Starting /dee2/code/volunteer_pipeline.sh SRR11462710 current disk space = 3049553784832 free memory = 1578164732 SRR11462710 SRAfilesize 9a145dda3a4c45a01d5bc4d8bd97d0d6 SRR11462710.sra SRR11462710.sra file validated SRR11462710 is single end SRR11462710 is conventional basespace SRR11462710 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11462710_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.38875 32.0 12.0 32.0 2.0 32.0 2 31.7225 32.0 32.0 32.0 32.0 32.0 3 34.80125 37.0 32.0 37.0 32.0 37.0 4 36.1675 37.0 37.0 37.0 32.0 37.0 5 36.45875 37.0 37.0 37.0 37.0 37.0 6 40.04875 41.0 41.0 41.0 37.0 41.0 7 40.08175 41.0 41.0 41.0 37.0 41.0 8 40.0815 41.0 41.0 41.0 37.0 41.0 9 40.30125 41.0 41.0 41.0 37.0 41.0 10-14 40.324600000000004 41.0 41.0 41.0 39.4 41.0 15-19 40.29695 41.0 41.0 41.0 40.2 41.0 20-24 40.2005 41.0 41.0 41.0 37.8 41.0 25-29 40.162 41.0 41.0 41.0 37.8 41.0 30-34 40.04195 41.0 41.0 41.0 37.0 41.0 35-39 40.04809999999999 41.0 41.0 41.0 37.0 41.0 40-44 40.112049999999996 41.0 41.0 41.0 37.0 41.0 45-49 40.0322 41.0 41.0 41.0 37.0 41.0 50-54 40.030950000000004 41.0 41.0 41.0 37.8 41.0 55-59 39.89495 41.0 41.0 41.0 37.0 41.0 60-64 39.95415 41.0 41.0 41.0 37.0 41.0 65-69 39.9357 41.0 41.0 41.0 37.0 41.0 70-74 39.84395 41.0 41.0 41.0 37.0 41.0 75-79 39.736650000000004 41.0 41.0 41.0 37.0 41.0 80-84 40.12995 41.0 41.0 41.0 38.6 41.0 85-89 40.12975 41.0 41.0 41.0 37.0 41.0 90-94 39.97195000000001 41.0 41.0 41.0 37.0 41.0 95-99 39.9587 41.0 41.0 41.0 37.0 41.0 100-104 39.900999999999996 41.0 41.0 41.0 37.0 41.0 105-109 39.717 41.0 41.0 41.0 37.0 41.0 110-114 39.76525 41.0 41.0 41.0 37.0 41.0 115-119 39.679449999999996 41.0 41.0 41.0 37.0 41.0 120-124 39.5691 41.0 41.0 41.0 37.0 41.0 125-129 39.47545 41.0 41.0 41.0 37.0 41.0 130-134 39.2752 41.0 41.0 41.0 37.0 41.0 135-139 38.9678 41.0 41.0 41.0 34.0 41.0 140-144 38.9365 41.0 41.0 41.0 35.0 41.0 145-149 38.5817 41.0 41.0 41.0 32.0 41.0 150-151 37.5695 41.0 39.0 41.0 29.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 0.0 25 6.0 26 5.0 27 4.0 28 4.0 29 17.0 30 27.0 31 26.0 32 61.0 33 43.0 34 74.0 35 87.0 36 92.0 37 141.0 38 160.0 39 279.0 40 2971.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 6.31019594818997 38.12686815011624 40.68415808701428 14.878777814679509 2 27.700000000000003 41.349999999999994 19.875 11.075 3 23.599999999999998 28.225 37.25 10.925 4 35.175 25.224999999999998 25.6 14.000000000000002 5 29.775000000000002 26.5 25.85 17.875 6 25.85 28.199999999999996 27.425 18.525 7 23.625 25.825 30.925000000000004 19.625 8 25.074999999999996 25.650000000000002 30.125 19.15 9 22.900000000000002 22.575 31.95 22.575 10-14 25.064999999999998 25.474999999999998 29.604999999999997 19.855 15-19 25.805 26.055 28.485 19.655 20-24 25.145 26.584999999999997 27.495000000000005 20.775 25-29 25.465 26.490000000000002 28.395 19.650000000000002 30-34 24.615000000000002 26.889999999999997 27.825 20.669999999999998 35-39 25.259999999999998 26.31 27.91 20.52 40-44 24.8 26.465 28.38 20.355 45-49 24.2974297429743 26.712671267126716 28.877887788778878 20.11201120112011 50-54 25.319999999999997 26.790000000000003 27.495000000000005 20.395 55-59 24.935 27.16 27.865000000000002 20.04 60-64 25.19 26.31 28.08 20.419999999999998 65-69 25.21004200840168 25.95519103820764 28.035607121424285 20.799159831966392 70-74 25.580116023204642 26.655331066213243 27.655531106221243 20.10902180436087 75-79 24.33 26.71 28.595 20.365 80-84 25.15751575157516 27.007700770077008 27.557755775577558 20.27702770277028 85-89 24.93 27.705000000000002 27.034999999999997 20.330000000000002 90-94 25.097529258777634 26.427928378513556 28.123437031109333 20.35110533159948 95-99 24.535 27.57 27.505000000000003 20.39 100-104 24.959999999999997 26.875 27.715 20.45 105-109 24.22 26.740000000000002 27.800000000000004 21.240000000000002 110-114 24.89 27.58 26.82 20.71 115-119 24.89 27.13 27.35 20.630000000000003 120-124 24.185000000000002 27.534999999999997 27.3 20.979999999999997 125-129 24.79 27.615000000000002 26.790000000000003 20.805 130-134 24.98 28.78 25.845000000000002 20.395 135-139 24.044999999999998 28.415000000000003 26.240000000000002 21.3 140-144 24.385 28.455000000000002 25.679999999999996 21.48 145-149 24.645 28.53 25.085 21.740000000000002 150-151 23.200000000000003 30.312499999999996 23.7125 22.775000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 3.0 27 5.5 28 7.5 29 10.5 30 14.5 31 18.5 32 26.5 33 33.0 34 52.5 35 81.5 36 96.0 37 117.5 38 132.5 39 154.5 40 188.5 41 199.5 42 216.5 43 245.0 44 254.5 45 254.0 46 250.5 47 231.5 48 213.0 49 205.5 50 179.0 51 131.0 52 107.5 53 100.5 54 86.5 55 80.5 56 61.0 57 43.5 58 39.0 59 28.0 60 24.5 61 18.5 62 16.5 63 17.0 64 9.0 65 2.5 66 4.5 67 6.5 68 5.5 69 7.0 70 6.5 71 4.5 72 2.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 24.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.02 70-74 0.02 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.03 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.475 #Duplication Level Percentage of deduplicated Percentage of total 1 94.43092727764261 87.325 2 4.21735604217356 7.8 3 0.7839956745066234 2.175 4 0.3784806704514734 1.4000000000000001 5 0.027034333603676672 0.125 6 0.027034333603676672 0.15 7 0.08110300081103002 0.525 8 0.0 0.0 9 0.0 0.0 >10 0.054068667207353344 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGG 10 0.25 No Hit TATTTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACA 10 0.25 No Hit ATGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTTACTT 7 0.17500000000000002 No Hit TGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTG 7 0.17500000000000002 No Hit TATTTTACTTATTCCGTGAATCGGAGGCGGGGCGCTGCCCCTCTTTTTGG 7 0.17500000000000002 No Hit AACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCT 6 0.15 No Hit TGTTTGTGTCGTCGGTGGTGTTCCGGCAGGGGGGGTGGATTTTATGATTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.037500000000000006 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.1375 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.16249999999999998 0.0 0.0 0.0 0.0 36-37 0.21250000000000002 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.2875 0.0 0.0 0.0 0.0 42-43 0.3125 0.0 0.0 0.0 0.0 44-45 0.3625 0.0 0.0 0.0 0.0 46-47 0.42500000000000004 0.0 0.0 0.0 0.0 48-49 0.475 0.0 0.0 0.0 0.0 50-51 0.55 0.0 0.0 0.0 0.0 52-53 0.6 0.0 0.0 0.0 0.0 54-55 0.6875 0.0 0.0 0.0 0.0 56-57 0.775 0.0 0.0 0.0 0.0 58-59 0.825 0.0 0.0 0.0 0.0 60-61 0.9125 0.0 0.0 0.0 0.0 62-63 1.0375 0.0 0.0 0.0 0.0 64-65 1.175 0.0 0.0 0.0 0.0 66-67 1.3875 0.0 0.0 0.0 0.0 68-69 1.4874999999999998 0.0 0.0 0.0 0.0 70-71 1.65 0.0 0.0 0.0 0.0 72-73 1.825 0.0 0.0 0.0 0.0 74-75 2.0 0.0 0.0 0.0 0.0 76-77 2.3 0.0 0.0 0.0 0.0 78-79 2.5875 0.0 0.0 0.0 0.0 80-81 2.875 0.0 0.0 0.0 0.0 82-83 3.2249999999999996 0.0 0.0 0.0 0.0 84-85 3.6 0.0 0.0 0.0 0.0 86-87 3.95 0.0 0.0 0.0 0.0 88-89 4.2125 0.0 0.0 0.0 0.0 90-91 4.75 0.0 0.0 0.0 0.0 92-93 5.137499999999999 0.0 0.0 0.0 0.0 94-95 5.5375 0.0 0.0 0.0 0.0 96-97 6.0875 0.0 0.0 0.0 0.0 98-99 6.737500000000001 0.0 0.0 0.0 0.0 100-101 7.475 0.0 0.0 0.0 0.0 102-103 7.9125 0.0 0.0 0.0 0.0 104-105 8.8375 0.0 0.0 0.0 0.0 106-107 9.45 0.0 0.0 0.0 0.0 108-109 10.149999999999999 0.0 0.0 0.0 0.0 110-111 10.8875 0.0 0.0 0.0 0.0 112-113 11.5125 0.0 0.0 0.0 0.0 114-115 12.4375 0.0 0.0 0.0 0.0 116-117 13.425 0.0 0.0 0.0 0.0 118-119 14.425 0.0 0.0 0.0 0.0 120-121 15.325 0.0 0.0 0.0 0.0 122-123 16.45 0.0 0.0 0.0 0.0 124-125 18.0125 0.0 0.0 0.0 0.0 126-127 19.125 0.0 0.0 0.0 0.0 128-129 20.637500000000003 0.0 0.0 0.0 0.0 130-131 21.85 0.0 0.0 0.0 0.0 132-133 23.125 0.0 0.0 0.0 0.0 134-135 24.65 0.0 0.0 0.0 0.0 136-137 26.0125 0.0 0.0 0.0 0.0 138-139 27.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACTCT 10 0.006864391 144.7625 4 TAAACTC 10 0.006864391 144.7625 3 GTATTCT 10 0.006864391 144.7625 7 TATTCTG 10 0.006864391 144.7625 8 TGTATTC 10 0.006864391 144.7625 6 AAAAAAA 220 0.009247525 6.580114 125-129 >>END_MODULE Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801709 READS because READLEN < 1 Read 1801709 spots for SRR11462710.sra Written 1801709 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra Rejected 1801704 READS because READLEN < 1 Read 1801704 spots for SRR11462710.sra Written 1801704 spots for SRR11462710.sra SRR ids: ['SRR11462710.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bp5mr9q5 SRR11462710.sra spots: 36034085 blocks: [[1, 1801704], [1801705, 3603408], [3603409, 5405112], [5405113, 7206816], [7206817, 9008520], [9008521, 10810224], [10810225, 12611928], [12611929, 14413632], [14413633, 16215336], [16215337, 18017040], [18017041, 19818744], [19818745, 21620448], [21620449, 23422152], [23422153, 25223856], [25223857, 27025560], [27025561, 28827264], [28827265, 30628968], [30628969, 32430672], [32430673, 34232376], [34232377, 36034085]] SRR11462710 file size 12224258 SRR11462710 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11462710 SRR11462710_1.fastq Input file: SRR11462710_1.fastq trimmed: SRR11462710-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 08:06:46 2025 >> started Wed Feb 12 08:07:07 2025 >> done (20.696s) 36034085 reads processed; of these: 11864 ( 0.03%) short reads filtered out after trimming by size control 825 ( 0.00%) empty reads filtered out after trimming by size control 36021396 (99.96%) reads available; of these: 5692767 (15.80%) trimmed reads available after processing 30328629 (84.20%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2561 0.01% 19 2740 0.01% 20 3622 0.01% 21 3372 0.01% 22 4015 0.01% 23 4254 0.01% 24 4733 0.01% 25 4552 0.01% 26 4996 0.01% 27 5126 0.01% 28 5251 0.01% 29 5656 0.02% 30 5756 0.02% 31 6136 0.02% 32 6190 0.02% 33 6365 0.02% 34 6931 0.02% 35 7128 0.02% 36 7209 0.02% 37 9460 0.03% 38 7704 0.02% 39 8595 0.02% 40 8499 0.02% 41 8734 0.02% 42 10075 0.03% 43 10053 0.03% 44 10036 0.03% 45 11156 0.03% 46 11439 0.03% 47 14765 0.04% 48 12942 0.04% 49 14929 0.04% 50 13673 0.04% 51 14351 0.04% 52 15055 0.04% 53 15470 0.04% 54 18053 0.05% 55 17483 0.05% 56 18393 0.05% 57 20500 0.06% 58 18796 0.05% 59 21362 0.06% 60 21934 0.06% 61 22110 0.06% 62 32448 0.09% 63 23376 0.06% 64 26273 0.07% 65 24887 0.07% 66 26347 0.07% 67 28659 0.08% 68 28055 0.08% 69 32992 0.09% 70 31787 0.09% 71 34841 0.10% 72 38011 0.11% 73 38632 0.11% 74 41228 0.11% 75 41319 0.11% 76 38649 0.11% 77 41663 0.12% 78 45372 0.13% 79 52294 0.15% 80 46386 0.13% 81 49493 0.14% 82 52243 0.15% 83 55996 0.16% 84 63177 0.18% 85 61424 0.17% 86 67807 0.19% 87 68004 0.19% 88 74450 0.21% 89 94591 0.26% 90 73668 0.20% 91 76877 0.21% 92 74293 0.21% 93 79926 0.22% 94 89780 0.25% 95 90406 0.25% 96 107636 0.30% 97 101746 0.28% 98 96869 0.27% 99 101977 0.28% 100 101959 0.28% 101 113373 0.31% 102 133485 0.37% 103 129055 0.36% 104 120522 0.33% 105 124393 0.35% 106 130876 0.36% 107 139831 0.39% 108 138954 0.39% 109 161243 0.45% 110 150022 0.42% 111 157355 0.44% 112 206039 0.57% 113 167879 0.47% 114 168726 0.47% 115 171888 0.48% 116 175927 0.49% 117 191377 0.53% 118 201123 0.56% 119 202998 0.56% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 0 0.00% 140 0 0.00% 141 0 0.00% 142 0 0.00% 143 0 0.00% 144 0 0.00% 145 0 0.00% 146 0 0.00% 147 0 0.00% 148 0 0.00% 149 0 0.00% 150 0 0.00% 151 30328629 84.20% 36021396 reads passed initial QC criterion=sequence-density sequence-density=12.64 sequence-density-rank=1 fanout-score=41.14 fanout-score-rank=1 prefix-density=15.21 prefix-fanout=34.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=12.64 sequence-density-rank=1 fanout-score=41.14 fanout-score-rank=1 prefix-density=15.21 prefix-fanout=34.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR11462710 - Input file: STDIN trimmed: SRR11462710-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 08:08:26 2025 >> started Wed Feb 12 08:09:01 2025 >> done (34.723s) 30479643 reads processed; of these: 380 ( 0.00%) short reads filtered out after trimming by size control 12 ( 0.00%) empty reads filtered out after trimming by size control 30479251 (100.00%) reads available; of these: 7367442 (24.17%) trimmed reads available after processing 23111809 (75.83%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2223 0.01% 19 2401 0.01% 20 3110 0.01% 21 2886 0.01% 22 3442 0.01% 23 3628 0.01% 24 4052 0.01% 25 3909 0.01% 26 4347 0.01% 27 4410 0.01% 28 4474 0.01% 29 4793 0.02% 30 4910 0.02% 31 5229 0.02% 32 5303 0.02% 33 5431 0.02% 34 5882 0.02% 35 6120 0.02% 36 6247 0.02% 37 8141 0.03% 38 6546 0.02% 39 7250 0.02% 40 7258 0.02% 41 7432 0.02% 42 8607 0.03% 43 8522 0.03% 44 8645 0.03% 45 9540 0.03% 46 9847 0.03% 47 12598 0.04% 48 11050 0.04% 49 12779 0.04% 50 11862 0.04% 51 12227 0.04% 52 12800 0.04% 53 13372 0.04% 54 15388 0.05% 55 14864 0.05% 56 15589 0.05% 57 17423 0.06% 58 15979 0.05% 59 18169 0.06% 60 18874 0.06% 61 19063 0.06% 62 27590 0.09% 63 19970 0.07% 64 22307 0.07% 65 21296 0.07% 66 22568 0.07% 67 24379 0.08% 68 24011 0.08% 69 28083 0.09% 70 27405 0.09% 71 29568 0.10% 72 32372 0.11% 73 32729 0.11% 74 35308 0.12% 75 35241 0.12% 76 33263 0.11% 77 35961 0.12% 78 38641 0.13% 79 44504 0.15% 80 39723 0.13% 81 46164 0.15% 82 44491 0.15% 83 47196 0.15% 84 50058 0.16% 85 52279 0.17% 86 57970 0.19% 87 58108 0.19% 88 63728 0.21% 89 80719 0.26% 90 65308 0.21% 91 65703 0.22% 92 63969 0.21% 93 67820 0.22% 94 76613 0.25% 95 76234 0.25% 96 91972 0.30% 97 85120 0.28% 98 82547 0.27% 99 86867 0.29% 100 86781 0.28% 101 97357 0.32% 102 113738 0.37% 103 110299 0.36% 104 102432 0.34% 105 106491 0.35% 106 111274 0.37% 107 118838 0.39% 108 119112 0.39% 109 137984 0.45% 110 127959 0.42% 111 133575 0.44% 112 176291 0.58% 113 141544 0.46% 114 143493 0.47% 115 145109 0.48% 116 149660 0.49% 117 156811 0.51% 118 164958 0.54% 119 169131 0.55% 120 184442 0.61% 121 196676 0.65% 122 184349 0.60% 123 253321 0.83% 124 219337 0.72% 125 191758 0.63% 126 208444 0.68% 127 222019 0.73% 128 207276 0.68% 129 201720 0.66% 130 204363 0.67% 131 221267 0.73% 132 231105 0.76% 133 254952 0.84% 134 225105 0.74% 135 240423 0.79% 136 225305 0.74% 137 246726 0.81% 138 258726 0.85% 139 250012 0.82% 140 264338 0.87% 141 228839 0.75% 142 246526 0.81% 143 250180 0.82% 144 245410 0.81% 145 288302 0.95% 146 249710 0.82% 147 347521 1.14% 148 634775 2.08% 149 0 0.00% 150 0 0.00% 151 18459080 60.56% criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=33 prefix-density=0.59 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATTGTTATGTATTGGCCATGTCTGTGGCCTCTGGTGTGGTTTTAATGAAGTCTTATAATTAGTGTAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=67.02 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.5 sequence=AAAGATGGCCTCGGCATCATTTCTCAAGTCATCACCAGTTCTAGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTGTCCGGTGCCGCTCCACCGCCCCTTCTGCTCTTACCGTTCGTGCTGGTTCCTATGCTGAGGAGCTTGTCAAAACCGCGAAAAC Started job on | Feb 12 08:09:37 Started mapping on | Feb 12 08:09:37 Finished on | Feb 12 08:10:41 Mapping speed, Million of reads per hour | 2026.18 Number of input reads | 36021004 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 30931259 Uniquely mapped reads % | 85.87% Average mapped length | 137.07 Number of splices: Total | 14075683 Number of splices: Annotated (sjdb) | 13791663 Number of splices: GT/AG | 13786356 Number of splices: GC/AG | 231969 Number of splices: AT/AC | 8868 Number of splices: Non-canonical | 48490 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.11 Insertion rate per base | 0.01% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1019970 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 2360999 % of reads mapped to too many loci | 6.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.66% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4069775 4069775 4069775 N_multimapping 1019970 1019970 1019970 N_noFeature 1726162 2215184 30055116 N_ambiguous 507852 120630 689 UnstrandedReadsAssigned:28697245 PositiveStrandReadsAssigned:28595445 NegativeStrandReadsAssigned:875454 Dataset is classified positive stranded MeadianReadLen=151 20thPercentileLength=126 echo kmer=121 SRR11462710 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR11462710-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,021,004 reads, 30,309,496 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,362 rounds 52401 SRR11462710.ke.tsv 34699 SRR11462710.se.tsv 87100 total ==> SRR11462710.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1230 23.7819 Potri.005G024800.1.v4.1 1035 936 552 21.8817 Potri.004G059700.1.v4.1 961 862 70 3.01306 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 2320 30.2674 Potri.016G087400.1.v4.1 270 171 2274 493.414 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 68 1.5072 Potri.012G127500.1.v4.1 977 878 163 6.88827 ==> SRR11462710.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 259 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 131 Potri.001G212900.v4.1 18 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 150 SRR11462710 completed mapping pipeline successfully