Starting /dee2/code/volunteer_pipeline.sh SRR11462705 current disk space = 3050301460480 free memory = 1480638356 SRR11462705 SRAfilesize 7d85a47f7244229dc0f14a30c3eb92bf SRR11462705.sra SRR11462705.sra file validated SRR11462705 is single end SRR11462705 is conventional basespace SRR11462705 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11462705_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.77125 32.0 2.0 32.0 2.0 32.0 2 31.715 32.0 32.0 32.0 32.0 32.0 3 34.69 37.0 32.0 37.0 32.0 37.0 4 36.1525 37.0 37.0 37.0 32.0 37.0 5 36.52 37.0 37.0 37.0 37.0 37.0 6 40.10225 41.0 41.0 41.0 37.0 41.0 7 40.1995 41.0 41.0 41.0 37.0 41.0 8 40.1535 41.0 41.0 41.0 37.0 41.0 9 40.38325 41.0 41.0 41.0 41.0 41.0 10-14 40.327749999999995 41.0 41.0 41.0 41.0 41.0 15-19 40.30395 41.0 41.0 41.0 40.2 41.0 20-24 40.214299999999994 41.0 41.0 41.0 40.2 41.0 25-29 40.190099999999994 41.0 41.0 41.0 39.4 41.0 30-34 40.074400000000004 41.0 41.0 41.0 37.8 41.0 35-39 40.04615 41.0 41.0 41.0 37.0 41.0 40-44 40.1255 41.0 41.0 41.0 37.8 41.0 45-49 40.108 41.0 41.0 41.0 37.8 41.0 50-54 40.057 41.0 41.0 41.0 37.8 41.0 55-59 39.97545 41.0 41.0 41.0 37.0 41.0 60-64 40.0172 41.0 41.0 41.0 37.0 41.0 65-69 39.9834 41.0 41.0 41.0 37.0 41.0 70-74 39.803149999999995 41.0 41.0 41.0 37.0 41.0 75-79 39.687149999999995 41.0 40.2 41.0 37.0 41.0 80-84 40.12515 41.0 41.0 41.0 37.0 41.0 85-89 40.162850000000006 41.0 41.0 41.0 38.6 41.0 90-94 40.00165 41.0 41.0 41.0 37.0 41.0 95-99 40.01435 41.0 41.0 41.0 37.0 41.0 100-104 39.91875 41.0 41.0 41.0 37.0 41.0 105-109 39.769450000000006 41.0 41.0 41.0 37.0 41.0 110-114 39.7866 41.0 41.0 41.0 37.0 41.0 115-119 39.725350000000006 41.0 41.0 41.0 37.0 41.0 120-124 39.5983 41.0 41.0 41.0 37.0 41.0 125-129 39.57485 41.0 41.0 41.0 37.0 41.0 130-134 39.450450000000004 41.0 41.0 41.0 37.0 41.0 135-139 39.15385 41.0 41.0 41.0 36.0 41.0 140-144 39.089999999999996 41.0 41.0 41.0 35.0 41.0 145-149 38.777 41.0 41.0 41.0 33.0 41.0 150-151 37.935874999999996 41.0 39.0 41.0 29.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 3.0 25 2.0 26 2.0 27 5.0 28 13.0 29 19.0 30 22.0 31 31.0 32 43.0 33 65.0 34 56.0 35 73.0 36 97.0 37 128.0 38 148.0 39 257.0 40 3035.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 5.405405405405405 38.761546356483066 41.087923366404375 14.74512487170715 2 28.225 41.25 18.9 11.625 3 22.675 29.099999999999998 37.9 10.325 4 34.275 24.725 27.200000000000003 13.8 5 28.4 25.074999999999996 28.499999999999996 18.025 6 25.775 26.35 28.349999999999998 19.525000000000002 7 22.425 26.900000000000002 30.8 19.875 8 25.75 25.324999999999996 31.0 17.925 9 23.325000000000003 23.724999999999998 30.775000000000002 22.175 10-14 24.41 25.775 29.89 19.925 15-19 23.965 27.200000000000003 28.89 19.945 20-24 24.895 26.195 28.685 20.225 25-29 24.45 26.43 28.705000000000002 20.415 30-34 24.65 26.650000000000002 27.950000000000003 20.75 35-39 24.755 27.075 27.529999999999998 20.64 40-44 24.42 27.169999999999998 28.27 20.14 45-49 24.021201060053002 26.581329066453325 28.606430321516076 20.7910395519776 50-54 24.529999999999998 26.455000000000002 28.315 20.7 55-59 24.95 26.090000000000003 28.384999999999998 20.575 60-64 23.925 26.235000000000003 29.585 20.255000000000003 65-69 25.18251825182518 26.387638763876385 27.767776777677767 20.662066206620665 70-74 24.817481748174817 26.552655265526553 27.987798779877988 20.642064206420642 75-79 24.905 25.900000000000002 29.025000000000002 20.169999999999998 80-84 25.306265313265662 26.161308065403272 28.466423321166058 20.066003300165008 85-89 24.759999999999998 27.029999999999998 28.235 19.975 90-94 25.228784317647644 25.923888583287493 28.58928839325899 20.25803870580587 95-99 24.779999999999998 26.229999999999997 28.439999999999998 20.549999999999997 100-104 25.215 26.365 28.29 20.13 105-109 24.375 26.479999999999997 28.17 20.974999999999998 110-114 24.675 26.805 27.785 20.735 115-119 24.685000000000002 27.115000000000002 28.194999999999997 20.005 120-124 24.34 27.189999999999998 28.15 20.32 125-129 24.175 27.565 27.455000000000002 20.805 130-134 23.810000000000002 28.65 27.025 20.515 135-139 24.825 27.355 26.375 21.445 140-144 24.915000000000003 27.72 26.195 21.17 145-149 24.005000000000003 28.194999999999997 25.835 21.965 150-151 22.912499999999998 28.125 26.5 22.4625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 3.5 25 5.5 26 5.0 27 6.0 28 10.0 29 14.0 30 17.5 31 24.0 32 39.0 33 46.0 34 59.0 35 86.0 36 92.5 37 108.5 38 139.5 39 159.0 40 177.5 41 206.0 42 246.0 43 262.0 44 264.0 45 264.0 46 233.5 47 223.5 48 214.0 49 171.0 50 143.0 51 112.5 52 97.5 53 102.0 54 87.0 55 73.5 56 58.5 57 46.0 58 39.0 59 24.0 60 24.0 61 22.5 62 15.5 63 19.0 64 13.5 65 5.0 66 3.0 67 2.5 68 4.5 69 5.0 70 6.5 71 7.5 72 4.0 73 2.0 74 2.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 26.924999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.01 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.015 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.3 #Duplication Level Percentage of deduplicated Percentage of total 1 94.38663745892661 86.175 2 3.9978094194961664 7.3 3 0.9583789704271631 2.625 4 0.24644030668127057 0.8999999999999999 5 0.16429353778751368 0.75 6 0.10952902519167579 0.6 7 0.054764512595837894 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.08214676889375684 1.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TATTTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACA 23 0.575 No Hit TATTTTACTTATTCCGTGAATCGGAGGCGGGGCGCTGCCCCTCTTTTTGG 15 0.375 No Hit ATGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTTACTT 14 0.35000000000000003 No Hit TACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCC 7 0.17500000000000002 No Hit CGGGCCGCCTTGAAGTACAATTCCCACCGAGCGGCGGGTAGAATCCTTTG 7 0.17500000000000002 No Hit AATCCGGGCTAGATGCGACGCGTGCGCCCGCCGTCCGATTGCCGACCTGC 6 0.15 No Hit ACTACTTTTAACGTTATTTTACTTATTCCGTGAATCGGAGGCGGGGCGCT 6 0.15 No Hit CGGTGAAAGAGCCGCGCGGGCCGCCTTGAAGTACAATTCCCACCGAGCGG 6 0.15 No Hit TTAATCAAGAACGAAAGTTGGGGGCTCGAAGACGATCAGATACCGTCCTA 6 0.15 No Hit AATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAACC 5 0.125 No Hit NATTTTACTTATTCCGTGAATCGGAGGCGGGGCGCTGCCCCTCTTTTTGG 5 0.125 No Hit CTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCC 5 0.125 No Hit TCAGATATCTAACGGTGGAGTCTCGTGGTTCGTCGGAACAAGTATTCTGC 5 0.125 No Hit TGCAACAAACCCCGACTTCTGGAAGGGACGCATTTATTAGATAAAAGGTC 5 0.125 No Hit ACCTGGGGCTGTAGTATGTTCCAAGGGTTGGGCTGTTCGCCCATTAAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.037500000000000006 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.2125 0.0 0.0 0.0 0.0 34-35 0.25 0.0 0.0 0.0 0.0 36-37 0.25 0.0 0.0 0.0 0.0 38-39 0.3125 0.0 0.0 0.0 0.0 40-41 0.35 0.0 0.0 0.0 0.0 42-43 0.4 0.0 0.0 0.0 0.0 44-45 0.4375 0.0 0.0 0.0 0.0 46-47 0.45 0.0 0.0 0.0 0.0 48-49 0.475 0.0 0.0 0.0 0.0 50-51 0.5 0.0 0.0 0.0 0.0 52-53 0.525 0.0 0.0 0.0 0.0 54-55 0.6125 0.0 0.0 0.0 0.0 56-57 0.625 0.0 0.0 0.0 0.0 58-59 0.7375 0.0 0.0 0.0 0.0 60-61 0.825 0.0 0.0 0.0 0.0 62-63 0.8374999999999999 0.0 0.0 0.0 0.0 64-65 0.8875 0.0 0.0 0.0 0.0 66-67 1.025 0.0 0.0 0.0 0.0 68-69 1.1375000000000002 0.0 0.0 0.0 0.0 70-71 1.3250000000000002 0.0 0.0 0.0 0.0 72-73 1.3875 0.0 0.0 0.0 0.0 74-75 1.4500000000000002 0.0 0.0 0.0 0.0 76-77 1.6125 0.0 0.0 0.0 0.0 78-79 1.8375 0.0 0.0 0.0 0.0 80-81 2.05 0.0 0.0 0.0 0.0 82-83 2.175 0.0 0.0 0.0 0.0 84-85 2.2750000000000004 0.0 0.0 0.0 0.0 86-87 2.6500000000000004 0.0 0.0 0.0 0.0 88-89 2.8375 0.0 0.0 0.0 0.0 90-91 3.0250000000000004 0.0 0.0 0.0 0.0 92-93 3.2 0.0 0.0 0.0 0.0 94-95 3.575 0.0 0.0 0.0 0.0 96-97 4.075 0.0 0.0 0.0 0.0 98-99 4.45 0.0 0.0 0.0 0.0 100-101 4.775 0.0 0.0 0.0 0.0 102-103 5.2875 0.0 0.0 0.0 0.0 104-105 5.862500000000001 0.0 0.0 0.0 0.0 106-107 6.425 0.0 0.0 0.0 0.0 108-109 7.025 0.0 0.0 0.0 0.0 110-111 7.725 0.0 0.0 0.0 0.0 112-113 8.575 0.0 0.0 0.0 0.0 114-115 9.45 0.0 0.0 0.0 0.0 116-117 10.3125 0.0 0.0 0.0 0.0 118-119 11.2625 0.0 0.0 0.0 0.0 120-121 12.4 0.0 0.0 0.0 0.0 122-123 13.3125 0.0 0.0 0.0 0.0 124-125 14.5125 0.0 0.0 0.0 0.0 126-127 15.537500000000001 0.0 0.0 0.0 0.0 128-129 16.4 0.0 0.0 0.0 0.0 130-131 17.950000000000003 0.0 0.0 0.0 0.0 132-133 19.65 0.0 0.0 0.0 0.0 134-135 20.9 0.0 0.0 0.0 0.0 136-137 22.3375 0.0 0.0 0.0 0.0 138-139 24.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATCCT 10 0.00686971 144.72499 7 >>END_MODULE Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202891 READS because READLEN < 1 Read 2202891 spots for SRR11462705.sra Written 2202891 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra Rejected 2202890 READS because READLEN < 1 Read 2202890 spots for SRR11462705.sra Written 2202890 spots for SRR11462705.sra SRR ids: ['SRR11462705.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hwkiu9id SRR11462705.sra spots: 44057801 blocks: [[1, 2202890], [2202891, 4405780], [4405781, 6608670], [6608671, 8811560], [8811561, 11014450], [11014451, 13217340], [13217341, 15420230], [15420231, 17623120], [17623121, 19826010], [19826011, 22028900], [22028901, 24231790], [24231791, 26434680], [26434681, 28637570], [28637571, 30840460], [30840461, 33043350], [33043351, 35246240], [35246241, 37449130], [37449131, 39652020], [39652021, 41854910], [41854911, 44057801]] SRR11462705 file size 14951067 SRR11462705 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11462705 SRR11462705_1.fastq Input file: SRR11462705_1.fastq trimmed: SRR11462705-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 06:56:59 2025 >> started Wed Feb 12 06:57:25 2025 >> done (26.286s) 44057801 reads processed; of these: 9402 ( 0.02%) short reads filtered out after trimming by size control 873 ( 0.00%) empty reads filtered out after trimming by size control 44047526 (99.98%) reads available; of these: 5508333 (12.51%) trimmed reads available after processing 38539193 (87.49%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2291 0.01% 19 2488 0.01% 20 2843 0.01% 21 2903 0.01% 22 3363 0.01% 23 3576 0.01% 24 3816 0.01% 25 3598 0.01% 26 3799 0.01% 27 4440 0.01% 28 4294 0.01% 29 4521 0.01% 30 4655 0.01% 31 4870 0.01% 32 5181 0.01% 33 5080 0.01% 34 5500 0.01% 35 5791 0.01% 36 6036 0.01% 37 7402 0.02% 38 6412 0.01% 39 6617 0.02% 40 6780 0.02% 41 6956 0.02% 42 8275 0.02% 43 8416 0.02% 44 8101 0.02% 45 8890 0.02% 46 9358 0.02% 47 11557 0.03% 48 10750 0.02% 49 12383 0.03% 50 10819 0.02% 51 11686 0.03% 52 12371 0.03% 53 12701 0.03% 54 14474 0.03% 55 14314 0.03% 56 14715 0.03% 57 17214 0.04% 58 15997 0.04% 59 17212 0.04% 60 18551 0.04% 61 18677 0.04% 62 32259 0.07% 63 20157 0.05% 64 21712 0.05% 65 21432 0.05% 66 22731 0.05% 67 24698 0.06% 68 24047 0.05% 69 29136 0.07% 70 26732 0.06% 71 30173 0.07% 72 32565 0.07% 73 37545 0.09% 74 36404 0.08% 75 36342 0.08% 76 33845 0.08% 77 40492 0.09% 78 39381 0.09% 79 47322 0.11% 80 41272 0.09% 81 43424 0.10% 82 47841 0.11% 83 49808 0.11% 84 56079 0.13% 85 54046 0.12% 86 58274 0.13% 87 62394 0.14% 88 63678 0.14% 89 90051 0.20% 90 69152 0.16% 91 73147 0.17% 92 69835 0.16% 93 73867 0.17% 94 82230 0.19% 95 83514 0.19% 96 97151 0.22% 97 96621 0.22% 98 92860 0.21% 99 98304 0.22% 100 98970 0.22% 101 110233 0.25% 102 124318 0.28% 103 121692 0.28% 104 118690 0.27% 105 125515 0.28% 106 129480 0.29% 107 136250 0.31% 108 145295 0.33% 109 160328 0.36% 110 153572 0.35% 111 161459 0.37% 112 247240 0.56% 113 173289 0.39% 114 177253 0.40% 115 179142 0.41% 116 186156 0.42% 117 202264 0.46% 118 209987 0.48% 119 217006 0.49% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 0 0.00% 140 0 0.00% 141 0 0.00% 142 0 0.00% 143 0 0.00% 144 0 0.00% 145 0 0.00% 146 0 0.00% 147 0 0.00% 148 0 0.00% 149 0 0.00% 150 0 0.00% 151 38539193 87.49% 44047526 reads passed initial QC criterion=sequence-density sequence-density=11.71 sequence-density-rank=1 fanout-score=40.82 fanout-score-rank=1 prefix-density=14.09 prefix-fanout=33.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=11.71 sequence-density-rank=1 fanout-score=40.82 fanout-score-rank=1 prefix-density=14.09 prefix-fanout=33.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG -o SRR11462705 - Input file: STDIN trimmed: SRR11462705-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 06:59:04 2025 >> started Wed Feb 12 06:59:54 2025 >> done (50.196s) 36706272 reads processed; of these: 290 ( 0.00%) short reads filtered out after trimming by size control 4 ( 0.00%) empty reads filtered out after trimming by size control 36705978 (100.00%) reads available; of these: 8447775 (23.01%) trimmed reads available after processing 28258203 (76.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1940 0.01% 19 2107 0.01% 20 2413 0.01% 21 2429 0.01% 22 2828 0.01% 23 3001 0.01% 24 3228 0.01% 25 3062 0.01% 26 3192 0.01% 27 3698 0.01% 28 3604 0.01% 29 3821 0.01% 30 3915 0.01% 31 4130 0.01% 32 4330 0.01% 33 4279 0.01% 34 4601 0.01% 35 4852 0.01% 36 5097 0.01% 37 6231 0.02% 38 5342 0.01% 39 5531 0.02% 40 5740 0.02% 41 5834 0.02% 42 6928 0.02% 43 7101 0.02% 44 6748 0.02% 45 7468 0.02% 46 7917 0.02% 47 9770 0.03% 48 8986 0.02% 49 10321 0.03% 50 9067 0.02% 51 9767 0.03% 52 10312 0.03% 53 10734 0.03% 54 12207 0.03% 55 12131 0.03% 56 12174 0.03% 57 14522 0.04% 58 13331 0.04% 59 14439 0.04% 60 15685 0.04% 61 15782 0.04% 62 27003 0.07% 63 16931 0.05% 64 18150 0.05% 65 18082 0.05% 66 19131 0.05% 67 20665 0.06% 68 20380 0.06% 69 24330 0.07% 70 22804 0.06% 71 25169 0.07% 72 27473 0.07% 73 31575 0.09% 74 30469 0.08% 75 30183 0.08% 76 28547 0.08% 77 33980 0.09% 78 33054 0.09% 79 39596 0.11% 80 34523 0.09% 81 37960 0.10% 82 40225 0.11% 83 41638 0.11% 84 45726 0.12% 85 45352 0.12% 86 49048 0.13% 87 52440 0.14% 88 53846 0.15% 89 75324 0.21% 90 59275 0.16% 91 61716 0.17% 92 58930 0.16% 93 61738 0.17% 94 68921 0.19% 95 69710 0.19% 96 81675 0.22% 97 80471 0.22% 98 78018 0.21% 99 82954 0.23% 100 82755 0.23% 101 92941 0.25% 102 104124 0.28% 103 102291 0.28% 104 99206 0.27% 105 105452 0.29% 106 108408 0.30% 107 114168 0.31% 108 122417 0.33% 109 134546 0.37% 110 128721 0.35% 111 135310 0.37% 112 208232 0.57% 113 143970 0.39% 114 148072 0.40% 115 148730 0.41% 116 155712 0.42% 117 163644 0.45% 118 169310 0.46% 119 177798 0.48% 120 191671 0.52% 121 198421 0.54% 122 193319 0.53% 123 244499 0.67% 124 233392 0.64% 125 208291 0.57% 126 223791 0.61% 127 228841 0.62% 128 227473 0.62% 129 226709 0.62% 130 227138 0.62% 131 244026 0.66% 132 273092 0.74% 133 282626 0.77% 134 257063 0.70% 135 285048 0.78% 136 263716 0.72% 137 290623 0.79% 138 298852 0.81% 139 288946 0.79% 140 308456 0.84% 141 280116 0.76% 142 298018 0.81% 143 301762 0.82% 144 292960 0.80% 145 368475 1.00% 146 316804 0.86% 147 436363 1.19% 148 790010 2.15% 149 0 0.00% 150 0 0.00% 151 23822063 64.90% criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=31 prefix-density=0.86 prefix-fanout=2.0 sequence=ACGTGAGCTGGGTTCAGAACGTCGTGAGACAGTTCGGTCCATATCCGGTGTGGGCGTTAGAGCATTGAGAGGACCTTTCCCTAGTACGAGAGGACCGGGAAGGACGCACCTCTGGTGTACCAGTTATTGTGCCCACGGTAAACGCTGGGTAGCCAAGTGCGGAGCGGATAACTGCTGAAAGCATCTAAGTAGTAAGCCCACCCCAAGATGAGTGCTCTCCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=159.29 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=7.5 sequence=TGTTGAAGAATGAGCCGGCGACTCATAGGCAGTGGCTTGGTTAAGGGAACCCACCGGAGCCGTAGCGAAAGCGAGTCTTCATAGGGCAATTGTCACTGCTTATGGACCCGAACCTGGGTGATCTATCCATGACCAGGATGAAGCTTGGGTGAAACTAAGTGGAGGTCCGAACCGACTGATGTTGAAGAATCAGCGGATGAGTTGTGGTTAGGGGTGAAATGCCACTCGAACCCAGAGCTAGCTGGTTCTCCCCGAAATGCGTTGAGGCGCAGCAGTTGACTGGACATCTAGGGGTAAAGCACTGTTTCGGTGCGGGCCGCGAGAGCGGTACCAAATCGAGGCAAACTCTGAATACTAGATATGACCTCAAAATAACAGGGGTCAAGGTCGGCCAGTGAGACGGTGGGGGATAAGCTTCATCGTCGAGAGGGAAACAGCCCGGATCACCAGCTAAGGCCCCTAAATGACCGCTCAGTGATAAAGGAGGTAGGGGTGCAGAGACAGCCAGGAG Started job on | Feb 12 07:00:34 Started mapping on | Feb 12 07:00:35 Finished on | Feb 12 07:02:28 Mapping speed, Million of reads per hour | 1403.27 Number of input reads | 44047232 Average input read length | 141 UNIQUE READS: Uniquely mapped reads number | 35917226 Uniquely mapped reads % | 81.54% Average mapped length | 138.49 Number of splices: Total | 16192248 Number of splices: Annotated (sjdb) | 15843215 Number of splices: GT/AG | 15916835 Number of splices: GC/AG | 212826 Number of splices: AT/AC | 9910 Number of splices: Non-canonical | 52677 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1095086 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 4333446 % of reads mapped to too many loci | 9.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.01% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7034920 7034920 7034920 N_multimapping 1095086 1095086 1095086 N_noFeature 2305799 2731962 35027768 N_ambiguous 595044 131812 856 UnstrandedReadsAssigned:33016383 PositiveStrandReadsAssigned:33053452 NegativeStrandReadsAssigned:888602 Dataset is classified positive stranded MeadianReadLen=151 20thPercentileLength=132 echo kmer=127 SRR11462705 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR11462705-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,047,232 reads, 35,529,577 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,230 rounds 52401 SRR11462705.ke.tsv 34699 SRR11462705.se.tsv 87100 total ==> SRR11462705.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2199 38.2933 Potri.005G024800.1.v4.1 1035 936 885 31.5966 Potri.004G059700.1.v4.1 961 862 28 1.08548 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 3893.79 45.7525 Potri.016G087400.1.v4.1 270 171 2687 525.103 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 547 10.9195 Potri.012G127500.1.v4.1 977 878 130 4.94791 ==> SRR11462705.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 75 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 19 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 20 SRR11462705 completed mapping pipeline successfully