Starting /dee2/code/volunteer_pipeline.sh SRR11462732 current disk space = 3051286753280 free memory = 1576320480 SRR11462732 SRAfilesize 8f1df43121f7919ddf3280f3d75c4aec SRR11462732.sra SRR11462732.sra file validated SRR11462732 is single end SRR11462732 is conventional basespace SRR11462732 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11462732_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.65125 32.0 2.0 32.0 2.0 32.0 2 31.81625 32.0 32.0 32.0 32.0 32.0 3 34.61 37.0 32.0 37.0 32.0 37.0 4 36.24 37.0 37.0 37.0 32.0 37.0 5 36.55375 37.0 37.0 37.0 37.0 37.0 6 40.0615 41.0 41.0 41.0 37.0 41.0 7 40.1795 41.0 41.0 41.0 37.0 41.0 8 40.22875 41.0 41.0 41.0 37.0 41.0 9 40.36025 41.0 41.0 41.0 41.0 41.0 10-14 40.33345 41.0 41.0 41.0 39.4 41.0 15-19 40.24895 41.0 41.0 41.0 37.8 41.0 20-24 40.27125 41.0 41.0 41.0 37.8 41.0 25-29 40.1845 41.0 41.0 41.0 37.8 41.0 30-34 40.0432 41.0 41.0 41.0 37.0 41.0 35-39 39.961850000000005 41.0 41.0 41.0 37.0 41.0 40-44 40.08055 41.0 41.0 41.0 37.0 41.0 45-49 40.1226 41.0 41.0 41.0 37.0 41.0 50-54 40.037099999999995 41.0 41.0 41.0 37.0 41.0 55-59 39.969849999999994 41.0 41.0 41.0 37.0 41.0 60-64 39.8932 41.0 41.0 41.0 37.0 41.0 65-69 39.92165 41.0 41.0 41.0 37.0 41.0 70-74 39.76625 41.0 41.0 41.0 37.0 41.0 75-79 39.67725 41.0 40.2 41.0 37.0 41.0 80-84 40.12095000000001 41.0 41.0 41.0 37.0 41.0 85-89 40.02575 41.0 41.0 41.0 37.0 41.0 90-94 40.062 41.0 41.0 41.0 37.8 41.0 95-99 39.91674999999999 41.0 41.0 41.0 37.0 41.0 100-104 39.845499999999994 41.0 41.0 41.0 37.0 41.0 105-109 39.86135 41.0 41.0 41.0 37.0 41.0 110-114 39.76425 41.0 41.0 41.0 37.0 41.0 115-119 39.766 41.0 41.0 41.0 37.0 41.0 120-124 39.6131 41.0 41.0 41.0 37.0 41.0 125-129 39.4409 41.0 41.0 41.0 37.0 41.0 130-134 39.2927 41.0 41.0 41.0 37.0 41.0 135-139 39.06464999999999 41.0 41.0 41.0 35.0 41.0 140-144 38.923500000000004 41.0 41.0 41.0 34.0 41.0 145-149 38.67515 41.0 41.0 41.0 32.0 41.0 150-151 37.929 41.0 39.0 41.0 29.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 2.0 25 0.0 26 1.0 27 3.0 28 3.0 29 17.0 30 29.0 31 26.0 32 54.0 33 56.0 34 74.0 35 90.0 36 96.0 37 133.0 38 162.0 39 323.0 40 2930.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 6.297229219143577 36.595897804965816 43.32493702770781 13.781935948182799 2 26.674999999999997 40.9 20.200000000000003 12.225 3 21.25 30.15 39.425 9.175 4 32.9 25.074999999999996 27.1 14.924999999999999 5 28.199999999999996 26.575 27.400000000000002 17.825 6 24.975 26.85 28.599999999999998 19.575 7 22.55 26.075 30.55 20.825 8 24.675 25.174999999999997 31.374999999999996 18.775 9 22.2 23.549999999999997 31.65 22.6 10-14 24.925 25.66 29.705 19.71 15-19 24.205 26.76 29.395 19.64 20-24 24.185000000000002 27.36 28.935 19.52 25-29 24.19 26.450000000000003 29.415000000000003 19.945 30-34 24.099999999999998 26.275 28.555000000000003 21.07 35-39 24.625 26.384999999999998 28.68 20.31 40-44 23.93 26.395000000000003 29.64 20.035 45-49 23.75 26.784999999999997 29.205 20.26 50-54 23.775 26.87 28.985 20.369999999999997 55-59 24.525 27.08 28.249999999999996 20.145 60-64 24.425 26.450000000000003 29.465000000000003 19.66 65-69 25.424999999999997 26.775 27.805000000000003 19.994999999999997 70-74 24.967496749674968 26.567656765676567 28.457845784578456 20.00700070007001 75-79 23.84 27.279999999999998 28.54 20.34 80-84 24.69 26.56 28.73 20.02 85-89 24.415 27.200000000000003 28.225 20.16 90-94 24.89 25.985000000000003 28.845 20.28 95-99 24.34 26.55 28.000000000000004 21.11 100-104 24.525 26.150000000000002 29.01 20.315 105-109 23.919999999999998 26.76 28.134999999999998 21.185000000000002 110-114 24.435000000000002 26.424999999999997 28.18 20.96 115-119 23.905 26.97 28.38 20.745 120-124 24.044999999999998 26.87 28.67 20.415 125-129 23.595 26.810000000000002 28.04 21.555 130-134 23.810000000000002 27.689999999999998 27.839999999999996 20.66 135-139 23.915 27.765 26.884999999999998 21.435000000000002 140-144 24.535 27.534999999999997 26.965 20.965 145-149 23.915 27.560000000000002 26.245 22.28 150-151 22.8625 28.012500000000003 26.0125 23.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 2.5 23 3.0 24 2.5 25 6.0 26 6.0 27 6.5 28 12.0 29 12.0 30 17.5 31 24.0 32 31.5 33 42.0 34 57.0 35 92.5 36 119.0 37 135.5 38 160.0 39 172.5 40 191.5 41 209.5 42 230.5 43 248.5 44 263.0 45 270.0 46 258.0 47 233.0 48 196.5 49 169.5 50 126.0 51 100.0 52 111.5 53 91.0 54 59.5 55 75.5 56 63.0 57 39.5 58 33.0 59 16.5 60 18.0 61 18.5 62 15.5 63 17.0 64 11.0 65 4.0 66 3.5 67 3.0 68 3.0 69 2.5 70 1.0 71 4.5 72 4.0 73 1.0 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 30.525000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.75348577802566 84.05 2 4.740658114891243 8.5 3 0.6134969325153374 1.6500000000000001 4 0.3067484662576687 1.0999999999999999 5 0.13943112102621305 0.625 6 0.13943112102621305 0.75 7 0.08365867261572783 0.525 8 0.055772448410485224 0.4 9 0.027886224205242612 0.22499999999999998 >10 0.13943112102621305 2.175 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGG 32 0.8 No Hit TATTTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACA 21 0.525 No Hit ATGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTTACTT 12 0.3 No Hit NATTTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACA 12 0.3 No Hit AGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTA 10 0.25 No Hit TACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCC 9 0.22499999999999998 No Hit TGTTGGCCTTCGGGATCGGAGTAATGATTAACAGGGACAGTCGGGGGCAT 8 0.2 No Hit ACTTATTCCGTGAATCGGAGGCGGGGCGCTGCCCCTCTTTTTGGACCCAA 8 0.2 No Hit AAAGACGAACAACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAA 7 0.17500000000000002 No Hit NTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCC 7 0.17500000000000002 No Hit NGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGG 7 0.17500000000000002 No Hit GAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGC 6 0.15 No Hit TGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTG 6 0.15 No Hit NTGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTTACTT 6 0.15 No Hit CACCTGGGGCTGTAGTATGTTCCAAGGGTTGGGCTGTTCGCCCATTAAAG 6 0.15 No Hit CAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTC 6 0.15 No Hit AATCCGGGCTAGATGCGACGCGTGCGCCCGCCGTCCGATTGCCGACCTGC 5 0.125 No Hit CGTTGACTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCCTACCGA 5 0.125 No Hit NGTTGGCCTTCGGGATCGGAGTAATGATTAACAGGGACAGTCGGGGGCAT 5 0.125 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit GATGTCGGCTCTTCGCCACCTGGGGCTGTAGTATGTTCCAAGGGTTGGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.037500000000000006 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.11249999999999999 0.0 0.0 0.0 0.0 48-49 0.175 0.0 0.0 0.0 0.0 50-51 0.21250000000000002 0.0 0.0 0.0 0.0 52-53 0.2625 0.0 0.0 0.0 0.0 54-55 0.3 0.0 0.0 0.0 0.0 56-57 0.3125 0.0 0.0 0.0 0.0 58-59 0.4 0.0 0.0 0.0 0.0 60-61 0.4625 0.0 0.0 0.0 0.0 62-63 0.575 0.0 0.0 0.0 0.0 64-65 0.7 0.0 0.0 0.0 0.0 66-67 0.825 0.0 0.0 0.0 0.0 68-69 0.9875 0.0 0.0 0.0 0.0 70-71 1.1375 0.0 0.0 0.0 0.0 72-73 1.2625 0.0 0.0 0.0 0.0 74-75 1.475 0.0 0.0 0.0 0.0 76-77 1.575 0.0 0.0 0.0 0.0 78-79 1.8624999999999998 0.0 0.0 0.0 0.0 80-81 2.2 0.0 0.0 0.0 0.0 82-83 2.375 0.0 0.0 0.0 0.0 84-85 2.625 0.0 0.0 0.0 0.0 86-87 2.8499999999999996 0.0 0.0 0.0 0.0 88-89 3.0125 0.0 0.0 0.0 0.0 90-91 3.575 0.0 0.0 0.0 0.0 92-93 3.9375 0.0 0.0 0.0 0.0 94-95 4.2625 0.0 0.0 0.0 0.0 96-97 4.699999999999999 0.0 0.0 0.0 0.0 98-99 5.1 0.0 0.0 0.0 0.0 100-101 5.65 0.0 0.0 0.0 0.0 102-103 6.05 0.0 0.0 0.0 0.0 104-105 6.449999999999999 0.0 0.0 0.0 0.0 106-107 7.025 0.0 0.0 0.0 0.0 108-109 7.775 0.0 0.0 0.0 0.0 110-111 8.537500000000001 0.0 0.0 0.0 0.0 112-113 9.25 0.0 0.0 0.0 0.0 114-115 10.087499999999999 0.0 0.0 0.0 0.0 116-117 10.725 0.0 0.0 0.0 0.0 118-119 11.2375 0.0 0.0 0.0 0.0 120-121 11.825 0.0 0.0 0.0 0.0 122-123 12.7125 0.0 0.0 0.0 0.0 124-125 13.925 0.0 0.0 0.0 0.0 126-127 14.85 0.0 0.0 0.0 0.0 128-129 15.9875 0.0 0.0 0.0 0.0 130-131 17.3 0.0 0.0 0.0 0.0 132-133 18.3625 0.0 0.0 0.0 0.0 134-135 19.549999999999997 0.0 0.0 0.0 0.0 136-137 20.75 0.0 0.0 0.0 0.0 138-139 21.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTACTC 10 0.00687326 144.7 6 TGGACAG 10 0.00687326 144.7 3 ATTTGCT 30 0.0018121823 72.350006 2 >>END_MODULE Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760145 READS because READLEN < 1 Read 1760145 spots for SRR11462732.sra Written 1760145 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra Rejected 1760139 READS because READLEN < 1 Read 1760139 spots for SRR11462732.sra Written 1760139 spots for SRR11462732.sra SRR ids: ['SRR11462732.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3n1r3i7r SRR11462732.sra spots: 35202786 blocks: [[1, 1760139], [1760140, 3520278], [3520279, 5280417], [5280418, 7040556], [7040557, 8800695], [8800696, 10560834], [10560835, 12320973], [12320974, 14081112], [14081113, 15841251], [15841252, 17601390], [17601391, 19361529], [19361530, 21121668], [21121669, 22881807], [22881808, 24641946], [24641947, 26402085], [26402086, 28162224], [28162225, 29922363], [29922364, 31682502], [31682503, 33442641], [33442642, 35202786]] SRR11462732 file size 11941746 SRR11462732 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11462732 SRR11462732_1.fastq Input file: SRR11462732_1.fastq trimmed: SRR11462732-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 11:23:34 2025 >> started Wed Feb 12 11:23:53 2025 >> done (19.550s) 35202786 reads processed; of these: 6001 ( 0.02%) short reads filtered out after trimming by size control 410 ( 0.00%) empty reads filtered out after trimming by size control 35196375 (99.98%) reads available; of these: 4095494 (11.64%) trimmed reads available after processing 31100881 (88.36%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1285 0.00% 19 1498 0.00% 20 1662 0.00% 21 1839 0.01% 22 2173 0.01% 23 2279 0.01% 24 2452 0.01% 25 2325 0.01% 26 2600 0.01% 27 3504 0.01% 28 2809 0.01% 29 3073 0.01% 30 3257 0.01% 31 3298 0.01% 32 3456 0.01% 33 3633 0.01% 34 3890 0.01% 35 4030 0.01% 36 4081 0.01% 37 5614 0.02% 38 4455 0.01% 39 4841 0.01% 40 5002 0.01% 41 4951 0.01% 42 5878 0.02% 43 5737 0.02% 44 5865 0.02% 45 7744 0.02% 46 6951 0.02% 47 10108 0.03% 48 8869 0.03% 49 12582 0.04% 50 8136 0.02% 51 9087 0.03% 52 9000 0.03% 53 9676 0.03% 54 11414 0.03% 55 10235 0.03% 56 11430 0.03% 57 12826 0.04% 58 11963 0.03% 59 12799 0.04% 60 14758 0.04% 61 14202 0.04% 62 41877 0.12% 63 15047 0.04% 64 17626 0.05% 65 15910 0.05% 66 16428 0.05% 67 18062 0.05% 68 17829 0.05% 69 26876 0.08% 70 20058 0.06% 71 22593 0.06% 72 25406 0.07% 73 30218 0.09% 74 34307 0.10% 75 27296 0.08% 76 24537 0.07% 77 31217 0.09% 78 28149 0.08% 79 36502 0.10% 80 30194 0.09% 81 31241 0.09% 82 34152 0.10% 83 34866 0.10% 84 38692 0.11% 85 39766 0.11% 86 42879 0.12% 87 45162 0.13% 88 43946 0.12% 89 131748 0.37% 90 50031 0.14% 91 57348 0.16% 92 50180 0.14% 93 54870 0.16% 94 60662 0.17% 95 57429 0.16% 96 65410 0.19% 97 69460 0.20% 98 65152 0.19% 99 67925 0.19% 100 69455 0.20% 101 75906 0.22% 102 110023 0.31% 103 81201 0.23% 104 82391 0.23% 105 86263 0.25% 106 88986 0.25% 107 94943 0.27% 108 104189 0.30% 109 129476 0.37% 110 110309 0.31% 111 111369 0.32% 112 233805 0.66% 113 121774 0.35% 114 120027 0.34% 115 123741 0.35% 116 126287 0.36% 117 137597 0.39% 118 143075 0.41% 119 146346 0.42% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 0 0.00% 140 0 0.00% 141 0 0.00% 142 0 0.00% 143 0 0.00% 144 0 0.00% 145 0 0.00% 146 0 0.00% 147 0 0.00% 148 0 0.00% 149 0 0.00% 150 13 0.00% 151 31100881 88.36% 35196375 reads passed initial QC criterion=sequence-density sequence-density=9.96 sequence-density-rank=1 fanout-score=40.41 fanout-score-rank=1 prefix-density=12.00 prefix-fanout=33.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC criterion=fanout-score sequence-density=9.96 sequence-density-rank=1 fanout-score=40.41 fanout-score-rank=1 prefix-density=12.00 prefix-fanout=33.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -o SRR11462732 - Input file: STDIN trimmed: SRR11462732-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 11:25:13 2025 >> started Wed Feb 12 11:25:42 2025 >> done (28.922s) 28157100 reads processed; of these: 151 ( 0.00%) short reads filtered out after trimming by size control 4 ( 0.00%) empty reads filtered out after trimming by size control 28156945 (100.00%) reads available; of these: 5681391 (20.18%) trimmed reads available after processing 22475554 (79.82%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1051 0.00% 19 1255 0.00% 20 1328 0.00% 21 1462 0.01% 22 1734 0.01% 23 1822 0.01% 24 1989 0.01% 25 1902 0.01% 26 2093 0.01% 27 2786 0.01% 28 2270 0.01% 29 2505 0.01% 30 2603 0.01% 31 2704 0.01% 32 2762 0.01% 33 2893 0.01% 34 3118 0.01% 35 3241 0.01% 36 3226 0.01% 37 4512 0.02% 38 3572 0.01% 39 3937 0.01% 40 3963 0.01% 41 3998 0.01% 42 4669 0.02% 43 4664 0.02% 44 4764 0.02% 45 6313 0.02% 46 5635 0.02% 47 8096 0.03% 48 7022 0.02% 49 10062 0.04% 50 6544 0.02% 51 7302 0.03% 52 7219 0.03% 53 7860 0.03% 54 9155 0.03% 55 8208 0.03% 56 9091 0.03% 57 10329 0.04% 58 9615 0.03% 59 10301 0.04% 60 11878 0.04% 61 11338 0.04% 62 33517 0.12% 63 12122 0.04% 64 14135 0.05% 65 12663 0.04% 66 13259 0.05% 67 14488 0.05% 68 14474 0.05% 69 21547 0.08% 70 16441 0.06% 71 18086 0.06% 72 20497 0.07% 73 24200 0.09% 74 27353 0.10% 75 21634 0.08% 76 19767 0.07% 77 25114 0.09% 78 22725 0.08% 79 29267 0.10% 80 24172 0.09% 81 25343 0.09% 82 27515 0.10% 83 27953 0.10% 84 30756 0.11% 85 31851 0.11% 86 34327 0.12% 87 36100 0.13% 88 35434 0.13% 89 105587 0.37% 90 40588 0.14% 91 46228 0.16% 92 40608 0.14% 93 44035 0.16% 94 48505 0.17% 95 45769 0.16% 96 52452 0.19% 97 55575 0.20% 98 52527 0.19% 99 54890 0.19% 100 55568 0.20% 101 61042 0.22% 102 88099 0.31% 103 65447 0.23% 104 66209 0.24% 105 69453 0.25% 106 71356 0.25% 107 75894 0.27% 108 83638 0.30% 109 103601 0.37% 110 88575 0.31% 111 89299 0.32% 112 188701 0.67% 113 97189 0.35% 114 96347 0.34% 115 98382 0.35% 116 101410 0.36% 117 106970 0.38% 118 110818 0.39% 119 115275 0.41% 120 126218 0.45% 121 133647 0.47% 122 128290 0.46% 123 162389 0.58% 124 153028 0.54% 125 133487 0.47% 126 142189 0.50% 127 160773 0.57% 128 149742 0.53% 129 151349 0.54% 130 150955 0.54% 131 155442 0.55% 132 190331 0.68% 133 206547 0.73% 134 171204 0.61% 135 186976 0.66% 136 172213 0.61% 137 178959 0.64% 138 199653 0.71% 139 187515 0.67% 140 216712 0.77% 141 186164 0.66% 142 196845 0.70% 143 203469 0.72% 144 199670 0.71% 145 223897 0.80% 146 209078 0.74% 147 304946 1.08% 148 604428 2.15% 149 0 0.00% 150 5 0.00% 151 19293256 68.52% criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=36 prefix-density=0.96 prefix-fanout=1.9 sequence=ACGTGAGCTGGGTTCAGAACGTCGTGAGACAGTTCGGTCCATATCCGGTGTGGGCGTTAGAGCATTGAGAGGACCTTTCCCTAGTACGAGAGGACCGGGAAGGACGCACCTCTGGTGTACCAGTTATTGTGCCCACGGTAAACGCTGGGTAGCCAAGTGCGGAGCGGATAACTGCTGAAAGCATCTAAGTAGTAAGCCCACCCCAAGATGAGTGCTCTCCT criterion=fanout-score sequence-density=0.13 sequence-density-rank=12 fanout-score=26.61 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=10.6 sequence=GATTTTGATTTTGACCCTTGTGGTTACTC Started job on | Feb 12 11:26:18 Started mapping on | Feb 12 11:26:18 Finished on | Feb 12 11:27:38 Mapping speed, Million of reads per hour | 1583.83 Number of input reads | 35196220 Average input read length | 142 UNIQUE READS: Uniquely mapped reads number | 28993745 Uniquely mapped reads % | 82.38% Average mapped length | 140.23 Number of splices: Total | 12958583 Number of splices: Annotated (sjdb) | 12642346 Number of splices: GT/AG | 12734892 Number of splices: GC/AG | 176150 Number of splices: AT/AC | 6914 Number of splices: Non-canonical | 40627 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 875914 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 3035853 % of reads mapped to too many loci | 8.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.37% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5326561 5326561 5326561 N_multimapping 875914 875914 875914 N_noFeature 1714050 2202868 27957045 N_ambiguous 660287 112580 541 UnstrandedReadsAssigned:26619408 PositiveStrandReadsAssigned:26678297 NegativeStrandReadsAssigned:1036159 Dataset is classified positive stranded MeadianReadLen=151 20thPercentileLength=135 echo kmer=131 SRR11462732 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR11462732-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,196,220 reads, 28,040,898 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR11462732.ke.tsv 34699 SRR11462732.se.tsv 87100 total ==> SRR11462732.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2591 49.4114 Potri.005G024800.1.v4.1 1035 936 1052 41.1315 Potri.004G059700.1.v4.1 961 862 1 0.0424549 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 2388.95 30.7406 Potri.016G087400.1.v4.1 270 171 1822 389.93 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1884.97 41.2082 Potri.012G127500.1.v4.1 977 878 28 1.16707 ==> SRR11462732.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 194 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 61 SRR11462732 completed mapping pipeline successfully