Starting /dee2/code/volunteer_pipeline.sh SRR11462694 current disk space = 2824817168384 free memory = 1575864552 SRR11462694 SRAfilesize 347b982eeed90400a614a224ca20b245 SRR11462694.sra SRR11462694.sra file validated SRR11462694 is single end SRR11462694 is conventional basespace SRR11462694 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11462694_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.71625 32.0 2.0 32.0 2.0 32.0 2 31.68375 32.0 32.0 32.0 32.0 32.0 3 34.52375 37.0 32.0 37.0 32.0 37.0 4 36.24125 37.0 37.0 37.0 32.0 37.0 5 36.43125 37.0 37.0 37.0 37.0 37.0 6 39.921 41.0 41.0 41.0 37.0 41.0 7 40.222 41.0 41.0 41.0 37.0 41.0 8 40.07275 41.0 41.0 41.0 37.0 41.0 9 40.25225 41.0 41.0 41.0 37.0 41.0 10-14 40.25645 41.0 41.0 41.0 37.8 41.0 15-19 40.264 41.0 41.0 41.0 37.8 41.0 20-24 40.23539999999999 41.0 41.0 41.0 37.8 41.0 25-29 40.1639 41.0 41.0 41.0 37.8 41.0 30-34 40.19815 41.0 41.0 41.0 39.4 41.0 35-39 40.20025 41.0 41.0 41.0 38.6 41.0 40-44 40.215700000000005 41.0 41.0 41.0 37.8 41.0 45-49 40.1867 41.0 41.0 41.0 37.8 41.0 50-54 40.16675 41.0 41.0 41.0 37.0 41.0 55-59 40.10125000000001 41.0 41.0 41.0 37.8 41.0 60-64 40.009 41.0 41.0 41.0 37.0 41.0 65-69 40.02835 41.0 41.0 41.0 37.0 41.0 70-74 39.950300000000006 41.0 41.0 41.0 37.0 41.0 75-79 39.580349999999996 41.0 40.2 41.0 37.0 41.0 80-84 40.212450000000004 41.0 41.0 41.0 38.6 41.0 85-89 40.16135 41.0 41.0 41.0 38.6 41.0 90-94 40.089549999999996 41.0 41.0 41.0 37.8 41.0 95-99 39.93085000000001 41.0 41.0 41.0 37.0 41.0 100-104 39.95805 41.0 41.0 41.0 37.0 41.0 105-109 39.85845 41.0 41.0 41.0 37.0 41.0 110-114 39.9226 41.0 41.0 41.0 37.0 41.0 115-119 39.76015 41.0 41.0 41.0 37.0 41.0 120-124 39.5893 41.0 41.0 41.0 37.0 41.0 125-129 39.460950000000004 41.0 41.0 41.0 37.0 41.0 130-134 39.452149999999996 41.0 41.0 41.0 37.0 41.0 135-139 39.217299999999994 41.0 41.0 41.0 37.0 41.0 140-144 38.94745 41.0 41.0 41.0 37.0 41.0 145-149 38.8427 41.0 41.0 41.0 34.0 41.0 150-151 37.84587500000001 41.0 39.0 41.0 29.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 0.0 26 4.0 27 3.0 28 8.0 29 5.0 30 26.0 31 21.0 32 32.0 33 51.0 34 59.0 35 76.0 36 95.0 37 157.0 38 192.0 39 384.0 40 2886.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 6.059519541054141 37.647902474005015 41.807099318752236 14.485478666188598 2 27.525 40.65 19.975 11.85 3 22.225 30.65 37.974999999999994 9.15 4 33.15 27.6 25.924999999999997 13.325000000000001 5 29.049999999999997 27.1 25.4 18.45 6 25.650000000000002 26.974999999999998 28.675 18.7 7 24.224999999999998 25.25 31.05 19.475 8 24.65 26.05 31.324999999999996 17.974999999999998 9 22.6 23.5 31.7 22.2 10-14 24.685000000000002 25.974999999999998 29.87 19.470000000000002 15-19 24.759999999999998 27.62 27.985 19.634999999999998 20-24 24.34 27.839999999999996 28.335 19.485 25-29 24.695 26.825 28.65 19.830000000000002 30-34 24.495 25.985000000000003 28.904999999999998 20.615 35-39 24.54 26.985 28.335 20.14 40-44 24.21 27.155 28.895 19.74 45-49 24.45 26.825 28.7 20.025000000000002 50-54 24.265 26.465 29.065 20.205000000000002 55-59 25.115 26.91 27.894999999999996 20.080000000000002 60-64 24.905 26.165 29.035 19.895 65-69 24.525 26.395000000000003 28.71 20.369999999999997 70-74 25.169999999999998 26.915 28.249999999999996 19.665 75-79 24.875 27.24 28.7 19.185 80-84 24.83 27.29 27.715 20.165 85-89 24.115000000000002 27.6 28.515 19.77 90-94 25.235000000000003 26.545 28.18 20.04 95-99 24.485 26.945000000000004 29.005 19.564999999999998 100-104 24.62 26.5 28.875 20.005 105-109 23.419999999999998 27.565 28.505000000000003 20.51 110-114 24.044999999999998 27.794999999999998 27.975 20.185 115-119 24.315 26.884999999999998 28.485 20.315 120-124 24.345 27.644999999999996 27.665 20.345 125-129 24.745 27.72 27.505000000000003 20.03 130-134 24.3 27.794999999999998 27.58 20.325 135-139 23.935000000000002 27.894999999999996 26.77 21.4 140-144 23.645 28.01 27.189999999999998 21.154999999999998 145-149 24.529999999999998 27.889999999999997 26.215 21.365000000000002 150-151 23.3375 28.8625 26.887499999999996 20.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 1.0 27 5.0 28 12.5 29 14.0 30 15.5 31 17.0 32 26.0 33 42.0 34 52.0 35 71.5 36 95.0 37 111.0 38 143.0 39 177.0 40 201.0 41 227.0 42 267.0 43 283.5 44 263.5 45 262.5 46 272.0 47 255.5 48 219.0 49 182.5 50 155.0 51 121.0 52 95.5 53 89.5 54 63.5 55 52.5 56 54.5 57 40.0 58 33.0 59 22.0 60 14.0 61 10.5 62 7.0 63 8.0 64 3.5 65 2.5 66 3.0 67 1.0 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 30.275000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.45 #Duplication Level Percentage of deduplicated Percentage of total 1 95.60614081524616 90.3 2 3.7056643726839598 7.000000000000001 3 0.42350449973530974 1.2 4 0.10587612493382743 0.4 5 0.05293806246691372 0.25 6 0.02646903123345686 0.15 7 0.0 0.0 8 0.02646903123345686 0.2 9 0.0 0.0 >10 0.05293806246691372 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGG 10 0.25 No Hit TATTTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACA 10 0.25 No Hit TGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTG 8 0.2 No Hit TAAGCGCGAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCTTTGTACAC 6 0.15 No Hit NGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGG 5 0.125 No Hit AGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.07500000000000001 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.16249999999999998 0.0 0.0 0.0 0.0 24-25 0.21250000000000002 0.0 0.0 0.0 0.0 26-27 0.25 0.0 0.0 0.0 0.0 28-29 0.25 0.0 0.0 0.0 0.0 30-31 0.25 0.0 0.0 0.0 0.0 32-33 0.25 0.0 0.0 0.0 0.0 34-35 0.2625 0.0 0.0 0.0 0.0 36-37 0.3375 0.0 0.0 0.0 0.0 38-39 0.44999999999999996 0.0 0.0 0.0 0.0 40-41 0.4875 0.0 0.0 0.0 0.0 42-43 0.5375000000000001 0.0 0.0 0.0 0.0 44-45 0.55 0.0 0.0 0.0 0.0 46-47 0.575 0.0 0.0 0.0 0.0 48-49 0.65 0.0 0.0 0.0 0.0 50-51 0.675 0.0 0.0 0.0 0.0 52-53 0.7 0.0 0.0 0.0 0.0 54-55 0.8 0.0 0.0 0.0 0.0 56-57 0.9375 0.0 0.0 0.0 0.0 58-59 1.0499999999999998 0.0 0.0 0.0 0.0 60-61 1.125 0.0 0.0 0.0 0.0 62-63 1.2625000000000002 0.0 0.0 0.0 0.0 64-65 1.3125 0.0 0.0 0.0 0.0 66-67 1.35 0.0 0.0 0.0 0.0 68-69 1.4 0.0 0.0 0.0 0.0 70-71 1.5 0.0 0.0 0.0 0.0 72-73 1.5875 0.0 0.0 0.0 0.0 74-75 1.8375 0.0 0.0 0.0 0.0 76-77 2.1125 0.0 0.0 0.0 0.0 78-79 2.2 0.0 0.0 0.0 0.0 80-81 2.2875 0.0 0.0 0.0 0.0 82-83 2.3625 0.0 0.0 0.0 0.0 84-85 2.4625 0.0 0.0 0.0 0.0 86-87 2.7125 0.0 0.0 0.0 0.0 88-89 3.025 0.0 0.0 0.0 0.0 90-91 3.3125 0.0 0.0 0.0 0.0 92-93 3.5375 0.0 0.0 0.0 0.0 94-95 3.8 0.0 0.0 0.0 0.0 96-97 4.1 0.0 0.0 0.0 0.0 98-99 4.4625 0.0 0.0 0.0 0.0 100-101 4.725 0.0 0.0 0.0 0.0 102-103 5.0625 0.0 0.0 0.0 0.0 104-105 5.4875 0.0 0.0 0.0 0.0 106-107 5.8375 0.0 0.0 0.0 0.0 108-109 6.25 0.0 0.0 0.0 0.0 110-111 6.7375 0.0 0.0 0.0 0.0 112-113 7.15 0.0 0.0 0.0 0.0 114-115 7.6875 0.0 0.0 0.0 0.0 116-117 8.3625 0.0 0.0 0.0 0.0 118-119 9.1125 0.0 0.0 0.0 0.0 120-121 9.9625 0.0 0.0 0.0 0.0 122-123 10.875 0.0 0.0 0.0 0.0 124-125 12.175 0.0 0.0 0.0 0.0 126-127 13.05 0.0 0.0 0.0 0.0 128-129 14.024999999999999 0.0 0.0 0.0 0.0 130-131 15.2375 0.0 0.0 0.0 0.0 132-133 16.1625 0.0 0.0 0.0 0.0 134-135 17.0875 0.0 0.0 0.0 0.0 136-137 17.9375 0.0 0.0 0.0 0.0 138-139 19.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGAGT 10 0.0023261916 206.7143 1 CGCCCCG 10 0.00687326 144.7 145 AAGAGTC 10 0.00687326 144.7 2 AGAGTCT 10 0.00687326 144.7 3 >>END_MODULE Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035997 READS because READLEN < 1 Read 2035997 spots for SRR11462694.sra Written 2035997 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra Rejected 2035993 READS because READLEN < 1 Read 2035993 spots for SRR11462694.sra Written 2035993 spots for SRR11462694.sra SRR ids: ['SRR11462694.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nf8kv8tt SRR11462694.sra spots: 40719864 blocks: [[1, 2035993], [2035994, 4071986], [4071987, 6107979], [6107980, 8143972], [8143973, 10179965], [10179966, 12215958], [12215959, 14251951], [14251952, 16287944], [16287945, 18323937], [18323938, 20359930], [20359931, 22395923], [22395924, 24431916], [24431917, 26467909], [26467910, 28503902], [28503903, 30539895], [30539896, 32575888], [32575889, 34611881], [34611882, 36647874], [36647875, 38683867], [38683868, 40719864]] SRR11462694 file size 13816690 SRR11462694 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11462694 SRR11462694_1.fastq Input file: SRR11462694_1.fastq trimmed: SRR11462694-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Apr 10 11:47:16 2025 >> started Thu Apr 10 11:47:41 2025 >> done (25.609s) 40719864 reads processed; of these: 9380 ( 0.02%) short reads filtered out after trimming by size control 1314 ( 0.00%) empty reads filtered out after trimming by size control 40709170 (99.97%) reads available; of these: 4182680 (10.27%) trimmed reads available after processing 36526490 (89.73%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2093 0.01% 19 2297 0.01% 20 2601 0.01% 21 2743 0.01% 22 3234 0.01% 23 3281 0.01% 24 3600 0.01% 25 3562 0.01% 26 3894 0.01% 27 4328 0.01% 28 4309 0.01% 29 4575 0.01% 30 4777 0.01% 31 4890 0.01% 32 4907 0.01% 33 5280 0.01% 34 5376 0.01% 35 5659 0.01% 36 5873 0.01% 37 7093 0.02% 38 6120 0.02% 39 6715 0.02% 40 6740 0.02% 41 6750 0.02% 42 7707 0.02% 43 7763 0.02% 44 7805 0.02% 45 8728 0.02% 46 9009 0.02% 47 11378 0.03% 48 10037 0.02% 49 11111 0.03% 50 10548 0.03% 51 11143 0.03% 52 11390 0.03% 53 12180 0.03% 54 13150 0.03% 55 13677 0.03% 56 14143 0.03% 57 15223 0.04% 58 14670 0.04% 59 16850 0.04% 60 16495 0.04% 61 16967 0.04% 62 27517 0.07% 63 18693 0.05% 64 20069 0.05% 65 19895 0.05% 66 20123 0.05% 67 22943 0.06% 68 21946 0.05% 69 24373 0.06% 70 23917 0.06% 71 26540 0.07% 72 27872 0.07% 73 29388 0.07% 74 32853 0.08% 75 30684 0.08% 76 29124 0.07% 77 32098 0.08% 78 33536 0.08% 79 37353 0.09% 80 35485 0.09% 81 37416 0.09% 82 38425 0.09% 83 40033 0.10% 84 43720 0.11% 85 45649 0.11% 86 48020 0.12% 87 48863 0.12% 88 48401 0.12% 89 66833 0.16% 90 52958 0.13% 91 55671 0.14% 92 55855 0.14% 93 60660 0.15% 94 64273 0.16% 95 64277 0.16% 96 73049 0.18% 97 71323 0.18% 98 70542 0.17% 99 73475 0.18% 100 72907 0.18% 101 80379 0.20% 102 95825 0.24% 103 84685 0.21% 104 87363 0.21% 105 91614 0.23% 106 96812 0.24% 107 100029 0.25% 108 104119 0.26% 109 118449 0.29% 110 112044 0.28% 111 111761 0.27% 112 149190 0.37% 113 126735 0.31% 114 124628 0.31% 115 128651 0.32% 116 131556 0.32% 117 142565 0.35% 118 149444 0.37% 119 149401 0.37% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 0 0.00% 140 0 0.00% 141 0 0.00% 142 0 0.00% 143 0 0.00% 144 0 0.00% 145 0 0.00% 146 0 0.00% 147 0 0.00% 148 0 0.00% 149 0 0.00% 150 0 0.00% 151 36526490 89.73% 40709170 reads passed initial QC criterion=sequence-density sequence-density=8.96 sequence-density-rank=1 fanout-score=40.90 fanout-score-rank=1 prefix-density=10.82 prefix-fanout=33.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGGCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=8.96 sequence-density-rank=1 fanout-score=40.90 fanout-score-rank=1 prefix-density=10.82 prefix-fanout=33.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGGCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGGCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR11462694 - Input file: STDIN trimmed: SRR11462694-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGGCGATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Thu Apr 10 11:49:30 2025 >> started Thu Apr 10 11:50:15 2025 >> done (44.776s) 31662688 reads processed; of these: 292 ( 0.00%) short reads filtered out after trimming by size control 6 ( 0.00%) empty reads filtered out after trimming by size control 31662390 (100.00%) reads available; of these: 5845175 (18.46%) trimmed reads available after processing 25817215 (81.54%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1673 0.01% 19 1820 0.01% 20 2004 0.01% 21 2142 0.01% 22 2522 0.01% 23 2573 0.01% 24 2778 0.01% 25 2787 0.01% 26 3087 0.01% 27 3333 0.01% 28 3413 0.01% 29 3597 0.01% 30 3732 0.01% 31 3823 0.01% 32 3891 0.01% 33 4125 0.01% 34 4243 0.01% 35 4525 0.01% 36 4595 0.01% 37 5548 0.02% 38 4733 0.01% 39 5250 0.02% 40 5260 0.02% 41 5290 0.02% 42 5936 0.02% 43 6069 0.02% 44 6111 0.02% 45 6863 0.02% 46 7164 0.02% 47 8966 0.03% 48 7804 0.02% 49 8723 0.03% 50 8391 0.03% 51 8747 0.03% 52 8860 0.03% 53 9637 0.03% 54 10321 0.03% 55 10733 0.03% 56 11023 0.03% 57 11948 0.04% 58 11422 0.04% 59 13039 0.04% 60 12983 0.04% 61 13315 0.04% 62 21697 0.07% 63 14806 0.05% 64 15646 0.05% 65 15550 0.05% 66 15683 0.05% 67 17961 0.06% 68 17392 0.05% 69 19223 0.06% 70 18850 0.06% 71 20741 0.07% 72 21927 0.07% 73 22944 0.07% 74 25734 0.08% 75 23881 0.08% 76 22866 0.07% 77 25165 0.08% 78 26115 0.08% 79 29274 0.09% 80 27671 0.09% 81 30824 0.10% 82 29879 0.09% 83 31349 0.10% 84 32834 0.10% 85 35600 0.11% 86 37818 0.12% 87 38239 0.12% 88 38203 0.12% 89 52319 0.17% 90 41993 0.13% 91 43610 0.14% 92 43663 0.14% 93 47109 0.15% 94 50164 0.16% 95 50534 0.16% 96 57322 0.18% 97 55707 0.18% 98 55281 0.17% 99 57832 0.18% 100 56830 0.18% 101 63045 0.20% 102 75039 0.24% 103 66743 0.21% 104 68723 0.22% 105 71745 0.23% 106 75646 0.24% 107 78028 0.25% 108 81632 0.26% 109 92343 0.29% 110 87476 0.28% 111 87541 0.28% 112 117071 0.37% 113 98812 0.31% 114 97722 0.31% 115 99855 0.32% 116 102796 0.32% 117 107111 0.34% 118 112809 0.36% 119 116137 0.37% 120 122955 0.39% 121 124508 0.39% 122 127973 0.40% 123 165276 0.52% 124 152516 0.48% 125 138960 0.44% 126 143747 0.45% 127 149666 0.47% 128 147512 0.47% 129 152167 0.48% 130 154177 0.49% 131 165645 0.52% 132 169966 0.54% 133 183659 0.58% 134 168939 0.53% 135 183995 0.58% 136 176452 0.56% 137 192662 0.61% 138 209449 0.66% 139 193509 0.61% 140 218540 0.69% 141 189335 0.60% 142 199639 0.63% 143 208778 0.66% 144 207005 0.65% 145 209770 0.66% 146 224883 0.71% 147 338924 1.07% 148 700670 2.21% 149 0 0.00% 150 0 0.00% 151 22675804 71.62% criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=32 prefix-density=0.44 prefix-fanout=2.0 sequence=ACGTGAGCTGGGTTCAGAACGTCGTGAGACAGTTCGGTCCATATCCGGTGTGGGCGTTAGAGCATTGAGAGGACCTTTCCCTAGTACGAGAGGACCGGGAAGGACGCACCTCTGGTGTACCAGTTATTGTGCCCACGGTAAACGCTGGGTAGCCAAGTGCGGAGCGGATAACTGCTGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=646.88 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=18.0 sequence=TTGGATTTGATTAGATCCACCAATAAAAAGGGCTTGCCTTACACTCTTGGTCTTAATCAATTTGCTGATTGGACATGGCAAGAGTTCCAAAAGTACAGACTGGGAGCTGCCCAAAATTGCTCTGCAACCACAAGGGGCAATCACAAGCTTACGAACGCTCTTCTTCCTGAAACGAAAGACTGGAGGGAAGAAGGCATAGTCAGTCCCGTTAAGAATCAAGGTCACTGTGGATCTTGCTGGACTTTCAGCACCACTGGAGCTCTAGAGGCTGCTTACCACCAGGCTTTTGGGAAAGGAATCTCTCTGTCTGAACAGCAGCTTGTGGACTGTGCTAGAGCATTTAATAACTTTGGCTGCAATG Started job on | Apr 10 11:51:01 Started mapping on | Apr 10 11:51:01 Finished on | Apr 10 11:52:14 Mapping speed, Million of reads per hour | 2007.56 Number of input reads | 40708872 Average input read length | 143 UNIQUE READS: Uniquely mapped reads number | 36583634 Uniquely mapped reads % | 89.87% Average mapped length | 141.34 Number of splices: Total | 17354009 Number of splices: Annotated (sjdb) | 16987790 Number of splices: GT/AG | 17043460 Number of splices: GC/AG | 235903 Number of splices: AT/AC | 10887 Number of splices: Non-canonical | 63759 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.02% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1221260 % of reads mapped to multiple loci | 3.00% Number of reads mapped to too many loci | 1193921 % of reads mapped to too many loci | 2.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.12% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2903978 2903978 2903978 N_multimapping 1221260 1221260 1221260 N_noFeature 1631403 2011730 35827009 N_ambiguous 521990 145725 693 UnstrandedReadsAssigned:34430241 PositiveStrandReadsAssigned:34426179 NegativeStrandReadsAssigned:755932 Dataset is classified positive stranded MeadianReadLen=151 20thPercentileLength=139 echo kmer=135 SRR11462694 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR11462694-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,708,872 reads, 35,482,898 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52401 SRR11462694.ke.tsv 34699 SRR11462694.se.tsv 87100 total ==> SRR11462694.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1545 26.3677 Potri.005G024800.1.v4.1 1035 936 440 15.3956 Potri.004G059700.1.v4.1 961 862 49 1.86169 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 3168.6 36.4886 Potri.016G087400.1.v4.1 270 171 3748 717.832 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 365 7.14096 Potri.012G127500.1.v4.1 977 878 69 2.57379 ==> SRR11462694.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 390 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 202 Potri.001G212900.v4.1 23 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 69 SRR11462694 completed mapping pipeline successfully