Starting /dee2/code/volunteer_pipeline.sh SRR11462711 current disk space = 3049928626176 free memory = 1489837008 SRR11462711 SRAfilesize 779486f4c19de74d7647add0b1f304fe SRR11462711.sra SRR11462711.sra file validated SRR11462711 is single end SRR11462711 is conventional basespace SRR11462711 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11462711_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.55875 32.0 27.0 32.0 2.0 32.0 2 31.78 32.0 32.0 32.0 32.0 32.0 3 34.90625 37.0 32.0 37.0 32.0 37.0 4 36.25125 37.0 37.0 37.0 32.0 37.0 5 36.5375 37.0 37.0 37.0 37.0 37.0 6 40.09475 41.0 41.0 41.0 37.0 41.0 7 40.202 41.0 41.0 41.0 37.0 41.0 8 40.19025 41.0 41.0 41.0 37.0 41.0 9 40.37025 41.0 41.0 41.0 41.0 41.0 10-14 40.32745 41.0 41.0 41.0 41.0 41.0 15-19 40.297399999999996 41.0 41.0 41.0 39.4 41.0 20-24 40.21205 41.0 41.0 41.0 37.8 41.0 25-29 40.19414999999999 41.0 41.0 41.0 37.8 41.0 30-34 40.0629 41.0 41.0 41.0 37.0 41.0 35-39 40.03565 41.0 41.0 41.0 38.6 41.0 40-44 40.10435 41.0 41.0 41.0 37.8 41.0 45-49 40.08925000000001 41.0 41.0 41.0 37.0 41.0 50-54 40.01795 41.0 41.0 41.0 37.0 41.0 55-59 40.04245 41.0 41.0 41.0 37.0 41.0 60-64 40.0386 41.0 41.0 41.0 37.0 41.0 65-69 39.99335000000001 41.0 41.0 41.0 37.0 41.0 70-74 39.8745 41.0 41.0 41.0 37.0 41.0 75-79 39.80335 41.0 41.0 41.0 37.0 41.0 80-84 40.1584 41.0 41.0 41.0 38.6 41.0 85-89 40.19855 41.0 41.0 41.0 39.4 41.0 90-94 40.03 41.0 41.0 41.0 37.8 41.0 95-99 40.04774999999999 41.0 41.0 41.0 37.0 41.0 100-104 39.965999999999994 41.0 41.0 41.0 37.0 41.0 105-109 39.75815 41.0 41.0 41.0 37.0 41.0 110-114 39.777049999999996 41.0 41.0 41.0 37.0 41.0 115-119 39.73635 41.0 41.0 41.0 37.0 41.0 120-124 39.5402 41.0 41.0 41.0 37.0 41.0 125-129 39.448750000000004 41.0 41.0 41.0 37.0 41.0 130-134 39.2846 41.0 41.0 41.0 37.0 41.0 135-139 38.94775 41.0 41.0 41.0 34.0 41.0 140-144 38.74829999999999 41.0 41.0 41.0 33.0 41.0 145-149 38.159850000000006 41.0 41.0 41.0 32.0 41.0 150-151 37.21725 41.0 39.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 2.0 26 6.0 27 6.0 28 14.0 29 15.0 30 29.0 31 38.0 32 36.0 33 50.0 34 77.0 35 64.0 36 92.0 37 133.0 38 182.0 39 284.0 40 2969.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 6.761213720316622 37.86279683377309 39.70976253298153 15.66622691292876 2 25.275 42.525 20.1 12.1 3 23.0 29.925 36.025 11.05 4 34.25 25.0 26.525 14.224999999999998 5 29.025000000000002 26.75 26.35 17.875 6 26.25 27.474999999999998 28.325 17.95 7 23.625 27.150000000000002 29.225 20.0 8 24.474999999999998 27.125 29.45 18.95 9 21.875 24.825 30.5 22.8 10-14 25.385 25.64 29.360000000000003 19.615 15-19 24.705 27.084999999999997 28.235 19.975 20-24 24.654999999999998 27.21 28.665000000000003 19.470000000000002 25-29 24.11 26.575 28.64 20.674999999999997 30-34 24.154999999999998 26.36 28.46 21.025 35-39 24.635 26.240000000000002 28.88 20.244999999999997 40-44 24.615000000000002 26.43 28.875 20.080000000000002 45-49 23.581179058952948 27.406370318515926 28.646432321616082 20.366018300915044 50-54 24.779999999999998 26.834999999999997 28.325 20.06 55-59 24.759999999999998 27.27 28.43 19.54 60-64 25.074999999999996 27.205000000000002 28.444999999999997 19.275000000000002 65-69 24.217421742174217 26.82268226822682 28.227822782278228 20.73207320732073 70-74 24.44244424442444 26.777677767776776 28.65286528652865 20.12701270127013 75-79 23.635 27.52 28.27 20.575 80-84 24.626231311565576 27.40137006850343 27.726386319315964 20.24601230061503 85-89 24.22 27.084999999999997 28.04 20.655 90-94 24.48367255088263 27.879181877281596 27.39910986647997 20.238035705355802 95-99 24.365000000000002 27.145000000000003 27.715 20.775 100-104 24.57 27.49 27.055 20.885 105-109 23.685000000000002 28.505000000000003 26.400000000000002 21.41 110-114 23.935000000000002 27.96 26.47 21.634999999999998 115-119 24.5 27.96 26.06 21.48 120-124 23.9 27.939999999999998 26.174999999999997 21.985 125-129 22.99 28.865000000000002 25.264999999999997 22.88 130-134 23.169999999999998 29.34 24.785 22.705000000000002 135-139 22.325 29.025000000000002 24.94 23.71 140-144 22.435 29.57 24.065 23.93 145-149 21.7 29.599999999999998 24.16 24.54 150-151 21.2625 30.075000000000003 23.9375 24.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 1.0 24 1.5 25 3.5 26 2.5 27 2.5 28 9.0 29 17.0 30 22.5 31 27.5 32 30.0 33 44.0 34 62.5 35 82.5 36 102.0 37 107.5 38 140.0 39 169.0 40 187.5 41 212.5 42 240.5 43 253.5 44 255.5 45 249.0 46 227.5 47 245.5 48 239.0 49 196.0 50 164.0 51 121.0 52 105.0 53 100.5 54 71.5 55 67.0 56 60.0 57 46.5 58 37.0 59 18.5 60 13.5 61 11.5 62 9.0 63 7.5 64 4.0 65 1.0 66 0.5 67 1.5 68 3.5 69 5.5 70 7.0 71 5.5 72 1.5 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 24.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.01 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.015 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.51367135651712 89.95 2 3.6899389434563314 6.950000000000001 3 0.4778338200159278 1.35 4 0.15927794000530926 0.6 5 0.053092646668436425 0.25 6 0.026546323334218212 0.15 7 0.053092646668436425 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.026546323334218212 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTTACTT 16 0.4 No Hit TATTTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACA 7 0.17500000000000002 No Hit CGGGCCGCCTTGAAGTACAATTCCCACCGAGCGGCGGGTAGAATCCTTTG 7 0.17500000000000002 No Hit TACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCC 6 0.15 No Hit AAAGGGCATTTTGCAAAGCGATCCCTTTGAGGTGCTTGATCAGAAAGGTG 5 0.125 No Hit TTAGATAAAAGGTCGACGCGGGCTCTGCCCGTTGCTCTGATGATTCATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.1125 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.1875 0.0 0.0 0.0 0.0 36-37 0.2625 0.0 0.0 0.0 0.0 38-39 0.325 0.0 0.0 0.0 0.0 40-41 0.35 0.0 0.0 0.0 0.0 42-43 0.3875 0.0 0.0 0.0 0.0 44-45 0.42500000000000004 0.0 0.0 0.0 0.0 46-47 0.5625 0.0 0.0 0.0 0.0 48-49 0.6 0.0 0.0 0.0 0.0 50-51 0.675 0.0 0.0 0.0 0.0 52-53 0.7875000000000001 0.0 0.0 0.0 0.0 54-55 0.875 0.0 0.0 0.0 0.0 56-57 1.0125 0.0 0.0 0.0 0.0 58-59 1.1124999999999998 0.0 0.0 0.0 0.0 60-61 1.2625000000000002 0.0 0.0 0.0 0.0 62-63 1.5375 0.0 0.0 0.0 0.0 64-65 1.9625 0.0 0.0 0.0 0.0 66-67 2.2625 0.0 0.0 0.0 0.0 68-69 2.6375 0.0 0.0 0.0 0.0 70-71 2.9875 0.0 0.0 0.0 0.0 72-73 3.4125 0.0 0.0 0.0 0.0 74-75 3.675 0.0 0.0 0.0 0.0 76-77 4.15 0.0 0.0 0.0 0.0 78-79 4.6125 0.0 0.0 0.0 0.0 80-81 5.075 0.0 0.0 0.0 0.0 82-83 5.6 0.0 0.0 0.0 0.0 84-85 6.324999999999999 0.0 0.0 0.0 0.0 86-87 7.1125 0.0 0.0 0.0 0.0 88-89 7.9625 0.0 0.0 0.0 0.0 90-91 8.725000000000001 0.0 0.0 0.0 0.0 92-93 9.5625 0.0 0.0 0.0 0.0 94-95 10.5125 0.0 0.0 0.0 0.0 96-97 11.55 0.0 0.0 0.0 0.0 98-99 12.7625 0.0 0.0 0.0 0.0 100-101 13.837499999999999 0.0 0.0 0.0 0.0 102-103 15.4375 0.0 0.0 0.0 0.0 104-105 16.85 0.0 0.0 0.0 0.0 106-107 18.175 0.0 0.0 0.0 0.0 108-109 19.7125 0.0 0.0 0.0 0.0 110-111 21.1375 0.0 0.0 0.0 0.0 112-113 23.1625 0.0 0.0 0.0 0.0 114-115 25.0 0.0 0.0 0.0 0.0 116-117 26.625 0.0 0.0 0.0 0.0 118-119 28.575 0.0 0.0 0.0 0.0 120-121 30.674999999999997 0.0 0.0 0.0 0.0 122-123 32.5 0.0 0.0 0.0 0.0 124-125 34.15 0.0 0.0 0.0 0.0 126-127 35.599999999999994 0.0 0.0 0.0 0.0 128-129 37.2 0.0 0.0 0.0 0.0 130-131 38.9875 0.0 0.0 0.0 0.0 132-133 41.2 0.0 0.0 0.0 0.0 134-135 43.05 0.0 0.0 0.0 0.0 136-137 44.8875 0.0 0.0 0.0 0.0 138-139 46.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTACT 10 0.006864391 144.7625 9 ATCAGTA 10 0.006864391 144.7625 8 TCAGTAG 10 0.006864391 144.7625 9 TATCATC 10 0.006864391 144.7625 4 AAAAAAA 195 2.8783816E-6 9.650833 135-139 >>END_MODULE Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919182 READS because READLEN < 1 Read 1919182 spots for SRR11462711.sra Written 1919182 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra Rejected 1919170 READS because READLEN < 1 Read 1919170 spots for SRR11462711.sra Written 1919170 spots for SRR11462711.sra SRR ids: ['SRR11462711.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7bd0pvjx SRR11462711.sra spots: 38383412 blocks: [[1, 1919170], [1919171, 3838340], [3838341, 5757510], [5757511, 7676680], [7676681, 9595850], [9595851, 11515020], [11515021, 13434190], [13434191, 15353360], [15353361, 17272530], [17272531, 19191700], [19191701, 21110870], [21110871, 23030040], [23030041, 24949210], [24949211, 26868380], [26868381, 28787550], [28787551, 30706720], [30706721, 32625890], [32625891, 34545060], [34545061, 36464230], [36464231, 38383412]] SRR11462711 file size 13022662 SRR11462711 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11462711 SRR11462711_1.fastq Input file: SRR11462711_1.fastq trimmed: SRR11462711-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:26:13 2025 >> started Wed Feb 12 07:26:37 2025 >> done (23.799s) 38383412 reads processed; of these: 18660 ( 0.05%) short reads filtered out after trimming by size control 1046 ( 0.00%) empty reads filtered out after trimming by size control 38363706 (99.95%) reads available; of these: 11593358 (30.22%) trimmed reads available after processing 26770348 (69.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4124 0.01% 19 4594 0.01% 20 5099 0.01% 21 5755 0.02% 22 6379 0.02% 23 6628 0.02% 24 7160 0.02% 25 7179 0.02% 26 7286 0.02% 27 8183 0.02% 28 8692 0.02% 29 8836 0.02% 30 9208 0.02% 31 9811 0.03% 32 9585 0.02% 33 10182 0.03% 34 11297 0.03% 35 11026 0.03% 36 11687 0.03% 37 12979 0.03% 38 12208 0.03% 39 13002 0.03% 40 13814 0.04% 41 13921 0.04% 42 15655 0.04% 43 15825 0.04% 44 16376 0.04% 45 17017 0.04% 46 18719 0.05% 47 20456 0.05% 48 20097 0.05% 49 21862 0.06% 50 21616 0.06% 51 23588 0.06% 52 24850 0.06% 53 26095 0.07% 54 28532 0.07% 55 29728 0.08% 56 31167 0.08% 57 34272 0.09% 58 34121 0.09% 59 36965 0.10% 60 38203 0.10% 61 40381 0.11% 62 49271 0.13% 63 43990 0.11% 64 47377 0.12% 65 48017 0.13% 66 50354 0.13% 67 55585 0.14% 68 55311 0.14% 69 61753 0.16% 70 63201 0.16% 71 70767 0.18% 72 73966 0.19% 73 78107 0.20% 74 80153 0.21% 75 84183 0.22% 76 84405 0.22% 77 92252 0.24% 78 95530 0.25% 79 106054 0.28% 80 103477 0.27% 81 109776 0.29% 82 121925 0.32% 83 128869 0.34% 84 134595 0.35% 85 138072 0.36% 86 143041 0.37% 87 157249 0.41% 88 159211 0.42% 89 172794 0.45% 90 167301 0.44% 91 176977 0.46% 92 173910 0.45% 93 186918 0.49% 94 201100 0.52% 95 209246 0.55% 96 228634 0.60% 97 229820 0.60% 98 223194 0.58% 99 235991 0.62% 100 234055 0.61% 101 255134 0.67% 102 273201 0.71% 103 269244 0.70% 104 268270 0.70% 105 275604 0.72% 106 282750 0.74% 107 292380 0.76% 108 300680 0.78% 109 310043 0.81% 110 310746 0.81% 111 321391 0.84% 112 403585 1.05% 113 330203 0.86% 114 330082 0.86% 115 329369 0.86% 116 341343 0.89% 117 356859 0.93% 118 362264 0.94% 119 369619 0.96% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 0 0.00% 140 0 0.00% 141 0 0.00% 142 0 0.00% 143 0 0.00% 144 0 0.00% 145 0 0.00% 146 0 0.00% 147 0 0.00% 148 0 0.00% 149 0 0.00% 150 0 0.00% 151 26770348 69.78% 38363706 reads passed initial QC criterion=sequence-density sequence-density=18.17 sequence-density-rank=1 fanout-score=39.10 fanout-score-rank=1 prefix-density=21.19 prefix-fanout=33.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC criterion=fanout-score sequence-density=18.17 sequence-density-rank=1 fanout-score=39.10 fanout-score-rank=1 prefix-density=21.19 prefix-fanout=33.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -o SRR11462711 - Input file: STDIN trimmed: SRR11462711-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 07:28:12 2025 >> started Wed Feb 12 07:28:43 2025 >> done (30.533s) 34325421 reads processed; of these: 624 ( 0.00%) short reads filtered out after trimming by size control 5 ( 0.00%) empty reads filtered out after trimming by size control 34324792 (100.00%) reads available; of these: 10422296 (30.36%) trimmed reads available after processing 23902496 (69.64%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3764 0.01% 19 4179 0.01% 20 4632 0.01% 21 5172 0.02% 22 5680 0.02% 23 6011 0.02% 24 6487 0.02% 25 6541 0.02% 26 6585 0.02% 27 7375 0.02% 28 7767 0.02% 29 7942 0.02% 30 8259 0.02% 31 8871 0.03% 32 8655 0.03% 33 9195 0.03% 34 10049 0.03% 35 9946 0.03% 36 10465 0.03% 37 11830 0.03% 38 11057 0.03% 39 11784 0.03% 40 12386 0.04% 41 12609 0.04% 42 14016 0.04% 43 14234 0.04% 44 14735 0.04% 45 15304 0.04% 46 16899 0.05% 47 18336 0.05% 48 18095 0.05% 49 19656 0.06% 50 19493 0.06% 51 21211 0.06% 52 22406 0.07% 53 23532 0.07% 54 25774 0.08% 55 26652 0.08% 56 28010 0.08% 57 30860 0.09% 58 30664 0.09% 59 33152 0.10% 60 34534 0.10% 61 36431 0.11% 62 44478 0.13% 63 39453 0.11% 64 42387 0.12% 65 43086 0.13% 66 45354 0.13% 67 50054 0.15% 68 49834 0.15% 69 55542 0.16% 70 57156 0.17% 71 63181 0.18% 72 66594 0.19% 73 70143 0.20% 74 72178 0.21% 75 75688 0.22% 76 76415 0.22% 77 83396 0.24% 78 86043 0.25% 79 95241 0.28% 80 93006 0.27% 81 102285 0.30% 82 109398 0.32% 83 115232 0.34% 84 117189 0.34% 85 124156 0.36% 86 129133 0.38% 87 141720 0.41% 88 143555 0.42% 89 155175 0.45% 90 151720 0.44% 91 158663 0.46% 92 156306 0.46% 93 167591 0.49% 94 180630 0.53% 95 187717 0.55% 96 205900 0.60% 97 205702 0.60% 98 199923 0.58% 99 211921 0.62% 100 210055 0.61% 101 230470 0.67% 102 244806 0.71% 103 241811 0.70% 104 239743 0.70% 105 246724 0.72% 106 252887 0.74% 107 261789 0.76% 108 271233 0.79% 109 279144 0.81% 110 279427 0.81% 111 287743 0.84% 112 362257 1.06% 113 292873 0.85% 114 295608 0.86% 115 292779 0.85% 116 304416 0.89% 117 308586 0.90% 118 314837 0.92% 119 325757 0.95% 120 342009 1.00% 121 341052 0.99% 122 334587 0.97% 123 376628 1.10% 124 363374 1.06% 125 331126 0.96% 126 352459 1.03% 127 352479 1.03% 128 335430 0.98% 129 332600 0.97% 130 328753 0.96% 131 348075 1.01% 132 358895 1.05% 133 352965 1.03% 134 324385 0.95% 135 338755 0.99% 136 320406 0.93% 137 355683 1.04% 138 334073 0.97% 139 336768 0.98% 140 325202 0.95% 141 309672 0.90% 142 326065 0.95% 143 317832 0.93% 144 306347 0.89% 145 361984 1.05% 146 303498 0.88% 147 377482 1.10% 148 589383 1.72% 149 0 0.00% 150 0 0.00% 151 13869500 40.41% criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=31 prefix-density=0.38 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATTGTTATGTATTGGCCATGTCTGTGGCCTCTGGTGTGGTTTTAATGAAGTCTTATAATTAGTGTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=30.54 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=2.4 sequence=AACTTTGAAGGCCGAAGAGGGGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTTAGTCGATCCTAAGAGACGGGGGAAGCCCGTCCGACAGCGCGTTCGCGCGCGAGCTTCGAAAGGGAATCGGGTTAAAATTCCTGAACCGGGACGTGGCGGCTGACGGCAACGTTAGGGAGTCCGGAGACGTCGGCGGGGGCCTCGGGAAGAGTTATCTTTTCTGTTTAACAGCCCGCCCACCCTGGAAACGACTTAGTCGGAGGTAGGGTCCAGCGGCTGGAAGAGCACCGCACGTCGCGTGGTGTCCGGTGCGCCCCCGGCGGCCCTTGAAAATCCGGAGGACCGAGTGCCTCCCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAGCCTCTGGTCGATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTCGGGAAAAGGATTGGCTCTGAGGGCTGGGCTCGGGGGTCCCAGTCCCGAACCCGTC Started job on | Feb 12 07:29:16 Started mapping on | Feb 12 07:29:16 Finished on | Feb 12 07:30:16 Mapping speed, Million of reads per hour | 2301.78 Number of input reads | 38363077 Average input read length | 130 UNIQUE READS: Uniquely mapped reads number | 32895604 Uniquely mapped reads % | 85.75% Average mapped length | 126.79 Number of splices: Total | 13532825 Number of splices: Annotated (sjdb) | 13257308 Number of splices: GT/AG | 13271284 Number of splices: GC/AG | 203686 Number of splices: AT/AC | 7809 Number of splices: Non-canonical | 50046 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 1.96 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1000186 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 2066038 % of reads mapped to too many loci | 5.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.20% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4467287 4467287 4467287 N_multimapping 1000186 1000186 1000186 N_noFeature 1858150 2094597 32392233 N_ambiguous 406948 140268 719 UnstrandedReadsAssigned:30630506 PositiveStrandReadsAssigned:30660739 NegativeStrandReadsAssigned:502652 Dataset is classified positive stranded MeadianReadLen=139 20thPercentileLength=108 echo kmer=103 SRR11462711 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR11462711-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,363,077 reads, 32,064,481 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,350 rounds 52401 SRR11462711.ke.tsv 34699 SRR11462711.se.tsv 87100 total ==> SRR11462711.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1382.54 27.4313 Potri.005G024800.1.v4.1 1035 936 342 13.9122 Potri.004G059700.1.v4.1 961 862 48 2.12021 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 3243.6 43.4253 Potri.016G087400.1.v4.1 270 171 1985 441.987 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 37 0.841571 Potri.012G127500.1.v4.1 977 878 250 10.8415 ==> SRR11462711.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 591 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 297 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 25 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 121 SRR11462711 completed mapping pipeline successfully