Starting /dee2/code/volunteer_pipeline.sh SRR11462707 current disk space = 3049901670400 free memory = 1369763128 SRR11462707 SRAfilesize ecd252d7ff863d5413e977818b457024 SRR11462707.sra SRR11462707.sra file validated SRR11462707 is single end SRR11462707 is conventional basespace SRR11462707 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11462707_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.0825 32.0 32.0 32.0 2.0 32.0 2 31.745 32.0 32.0 32.0 32.0 32.0 3 34.88625 37.0 32.0 37.0 32.0 37.0 4 36.2175 37.0 37.0 37.0 32.0 37.0 5 36.55 37.0 37.0 37.0 37.0 37.0 6 40.0355 41.0 41.0 41.0 37.0 41.0 7 40.173 41.0 41.0 41.0 37.0 41.0 8 40.13475 41.0 41.0 41.0 37.0 41.0 9 40.32 41.0 41.0 41.0 41.0 41.0 10-14 40.30535 41.0 41.0 41.0 40.2 41.0 15-19 40.26705 41.0 41.0 41.0 39.4 41.0 20-24 40.2369 41.0 41.0 41.0 38.6 41.0 25-29 40.16045 41.0 41.0 41.0 37.8 41.0 30-34 40.061150000000005 41.0 41.0 41.0 37.8 41.0 35-39 40.07705 41.0 41.0 41.0 37.8 41.0 40-44 40.1072 41.0 41.0 41.0 37.0 41.0 45-49 39.9996 41.0 41.0 41.0 37.0 41.0 50-54 39.9911 41.0 41.0 41.0 37.0 41.0 55-59 40.010349999999995 41.0 41.0 41.0 37.0 41.0 60-64 40.0266 41.0 41.0 41.0 37.0 41.0 65-69 40.0027 41.0 41.0 41.0 37.0 41.0 70-74 39.926249999999996 41.0 41.0 41.0 37.0 41.0 75-79 39.721 41.0 40.2 41.0 37.0 41.0 80-84 40.1918 41.0 41.0 41.0 39.4 41.0 85-89 40.1879 41.0 41.0 41.0 41.0 41.0 90-94 40.0846 41.0 41.0 41.0 37.0 41.0 95-99 40.05445 41.0 41.0 41.0 38.6 41.0 100-104 39.88985 41.0 41.0 41.0 37.0 41.0 105-109 39.79905 41.0 41.0 41.0 37.0 41.0 110-114 39.81935 41.0 41.0 41.0 37.0 41.0 115-119 39.737300000000005 41.0 41.0 41.0 37.0 41.0 120-124 39.60755 41.0 41.0 41.0 37.0 41.0 125-129 39.5747 41.0 41.0 41.0 37.0 41.0 130-134 39.3481 41.0 41.0 41.0 37.0 41.0 135-139 39.0981 41.0 41.0 41.0 36.0 41.0 140-144 39.06845 41.0 41.0 41.0 36.0 41.0 145-149 38.618700000000004 41.0 41.0 41.0 32.0 41.0 150-151 37.84025 41.0 39.0 41.0 29.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 6.0 27 9.0 28 13.0 29 18.0 30 27.0 31 22.0 32 33.0 33 64.0 34 65.0 35 98.0 36 80.0 37 126.0 38 157.0 39 236.0 40 3044.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 6.385037084811351 38.66494679135762 40.148339245404706 14.801676878426315 2 26.85 42.0 19.5 11.65 3 22.650000000000002 30.55 37.375 9.425 4 34.875 24.474999999999998 26.25 14.399999999999999 5 28.15 25.650000000000002 27.625 18.575 6 25.0 28.449999999999996 27.575 18.975 7 23.150000000000002 27.250000000000004 31.374999999999996 18.224999999999998 8 24.5 27.375 29.2 18.925 9 23.150000000000002 23.925 31.15 21.775 10-14 25.224999999999998 25.965 29.235 19.575 15-19 25.105 26.924999999999997 28.605000000000004 19.365 20-24 25.014999999999997 27.11 28.035 19.84 25-29 24.115000000000002 26.474999999999998 29.095 20.315 30-34 24.51 26.655 28.62 20.215 35-39 24.77 26.540000000000003 28.689999999999998 20.0 40-44 23.945 27.1 28.73 20.225 45-49 24.291214560728037 27.256362818140907 28.31641582079104 20.136006800340017 50-54 25.045 26.905 28.155 19.895 55-59 24.23 27.439999999999998 28.884999999999998 19.445 60-64 24.395 26.515 28.875 20.215 65-69 25.312531253125314 26.707670767076706 27.97779777977798 20.00200020002 70-74 24.967496749674968 26.957695769576954 27.952795279527955 20.122012201220123 75-79 24.375 26.6 28.53 20.495 80-84 24.756237811890593 26.77133856692835 28.266413320666032 20.206010300515025 85-89 24.625 27.589999999999996 27.884999999999998 19.900000000000002 90-94 25.288793318997847 25.95889383407511 28.424263639545934 20.328049207381106 95-99 24.224999999999998 27.474999999999998 28.175 20.125 100-104 24.175 27.515 27.955000000000002 20.355 105-109 24.15 26.845000000000002 27.935 21.07 110-114 24.395 27.305 27.400000000000002 20.9 115-119 23.935000000000002 28.035 27.51 20.52 120-124 23.7 27.815 27.33 21.154999999999998 125-129 24.279999999999998 28.84 26.39 20.49 130-134 23.705000000000002 29.23 26.3 20.765 135-139 24.099999999999998 28.87 25.35 21.68 140-144 23.625 29.060000000000002 25.7 21.615000000000002 145-149 22.755 28.720000000000002 25.585 22.939999999999998 150-151 23.4125 28.262500000000003 25.525 22.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 2.0 26 2.0 27 3.5 28 5.5 29 10.0 30 15.0 31 17.5 32 27.5 33 43.5 34 61.5 35 92.0 36 110.5 37 125.0 38 155.0 39 176.0 40 196.5 41 220.0 42 243.5 43 251.0 44 255.5 45 251.5 46 239.5 47 239.0 48 219.5 49 177.0 50 147.0 51 128.0 52 103.5 53 96.0 54 87.5 55 71.0 56 52.5 57 38.0 58 31.5 59 23.0 60 17.5 61 13.0 62 10.0 63 13.0 64 9.5 65 1.5 66 0.5 67 1.5 68 2.0 69 2.0 70 3.0 71 3.0 72 2.5 73 1.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 22.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.01 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.015 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.97986577181207 88.44999999999999 2 3.8926174496644297 7.249999999999999 3 0.6442953020134228 1.7999999999999998 4 0.2684563758389262 1.0 5 0.08053691275167785 0.375 6 0.05369127516778523 0.3 7 0.0 0.0 8 0.0 0.0 9 0.026845637583892613 0.22499999999999998 >10 0.05369127516778523 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGG 12 0.3 No Hit TATTTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACA 12 0.3 No Hit TGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTG 9 0.22499999999999998 No Hit ATGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTTACTT 6 0.15 No Hit NATTTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACA 6 0.15 No Hit TAAGCGCGAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCTTTGTACAC 5 0.125 No Hit NAAGACGAACAACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAA 5 0.125 No Hit TATTTTACTTATTCCGTGAATCGGAGGCGGGGCGCTGCCCCTCTTTTTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.037500000000000006 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.0625 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1375 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.1875 0.0 0.0 0.0 0.0 34-35 0.2 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.3 0.0 0.0 0.0 0.0 42-43 0.3125 0.0 0.0 0.0 0.0 44-45 0.3625 0.0 0.0 0.0 0.0 46-47 0.4 0.0 0.0 0.0 0.0 48-49 0.55 0.0 0.0 0.0 0.0 50-51 0.6125 0.0 0.0 0.0 0.0 52-53 0.6875 0.0 0.0 0.0 0.0 54-55 0.7875 0.0 0.0 0.0 0.0 56-57 0.875 0.0 0.0 0.0 0.0 58-59 0.9625 0.0 0.0 0.0 0.0 60-61 1.15 0.0 0.0 0.0 0.0 62-63 1.2999999999999998 0.0 0.0 0.0 0.0 64-65 1.4125 0.0 0.0 0.0 0.0 66-67 1.4625 0.0 0.0 0.0 0.0 68-69 1.6 0.0 0.0 0.0 0.0 70-71 1.8 0.0 0.0 0.0 0.0 72-73 1.975 0.0 0.0 0.0 0.0 74-75 2.125 0.0 0.0 0.0 0.0 76-77 2.425 0.0 0.0 0.0 0.0 78-79 2.6875 0.0 0.0 0.0 0.0 80-81 2.8375 0.0 0.0 0.0 0.0 82-83 3.125 0.0 0.0 0.0 0.0 84-85 3.325 0.0 0.0 0.0 0.0 86-87 3.75 0.0 0.0 0.0 0.0 88-89 4.112500000000001 0.0 0.0 0.0 0.0 90-91 4.4125 0.0 0.0 0.0 0.0 92-93 4.9625 0.0 0.0 0.0 0.0 94-95 5.5875 0.0 0.0 0.0 0.0 96-97 6.025 0.0 0.0 0.0 0.0 98-99 6.4875 0.0 0.0 0.0 0.0 100-101 7.1625 0.0 0.0 0.0 0.0 102-103 7.9375 0.0 0.0 0.0 0.0 104-105 8.837499999999999 0.0 0.0 0.0 0.0 106-107 9.7 0.0 0.0 0.0 0.0 108-109 10.575 0.0 0.0 0.0 0.0 110-111 11.45 0.0 0.0 0.0 0.0 112-113 12.375 0.0 0.0 0.0 0.0 114-115 13.1875 0.0 0.0 0.0 0.0 116-117 14.25 0.0 0.0 0.0 0.0 118-119 15.5 0.0 0.0 0.0 0.0 120-121 16.95 0.0 0.0 0.0 0.0 122-123 18.525 0.0 0.0 0.0 0.0 124-125 20.6375 0.0 0.0 0.0 0.0 126-127 22.4125 0.0 0.0 0.0 0.0 128-129 23.987499999999997 0.0 0.0 0.0 0.0 130-131 25.5625 0.0 0.0 0.0 0.0 132-133 27.225 0.0 0.0 0.0 0.0 134-135 29.275 0.0 0.0 0.0 0.0 136-137 30.825000000000003 0.0 0.0 0.0 0.0 138-139 32.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGAAT 10 0.006862618 144.77501 2 CAATCAA 10 0.006862618 144.77501 5 >>END_MODULE Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790809 READS because READLEN < 1 Read 1790809 spots for SRR11462707.sra Written 1790809 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra Rejected 1790807 READS because READLEN < 1 Read 1790807 spots for SRR11462707.sra Written 1790807 spots for SRR11462707.sra SRR ids: ['SRR11462707.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_df2zx57r SRR11462707.sra spots: 35816142 blocks: [[1, 1790807], [1790808, 3581614], [3581615, 5372421], [5372422, 7163228], [7163229, 8954035], [8954036, 10744842], [10744843, 12535649], [12535650, 14326456], [14326457, 16117263], [16117264, 17908070], [17908071, 19698877], [19698878, 21489684], [21489685, 23280491], [23280492, 25071298], [25071299, 26862105], [26862106, 28652912], [28652913, 30443719], [30443720, 32234526], [32234527, 34025333], [34025334, 35816142]] SRR11462707 file size 12150191 SRR11462707 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11462707 SRR11462707_1.fastq Input file: SRR11462707_1.fastq trimmed: SRR11462707-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:36:20 2025 >> started Wed Feb 12 07:36:40 2025 >> done (20.558s) 35816142 reads processed; of these: 10731 ( 0.03%) short reads filtered out after trimming by size control 871 ( 0.00%) empty reads filtered out after trimming by size control 35804540 (99.97%) reads available; of these: 6646350 (18.56%) trimmed reads available after processing 29158190 (81.44%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2440 0.01% 19 2644 0.01% 20 2971 0.01% 21 3285 0.01% 22 3769 0.01% 23 3860 0.01% 24 4225 0.01% 25 4333 0.01% 26 4358 0.01% 27 4980 0.01% 28 4900 0.01% 29 5287 0.01% 30 5591 0.02% 31 5746 0.02% 32 5809 0.02% 33 5931 0.02% 34 6378 0.02% 35 6594 0.02% 36 6698 0.02% 37 8693 0.02% 38 7370 0.02% 39 7758 0.02% 40 7821 0.02% 41 8165 0.02% 42 9110 0.03% 43 9271 0.03% 44 9179 0.03% 45 9881 0.03% 46 10904 0.03% 47 13906 0.04% 48 12509 0.03% 49 13902 0.04% 50 12770 0.04% 51 13494 0.04% 52 14126 0.04% 53 14672 0.04% 54 16894 0.05% 55 16574 0.05% 56 17801 0.05% 57 20572 0.06% 58 18303 0.05% 59 21704 0.06% 60 21680 0.06% 61 22419 0.06% 62 32934 0.09% 63 24588 0.07% 64 26256 0.07% 65 25782 0.07% 66 27283 0.08% 67 31526 0.09% 68 30273 0.08% 69 35173 0.10% 70 34349 0.10% 71 38047 0.11% 72 39990 0.11% 73 43137 0.12% 74 46432 0.13% 75 43667 0.12% 76 43370 0.12% 77 47616 0.13% 78 50004 0.14% 79 58160 0.16% 80 53869 0.15% 81 59585 0.17% 82 59965 0.17% 83 62406 0.17% 84 68531 0.19% 85 69984 0.20% 86 76017 0.21% 87 79497 0.22% 88 80370 0.22% 89 97050 0.27% 90 84345 0.24% 91 90764 0.25% 92 89576 0.25% 93 95079 0.27% 94 105346 0.29% 95 108619 0.30% 96 117354 0.33% 97 123872 0.35% 98 117258 0.33% 99 125940 0.35% 100 127430 0.36% 101 136257 0.38% 102 158653 0.44% 103 149824 0.42% 104 148227 0.41% 105 153585 0.43% 106 162357 0.45% 107 169847 0.47% 108 175323 0.49% 109 198935 0.56% 110 186320 0.52% 111 191900 0.54% 112 253908 0.71% 113 204517 0.57% 114 206319 0.58% 115 210546 0.59% 116 216494 0.60% 117 233784 0.65% 118 237438 0.66% 119 251395 0.70% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 0 0.00% 140 0 0.00% 141 0 0.00% 142 0 0.00% 143 0 0.00% 144 0 0.00% 145 0 0.00% 146 0 0.00% 147 0 0.00% 148 0 0.00% 149 0 0.00% 150 0 0.00% 151 29158190 81.44% 35804540 reads passed initial QC criterion=sequence-density sequence-density=14.90 sequence-density-rank=1 fanout-score=39.72 fanout-score-rank=1 prefix-density=17.66 prefix-fanout=33.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTGAAA criterion=fanout-score sequence-density=14.90 sequence-density-rank=1 fanout-score=39.72 fanout-score-rank=1 prefix-density=17.66 prefix-fanout=33.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTGAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTGAAA -o SRR11462707 - Input file: STDIN trimmed: SRR11462707-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 07:37:58 2025 >> started Wed Feb 12 07:38:33 2025 >> done (35.338s) 31030601 reads processed; of these: 328 ( 0.00%) short reads filtered out after trimming by size control 4 ( 0.00%) empty reads filtered out after trimming by size control 31030269 (100.00%) reads available; of these: 8443291 (27.21%) trimmed reads available after processing 22586978 (72.79%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2129 0.01% 19 2310 0.01% 20 2628 0.01% 21 2907 0.01% 22 3310 0.01% 23 3389 0.01% 24 3667 0.01% 25 3793 0.01% 26 3791 0.01% 27 4335 0.01% 28 4219 0.01% 29 4630 0.01% 30 4858 0.02% 31 5007 0.02% 32 5058 0.02% 33 5215 0.02% 34 5612 0.02% 35 5841 0.02% 36 5878 0.02% 37 7601 0.02% 38 6382 0.02% 39 6754 0.02% 40 6865 0.02% 41 7123 0.02% 42 7956 0.03% 43 8094 0.03% 44 8038 0.03% 45 8627 0.03% 46 9590 0.03% 47 12096 0.04% 48 11009 0.04% 49 12151 0.04% 50 11210 0.04% 51 11755 0.04% 52 12349 0.04% 53 12965 0.04% 54 14729 0.05% 55 14401 0.05% 56 15339 0.05% 57 17982 0.06% 58 15964 0.05% 59 18898 0.06% 60 18998 0.06% 61 19604 0.06% 62 28742 0.09% 63 21537 0.07% 64 22794 0.07% 65 22506 0.07% 66 23833 0.08% 67 27488 0.09% 68 26680 0.09% 69 30682 0.10% 70 30156 0.10% 71 32907 0.11% 72 34938 0.11% 73 37554 0.12% 74 40454 0.13% 75 38089 0.12% 76 38028 0.12% 77 41968 0.14% 78 43584 0.14% 79 50852 0.16% 80 46972 0.15% 81 53850 0.17% 82 52187 0.17% 83 54273 0.17% 84 58226 0.19% 85 61231 0.20% 86 66368 0.21% 87 69537 0.22% 88 70715 0.23% 89 84845 0.27% 90 74637 0.24% 91 79179 0.26% 92 78261 0.25% 93 82593 0.27% 94 91861 0.30% 95 94452 0.30% 96 102535 0.33% 97 107579 0.35% 98 102616 0.33% 99 110002 0.35% 100 111564 0.36% 101 119074 0.38% 102 137943 0.44% 103 130811 0.42% 104 129142 0.42% 105 133727 0.43% 106 141448 0.46% 107 148127 0.48% 108 154016 0.50% 109 173993 0.56% 110 162399 0.52% 111 166708 0.54% 112 222107 0.72% 113 177081 0.57% 114 179461 0.58% 115 181910 0.59% 116 187928 0.61% 117 196031 0.63% 118 199359 0.64% 119 214577 0.69% 120 228395 0.74% 121 227097 0.73% 122 226077 0.73% 123 276278 0.89% 124 269942 0.87% 125 237585 0.77% 126 251356 0.81% 127 252010 0.81% 128 248119 0.80% 129 249249 0.80% 130 245959 0.79% 131 259143 0.84% 132 273173 0.88% 133 285709 0.92% 134 261675 0.84% 135 277285 0.89% 136 266058 0.86% 137 289154 0.93% 138 313669 1.01% 139 286453 0.92% 140 290384 0.94% 141 267921 0.86% 142 281561 0.91% 143 285724 0.92% 144 272428 0.88% 145 311163 1.00% 146 284176 0.92% 147 376166 1.21% 148 643077 2.07% 149 0 0.00% 150 0 0.00% 151 17016109 54.84% criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=32 prefix-density=0.74 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATTGTTATGTATTGGCCATGTCTGTGGCCTCTGGTGTGGTTTTAATGAAGTCTTATAATTAGTGTA criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=34.95 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=10.1 sequence=TGCTGCCATTGCTGTGCAAATCCTCTTGAATAGATTCCGTATTCATGGAATTATTCACTTTGGTAGTGCTGGGAGCCTTGATAAAGAAAGTATAGTGCCAGGTGATGTTTCCGTGCCGCTTGCTGTTGCTTTCACAGGAGCTTGGAATTGGAAGAAATTCGGGTCAGATGAAGGGACGCTGAACTTTGGCGAGTTTAATTATCCAGTGAACGGAGAGAACTTGTTGGCTAGCGTAGACTATGATAAAATAAAATTGTTCTCTAAAGGACAATCACCGCAGGATGTTTTCTGGTTTCCCAGCACCACATCCTGGTATAGTGCTGCCACTCAAGTGCTTCAGGATTTG Started job on | Feb 12 07:39:07 Started mapping on | Feb 12 07:39:08 Finished on | Feb 12 07:40:07 Mapping speed, Million of reads per hour | 2184.66 Number of input reads | 35804208 Average input read length | 137 UNIQUE READS: Uniquely mapped reads number | 30649940 Uniquely mapped reads % | 85.60% Average mapped length | 134.82 Number of splices: Total | 13281249 Number of splices: Annotated (sjdb) | 13017162 Number of splices: GT/AG | 13043317 Number of splices: GC/AG | 182006 Number of splices: AT/AC | 8639 Number of splices: Non-canonical | 47287 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1313799 % of reads mapped to multiple loci | 3.67% Number of reads mapped to too many loci | 2148112 % of reads mapped to too many loci | 6.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.65% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3840469 3840469 3840469 N_multimapping 1313799 1313799 1313799 N_noFeature 1470253 2080860 29711714 N_ambiguous 447919 120382 661 UnstrandedReadsAssigned:28731768 PositiveStrandReadsAssigned:28448698 NegativeStrandReadsAssigned:937565 Dataset is classified positive stranded MeadianReadLen=151 20thPercentileLength=121 echo kmer=117 SRR11462707 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR11462707-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,804,208 reads, 30,189,910 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52401 SRR11462707.ke.tsv 34699 SRR11462707.se.tsv 87100 total ==> SRR11462707.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2007.59 38.4836 Potri.005G024800.1.v4.1 1035 936 397 15.6023 Potri.004G059700.1.v4.1 961 862 30 1.28023 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 2776 35.9058 Potri.016G087400.1.v4.1 270 171 1946 418.622 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 267 5.8672 Potri.012G127500.1.v4.1 977 878 145 6.07503 ==> SRR11462707.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 197 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 181 Potri.001G212900.v4.1 334 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 29 SRR11462707 completed mapping pipeline successfully