Starting /dee2/code/volunteer_pipeline.sh SRR11462709 current disk space = 3050005610496 free memory = 1021739440 SRR11462709 SRAfilesize bec5aca51b41a0cce9ee4caaa98e7d65 SRR11462709.sra SRR11462709.sra file validated SRR11462709 is single end SRR11462709 is conventional basespace SRR11462709 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11462709_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.44 32.0 12.0 32.0 2.0 32.0 2 31.79125 32.0 32.0 32.0 32.0 32.0 3 34.82625 37.0 32.0 37.0 32.0 37.0 4 36.22 37.0 37.0 37.0 32.0 37.0 5 36.49125 37.0 37.0 37.0 37.0 37.0 6 40.062 41.0 41.0 41.0 37.0 41.0 7 40.122 41.0 41.0 41.0 37.0 41.0 8 40.04575 41.0 41.0 41.0 37.0 41.0 9 40.319 41.0 41.0 41.0 37.0 41.0 10-14 40.311699999999995 41.0 41.0 41.0 41.0 41.0 15-19 40.27785 41.0 41.0 41.0 38.6 41.0 20-24 40.180899999999994 41.0 41.0 41.0 37.0 41.0 25-29 40.17315000000001 41.0 41.0 41.0 37.0 41.0 30-34 40.0753 41.0 41.0 41.0 37.0 41.0 35-39 40.0343 41.0 41.0 41.0 37.8 41.0 40-44 40.0867 41.0 41.0 41.0 37.8 41.0 45-49 40.04105 41.0 41.0 41.0 37.0 41.0 50-54 40.05714999999999 41.0 41.0 41.0 37.0 41.0 55-59 39.988 41.0 41.0 41.0 37.0 41.0 60-64 40.03185 41.0 41.0 41.0 37.0 41.0 65-69 39.9571 41.0 41.0 41.0 37.0 41.0 70-74 39.8737 41.0 41.0 41.0 37.0 41.0 75-79 39.709500000000006 41.0 41.0 41.0 37.0 41.0 80-84 40.1388 41.0 41.0 41.0 37.0 41.0 85-89 40.1498 41.0 41.0 41.0 38.6 41.0 90-94 40.0681 41.0 41.0 41.0 37.0 41.0 95-99 40.0255 41.0 41.0 41.0 37.0 41.0 100-104 39.960449999999994 41.0 41.0 41.0 37.0 41.0 105-109 39.773 41.0 41.0 41.0 37.0 41.0 110-114 39.7996 41.0 41.0 41.0 37.0 41.0 115-119 39.7899 41.0 41.0 41.0 37.0 41.0 120-124 39.61065 41.0 41.0 41.0 37.0 41.0 125-129 39.52669999999999 41.0 41.0 41.0 37.0 41.0 130-134 39.259 41.0 41.0 41.0 37.0 41.0 135-139 38.892900000000004 41.0 41.0 41.0 33.0 41.0 140-144 38.8684 41.0 41.0 41.0 33.0 41.0 145-149 38.34115 41.0 41.0 41.0 32.0 41.0 150-151 37.390375000000006 41.0 39.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 2.0 27 7.0 28 8.0 29 18.0 30 20.0 31 29.0 32 47.0 33 59.0 34 71.0 35 110.0 36 87.0 37 139.0 38 181.0 39 251.0 40 2969.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 5.172413793103448 38.03050397877984 40.749336870026525 16.047745358090186 2 26.75 41.875 18.875 12.5 3 21.85 31.5 36.325 10.325 4 33.15 25.25 27.525 14.075 5 28.15 27.55 26.25 18.05 6 25.45 26.8 27.950000000000003 19.8 7 22.975 27.425 28.725 20.875 8 26.025 26.025 30.3 17.65 9 22.5 24.55 31.175000000000004 21.775 10-14 25.174999999999997 25.419999999999998 29.78 19.625 15-19 25.025 26.595000000000002 28.555000000000003 19.825 20-24 24.025 27.26 28.26 20.455000000000002 25-29 24.6 26.674999999999997 28.515 20.21 30-34 24.725 26.674999999999997 28.275 20.325 35-39 24.14 26.87 28.49 20.5 40-44 23.77 26.91 28.970000000000002 20.349999999999998 45-49 23.97239723972397 26.692669266926693 29.257925792579258 20.07700770077008 50-54 24.5 26.695 28.875 19.93 55-59 23.885 26.865 28.965000000000003 20.285 60-64 24.48 26.985 28.815 19.72 65-69 24.9499899979996 27.045409081816363 28.430686137227447 19.573914782956592 70-74 25.29005801160232 26.840368073614723 27.780556111222243 20.08901780356071 75-79 24.310000000000002 26.83 28.810000000000002 20.05 80-84 24.002400240024002 27.47274727472747 28.28282828282828 20.242024202420243 85-89 24.345 27.250000000000004 28.225 20.18 90-94 24.44733420026008 27.088126437931383 28.373512053616086 20.09102730819246 95-99 24.715 27.125 27.88 20.28 100-104 24.325 27.08 27.505000000000003 21.09 105-109 23.31 27.334999999999997 27.994999999999997 21.36 110-114 23.97 27.634999999999998 27.705000000000002 20.69 115-119 23.755000000000003 28.015 26.77 21.46 120-124 23.835 28.134999999999998 26.314999999999998 21.715 125-129 23.74 28.065 26.545 21.65 130-134 23.02 29.175 25.72 22.085 135-139 23.505000000000003 28.585 25.445 22.465 140-144 23.1 29.165000000000003 24.85 22.884999999999998 145-149 22.915 28.96 24.474999999999998 23.65 150-151 22.175 29.512500000000003 25.337500000000002 22.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 3.0 26 7.0 27 7.5 28 10.0 29 11.5 30 16.5 31 20.5 32 26.0 33 43.0 34 59.5 35 86.0 36 111.5 37 126.5 38 153.5 39 172.5 40 180.0 41 198.0 42 229.5 43 259.5 44 269.5 45 265.5 46 248.5 47 234.5 48 229.0 49 210.0 50 165.5 51 117.5 52 104.0 53 90.0 54 69.5 55 67.0 56 52.0 57 36.0 58 30.0 59 23.5 60 21.0 61 11.5 62 4.5 63 5.5 64 3.5 65 2.5 66 2.0 67 1.5 68 0.5 69 2.0 70 3.5 71 4.0 72 2.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 24.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.02 70-74 0.02 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.03 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.025 #Duplication Level Percentage of deduplicated Percentage of total 1 94.75947325987639 88.14999999999999 2 4.353668368718087 8.1 3 0.4837409298575652 1.35 4 0.16124697661918838 0.6 5 0.0 0.0 6 0.026874496103198062 0.15 7 0.10749798441279225 0.7000000000000001 8 0.053748992206396125 0.4 9 0.026874496103198062 0.22499999999999998 >10 0.026874496103198062 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TATTTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACA 13 0.325 No Hit TGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGG 9 0.22499999999999998 No Hit TGTTTGTGTCGTCGGTGGTGTTCCGGCAGGGGGGGTGGATTTTATGATTG 8 0.2 No Hit TGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTG 8 0.2 No Hit ATGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTTACTT 7 0.17500000000000002 No Hit GAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGC 7 0.17500000000000002 No Hit TTCCAAGATTTGATGAGTCCCTAGCTATCTGTTAGGGTTGCTTCGTTCAA 7 0.17500000000000002 No Hit TCTTGGCAAGATTGTGAAGGGGACTGTGGATCAGTCTGATGCTAGCTTCC 7 0.17500000000000002 No Hit AACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.1375 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.25 0.0 0.0 0.0 0.0 34-35 0.25 0.0 0.0 0.0 0.0 36-37 0.275 0.0 0.0 0.0 0.0 38-39 0.275 0.0 0.0 0.0 0.0 40-41 0.275 0.0 0.0 0.0 0.0 42-43 0.3125 0.0 0.0 0.0 0.0 44-45 0.375 0.0 0.0 0.0 0.0 46-47 0.475 0.0 0.0 0.0 0.0 48-49 0.575 0.0 0.0 0.0 0.0 50-51 0.6375 0.0 0.0 0.0 0.0 52-53 0.7124999999999999 0.0 0.0 0.0 0.0 54-55 0.8125 0.0 0.0 0.0 0.0 56-57 0.8999999999999999 0.0 0.0 0.0 0.0 58-59 1.0125 0.0 0.0 0.0 0.0 60-61 1.1749999999999998 0.0 0.0 0.0 0.0 62-63 1.3125 0.0 0.0 0.0 0.0 64-65 1.5125000000000002 0.0 0.0 0.0 0.0 66-67 1.7125 0.0 0.0 0.0 0.0 68-69 1.9125 0.0 0.0 0.0 0.0 70-71 2.1375 0.0 0.0 0.0 0.0 72-73 2.35 0.0 0.0 0.0 0.0 74-75 2.7 0.0 0.0 0.0 0.0 76-77 2.9749999999999996 0.0 0.0 0.0 0.0 78-79 3.3 0.0 0.0 0.0 0.0 80-81 3.7 0.0 0.0 0.0 0.0 82-83 4.199999999999999 0.0 0.0 0.0 0.0 84-85 4.7625 0.0 0.0 0.0 0.0 86-87 5.225 0.0 0.0 0.0 0.0 88-89 5.7625 0.0 0.0 0.0 0.0 90-91 6.5625 0.0 0.0 0.0 0.0 92-93 7.225 0.0 0.0 0.0 0.0 94-95 7.9375 0.0 0.0 0.0 0.0 96-97 8.75 0.0 0.0 0.0 0.0 98-99 9.65 0.0 0.0 0.0 0.0 100-101 10.3 0.0 0.0 0.0 0.0 102-103 11.35 0.0 0.0 0.0 0.0 104-105 12.3875 0.0 0.0 0.0 0.0 106-107 13.275 0.0 0.0 0.0 0.0 108-109 14.525 0.0 0.0 0.0 0.0 110-111 15.9625 0.0 0.0 0.0 0.0 112-113 17.424999999999997 0.0 0.0 0.0 0.0 114-115 18.725 0.0 0.0 0.0 0.0 116-117 20.0375 0.0 0.0 0.0 0.0 118-119 21.637500000000003 0.0 0.0 0.0 0.0 120-121 23.4 0.0 0.0 0.0 0.0 122-123 25.0625 0.0 0.0 0.0 0.0 124-125 26.425 0.0 0.0 0.0 0.0 126-127 27.8875 0.0 0.0 0.0 0.0 128-129 29.6 0.0 0.0 0.0 0.0 130-131 31.237499999999997 0.0 0.0 0.0 0.0 132-133 33.2625 0.0 0.0 0.0 0.0 134-135 35.075 0.0 0.0 0.0 0.0 136-137 36.712500000000006 0.0 0.0 0.0 0.0 138-139 38.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACGCC 65 0.0077208634 22.271154 145 CCAATAT 55 0.0025437553 15.792273 140-144 AAAAAAA 140 1.0460468E-4 10.3401785 140-144 ACGTCTG 150 2.1014476E-4 9.650834 140-144 CACGTCT 150 2.1014476E-4 9.650834 140-144 GAGCACA 160 4.019905E-4 9.047656 135-139 AGCACAC 160 4.019905E-4 9.047656 135-139 ACACGTC 150 0.0023015235 8.68575 140-144 AGAGCAC 160 0.0041292626 8.142891 135-139 GGAAGAG 190 0.0022150485 7.6190796 130-134 CGGAAGA 195 0.0028587906 7.4237175 130-134 AGATCGG 195 0.0028587906 7.4237175 125-129 >>END_MODULE Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006479 READS because READLEN < 1 Read 2006479 spots for SRR11462709.sra Written 2006479 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra Rejected 2006474 READS because READLEN < 1 Read 2006474 spots for SRR11462709.sra Written 2006474 spots for SRR11462709.sra SRR ids: ['SRR11462709.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0z0pstne SRR11462709.sra spots: 40129485 blocks: [[1, 2006474], [2006475, 4012948], [4012949, 6019422], [6019423, 8025896], [8025897, 10032370], [10032371, 12038844], [12038845, 14045318], [14045319, 16051792], [16051793, 18058266], [18058267, 20064740], [20064741, 22071214], [22071215, 24077688], [24077689, 26084162], [26084163, 28090636], [28090637, 30097110], [30097111, 32103584], [32103585, 34110058], [34110059, 36116532], [36116533, 38123006], [38123007, 40129485]] SRR11462709 file size 13616054 SRR11462709 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11462709 SRR11462709_1.fastq Input file: SRR11462709_1.fastq trimmed: SRR11462709-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:20:19 2025 >> started Wed Feb 12 07:20:50 2025 >> done (30.791s) 40129485 reads processed; of these: 11606 ( 0.03%) short reads filtered out after trimming by size control 765 ( 0.00%) empty reads filtered out after trimming by size control 40117114 (99.97%) reads available; of these: 9784058 (24.39%) trimmed reads available after processing 30333056 (75.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2824 0.01% 19 2972 0.01% 20 3734 0.01% 21 3860 0.01% 22 4357 0.01% 23 4712 0.01% 24 5181 0.01% 25 5046 0.01% 26 5013 0.01% 27 5814 0.01% 28 5675 0.01% 29 6001 0.01% 30 6466 0.02% 31 6808 0.02% 32 6684 0.02% 33 7027 0.02% 34 7688 0.02% 35 7702 0.02% 36 8145 0.02% 37 9919 0.02% 38 8943 0.02% 39 9545 0.02% 40 9943 0.02% 41 10017 0.02% 42 11669 0.03% 43 11358 0.03% 44 11922 0.03% 45 12769 0.03% 46 13803 0.03% 47 17603 0.04% 48 15577 0.04% 49 17333 0.04% 50 16452 0.04% 51 17769 0.04% 52 18416 0.05% 53 19990 0.05% 54 22465 0.06% 55 22603 0.06% 56 23993 0.06% 57 27162 0.07% 58 24963 0.06% 59 30025 0.07% 60 29539 0.07% 61 30350 0.08% 62 42353 0.11% 63 33722 0.08% 64 37257 0.09% 65 36493 0.09% 66 39207 0.10% 67 45075 0.11% 68 42215 0.11% 69 50029 0.12% 70 49692 0.12% 71 57843 0.14% 72 60211 0.15% 73 62465 0.16% 74 66116 0.16% 75 66042 0.16% 76 64368 0.16% 77 71498 0.18% 78 76809 0.19% 79 87439 0.22% 80 81886 0.20% 81 90173 0.22% 82 93067 0.23% 83 100195 0.25% 84 114261 0.28% 85 111412 0.28% 86 122857 0.31% 87 123123 0.31% 88 129538 0.32% 89 159360 0.40% 90 137633 0.34% 91 143086 0.36% 92 142662 0.36% 93 152125 0.38% 94 174361 0.43% 95 170953 0.43% 96 198948 0.50% 97 194258 0.48% 98 185255 0.46% 99 194514 0.48% 100 192360 0.48% 101 213000 0.53% 102 247348 0.62% 103 226833 0.57% 104 223967 0.56% 105 231159 0.58% 106 241453 0.60% 107 258028 0.64% 108 258745 0.64% 109 285208 0.71% 110 265699 0.66% 111 281598 0.70% 112 361741 0.90% 113 286289 0.71% 114 289082 0.72% 115 293523 0.73% 116 294676 0.73% 117 320358 0.80% 118 324648 0.81% 119 330005 0.82% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 0 0.00% 140 0 0.00% 141 0 0.00% 142 0 0.00% 143 0 0.00% 144 0 0.00% 145 0 0.00% 146 0 0.00% 147 0 0.00% 148 0 0.00% 149 0 0.00% 150 0 0.00% 151 30333056 75.61% 40117114 reads passed initial QC criterion=sequence-density sequence-density=16.41 sequence-density-rank=1 fanout-score=38.70 fanout-score-rank=1 prefix-density=19.25 prefix-fanout=33.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC criterion=fanout-score sequence-density=16.41 sequence-density-rank=1 fanout-score=38.70 fanout-score-rank=1 prefix-density=19.25 prefix-fanout=33.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -o SRR11462709 - Input file: STDIN trimmed: SRR11462709-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 07:22:40 2025 >> started Wed Feb 12 07:23:32 2025 >> done (51.535s) 35397454 reads processed; of these: 335 ( 0.00%) short reads filtered out after trimming by size control 1 ( 0.00%) empty reads filtered out after trimming by size control 35397118 (100.00%) reads available; of these: 9989165 (28.22%) trimmed reads available after processing 25407953 (71.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2570 0.01% 19 2725 0.01% 20 3329 0.01% 21 3488 0.01% 22 3838 0.01% 23 4209 0.01% 24 4544 0.01% 25 4501 0.01% 26 4445 0.01% 27 5148 0.01% 28 5066 0.01% 29 5330 0.02% 30 5723 0.02% 31 6022 0.02% 32 5907 0.02% 33 6272 0.02% 34 6837 0.02% 35 6828 0.02% 36 7183 0.02% 37 8835 0.02% 38 7890 0.02% 39 8533 0.02% 40 8802 0.02% 41 8948 0.03% 42 10273 0.03% 43 10048 0.03% 44 10519 0.03% 45 11339 0.03% 46 12245 0.03% 47 15668 0.04% 48 13870 0.04% 49 15458 0.04% 50 14765 0.04% 51 15635 0.04% 52 16342 0.05% 53 17855 0.05% 54 19887 0.06% 55 20091 0.06% 56 21103 0.06% 57 24147 0.07% 58 22148 0.06% 59 26588 0.08% 60 26403 0.07% 61 26969 0.08% 62 37857 0.11% 63 30068 0.08% 64 32765 0.09% 65 32394 0.09% 66 34739 0.10% 67 40065 0.11% 68 37732 0.11% 69 44341 0.13% 70 44275 0.13% 71 50932 0.14% 72 53785 0.15% 73 55277 0.16% 74 58582 0.17% 75 58370 0.16% 76 57528 0.16% 77 63877 0.18% 78 67996 0.19% 79 77284 0.22% 80 72493 0.20% 81 87201 0.25% 82 82149 0.23% 83 88631 0.25% 84 93689 0.26% 85 98960 0.28% 86 109383 0.31% 87 109939 0.31% 88 115429 0.33% 89 141032 0.40% 90 124279 0.35% 91 126340 0.36% 92 126793 0.36% 93 133903 0.38% 94 154599 0.44% 95 150863 0.43% 96 177150 0.50% 97 170553 0.48% 98 163785 0.46% 99 171811 0.49% 100 170201 0.48% 101 190605 0.54% 102 219078 0.62% 103 201267 0.57% 104 197967 0.56% 105 203692 0.58% 106 212712 0.60% 107 226885 0.64% 108 230048 0.65% 109 252742 0.71% 110 234975 0.66% 111 248681 0.70% 112 321389 0.91% 113 251863 0.71% 114 255740 0.72% 115 256727 0.73% 116 259476 0.73% 117 273693 0.77% 118 277415 0.78% 119 286691 0.81% 120 310228 0.88% 121 307734 0.87% 122 301384 0.85% 123 383598 1.08% 124 342459 0.97% 125 299576 0.85% 126 322241 0.91% 127 327545 0.93% 128 310625 0.88% 129 302325 0.85% 130 299997 0.85% 131 324824 0.92% 132 329906 0.93% 133 344374 0.97% 134 309913 0.88% 135 327926 0.93% 136 303088 0.86% 137 339885 0.96% 138 336438 0.95% 139 332766 0.94% 140 327643 0.93% 141 295541 0.83% 142 321706 0.91% 143 319451 0.90% 144 302718 0.86% 145 325473 0.92% 146 296041 0.84% 147 390747 1.10% 148 657971 1.86% 149 0 0.00% 150 0 0.00% 151 17065973 48.21% criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=35 prefix-density=0.63 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATTGTTATGTATTGGCCATGTCTGTGGCCTCTGGTGTGGTTTTAATGAAGTCTTATAATTAGTGTAGTA criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=39.20 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=9.0 sequence=TTGCTGTTGCTTTCACAGGAGCTTGGAATTGGAAGAAATTCGGGTCAGATGAAGGGACGCTGAACTTTGGCGAGTTTAATTATCCAGTGAACGGAGAGAACTTGTTGGCTAGCGTAGACTATGATAAAATAAAATTGTTCTCTAAAGGACAATCACCGCAGGATGTTTTCTGGTTTCCCAGCACCACATCCTGGTATAGTGCTGCCACTC Started job on | Feb 12 07:24:08 Started mapping on | Feb 12 07:24:08 Finished on | Feb 12 07:25:39 Mapping speed, Million of reads per hour | 1587.04 Number of input reads | 40116778 Average input read length | 133 UNIQUE READS: Uniquely mapped reads number | 35100408 Uniquely mapped reads % | 87.50% Average mapped length | 131.41 Number of splices: Total | 15260381 Number of splices: Annotated (sjdb) | 14970273 Number of splices: GT/AG | 14961653 Number of splices: GC/AG | 247614 Number of splices: AT/AC | 9630 Number of splices: Non-canonical | 41484 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 2.02 Insertion rate per base | 0.01% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1197789 % of reads mapped to multiple loci | 2.99% Number of reads mapped to too many loci | 1761342 % of reads mapped to too many loci | 4.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.08% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3818581 3818581 3818581 N_multimapping 1197789 1197789 1197789 N_noFeature 1733140 2216841 34269440 N_ambiguous 499192 151856 810 UnstrandedReadsAssigned:32868076 PositiveStrandReadsAssigned:32731711 NegativeStrandReadsAssigned:830158 Dataset is classified positive stranded MeadianReadLen=148 20thPercentileLength=114 echo kmer=109 SRR11462709 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR11462709-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,116,778 reads, 34,101,632 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,258 rounds 52401 SRR11462709.ke.tsv 34699 SRR11462709.se.tsv 87100 total ==> SRR11462709.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1111 18.9502 Potri.005G024800.1.v4.1 1035 936 440 15.3869 Potri.004G059700.1.v4.1 961 862 56 2.12645 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 2664 30.6605 Potri.016G087400.1.v4.1 270 171 2100 401.973 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 51 0.997215 Potri.012G127500.1.v4.1 977 878 123 4.58548 ==> SRR11462709.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 298 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 302 Potri.001G212900.v4.1 36 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 88 SRR11462709 completed mapping pipeline successfully