=32 fanout-score=21.08 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.8 sequence=AAGGCTGGAGCCCAGATCTTCAGCGAGGGTGGACTTGACTACTTGGGCAACCCAAGCTTGATCCACGCACAAAGCATCTTGGCCATCTGGGCTACACAGGTGGTCTTGATGGGTGCCGTTGAGGGTTACAGAATTGCTGGCGGGCCACTCGGTGAGGTAACTGACCCAATCTACCCAGGTGGAAGCTTCGACCCACTGGGCTTGGCTGACGATCCCGAAGCATTCGCTGAGTTGAAGGTGAAGGAACTCAAGAATGGTAGGTTGGCTATGTTCTCAATGTTCGGATTCTTTGTCCAGGCCATTGTGACCGGAAAGGGACCACTGGAGAACCTGGCTGACCACCTTTCTGACCCAGTAAACAACAACGCCTGGGCATATGCCACAAACTTCGTTCCCGGAAAGTGAGCAACAAAAGAGTTTTTTCTGTGCTGGGACTATTGGCTTGTAATGTTAACTTGTGATGTAACGAGCTCATG Started job on | Feb 12 06:15:59 Started mapping on | Feb 12 06:15:59 Finished on | Feb 12 06:17:21 Mapping speed, Million of reads per hour | 1492.68 Number of input reads | 33999945 Average input read length | 133 UNIQUE READS: Uniquely mapped reads number | 29224988 Uniquely mapped reads % | 85.96% Average mapped length | 131.07 Number of splices: Total | 12733177 Number of splices: Annotated (sjdb) | 12484432 Number of splices: GT/AG | 12519016 Number of splices: GC/AG | 166407 Number of splices: AT/AC | 6981 Number of splices: Non-canonical | 40773 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 860831 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 1316968 % of reads mapped to too many loci | 3.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.54% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3914126 3914126 3914126 N_multimapping 860831 860831 860831 N_noFeature 1462618 1967418 28359222 N_ambiguous 469730 109132 626 UnstrandedReadsAssigned:27292640 PositiveStrandReadsAssigned:27148438 NegativeStrandReadsAssigned:865140 Dataset is classified positive stranded MeadianReadLen=148 20thPercentileLength=115 echo kmer=111 SRR11462690 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR11462690-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,999,945 reads, 28,026,608 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,302 rounds 52401 SRR11462690.ke.tsv 34699 SRR11462690.se.tsv 87100 total ==> SRR11462690.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1385 26.3395 Potri.005G024800.1.v4.1 1035 936 514 20.041 Potri.004G059700.1.v4.1 961 862 14 0.592725 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 4075.7 52.3004 Potri.016G087400.1.v4.1 270 171 1439 307.112 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 200 4.36021 Potri.012G127500.1.v4.1 977 878 61 2.53553 ==> SRR11462690.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 119 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR11462690 completed mapping pipeline successfully