Starting /dee2/code/volunteer_pipeline.sh SRR11462738 current disk space = 3051317325824 free memory = 1582321748 SRR11462738 SRAfilesize 97a239c15038a346f4ce0c6a1bcdf357 SRR11462738.sra SRR11462738.sra file validated SRR11462738 is single end SRR11462738 is conventional basespace SRR11462738 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11462738_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.43125 32.0 2.0 32.0 2.0 32.0 2 31.71 32.0 32.0 32.0 32.0 32.0 3 34.085 32.0 32.0 37.0 32.0 37.0 4 36.10625 37.0 37.0 37.0 32.0 37.0 5 36.5275 37.0 37.0 37.0 37.0 37.0 6 40.03875 41.0 41.0 41.0 37.0 41.0 7 40.117 41.0 41.0 41.0 37.0 41.0 8 40.156 41.0 41.0 41.0 37.0 41.0 9 40.24025 41.0 41.0 41.0 37.0 41.0 10-14 40.3067 41.0 41.0 41.0 38.6 41.0 15-19 40.229299999999995 41.0 41.0 41.0 37.8 41.0 20-24 40.2244 41.0 41.0 41.0 37.0 41.0 25-29 40.1529 41.0 41.0 41.0 37.0 41.0 30-34 40.05174999999999 41.0 41.0 41.0 37.0 41.0 35-39 39.94345 41.0 41.0 41.0 37.0 41.0 40-44 39.98295 41.0 41.0 41.0 37.0 41.0 45-49 39.98405 41.0 41.0 41.0 37.0 41.0 50-54 39.980199999999996 41.0 41.0 41.0 37.0 41.0 55-59 39.883799999999994 41.0 41.0 41.0 37.0 41.0 60-64 39.900549999999996 41.0 41.0 41.0 37.0 41.0 65-69 39.87035000000001 41.0 41.0 41.0 37.0 41.0 70-74 39.76915 41.0 41.0 41.0 37.0 41.0 75-79 39.65865 41.0 40.2 41.0 37.0 41.0 80-84 40.012 41.0 41.0 41.0 37.0 41.0 85-89 39.993100000000005 41.0 41.0 41.0 37.0 41.0 90-94 39.95215 41.0 41.0 41.0 37.0 41.0 95-99 39.87905000000001 41.0 41.0 41.0 37.0 41.0 100-104 39.818650000000005 41.0 41.0 41.0 37.0 41.0 105-109 39.79025 41.0 41.0 41.0 37.0 41.0 110-114 39.684450000000005 41.0 41.0 41.0 37.0 41.0 115-119 39.6323 41.0 41.0 41.0 37.0 41.0 120-124 39.49835 41.0 41.0 41.0 37.0 41.0 125-129 39.283849999999994 41.0 41.0 41.0 37.0 41.0 130-134 39.09665 41.0 41.0 41.0 37.0 41.0 135-139 38.8251 41.0 41.0 41.0 35.0 41.0 140-144 38.769949999999994 41.0 41.0 41.0 33.0 41.0 145-149 38.5911 41.0 41.0 41.0 32.0 41.0 150-151 37.745125 41.0 39.0 41.0 29.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 3.0 26 2.0 27 6.0 28 12.0 29 29.0 30 24.0 31 29.0 32 50.0 33 57.0 34 72.0 35 81.0 36 124.0 37 132.0 38 143.0 39 359.0 40 2875.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 7.331628303495311 36.91389599317988 41.04859335038363 14.705882352941178 2 26.0 42.625 20.1 11.275 3 23.275000000000002 27.474999999999998 37.85 11.4 4 33.35 23.724999999999998 28.175 14.75 5 28.349999999999998 25.974999999999998 27.975 17.7 6 27.150000000000002 25.874999999999996 28.1 18.875 7 23.075000000000003 27.625 28.325 20.974999999999998 8 26.375 24.675 30.475 18.475 9 21.75 24.6 32.975 20.674999999999997 10-14 25.56 25.11 29.25 20.080000000000002 15-19 24.115000000000002 27.339999999999996 28.849999999999998 19.695 20-24 25.305 26.674999999999997 27.665 20.355 25-29 24.81 26.384999999999998 28.735 20.07 30-34 24.89 25.974999999999998 28.58 20.555 35-39 24.905 25.569999999999997 28.335 21.19 40-44 24.55 26.025 28.555000000000003 20.87 45-49 23.685000000000002 26.590000000000003 28.165000000000003 21.560000000000002 50-54 24.545 26.834999999999997 27.584999999999997 21.035 55-59 24.990000000000002 26.86 27.58 20.57 60-64 25.130000000000003 26.334999999999997 29.095 19.439999999999998 65-69 25.47 26.290000000000003 27.134999999999998 21.105 70-74 24.766238311915593 27.211360568028404 27.091354567728388 20.93104655232762 75-79 24.169999999999998 26.83 28.43 20.57 80-84 25.035 26.985 28.310000000000002 19.67 85-89 24.349999999999998 27.26 28.21 20.18 90-94 25.55 25.135 28.765 20.549999999999997 95-99 25.41 26.195 27.224999999999998 21.17 100-104 25.53 26.045 27.875 20.549999999999997 105-109 23.645 26.165 27.685 22.505 110-114 25.28 26.26 27.54 20.919999999999998 115-119 24.55 26.46 28.01 20.979999999999997 120-124 24.5 27.215 27.61 20.674999999999997 125-129 24.044999999999998 27.815 26.669999999999998 21.47 130-134 23.919999999999998 28.395 26.625 21.060000000000002 135-139 24.185000000000002 28.27 25.665 21.88 140-144 24.745 28.48 24.72 22.055 145-149 24.5 27.615000000000002 24.775 23.11 150-151 22.9375 27.762500000000003 25.15 24.15 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 1.0 26 3.0 27 4.5 28 8.0 29 14.0 30 19.5 31 20.5 32 27.0 33 43.0 34 63.5 35 87.0 36 103.5 37 112.5 38 132.0 39 146.0 40 155.0 41 192.5 42 228.0 43 246.0 44 267.5 45 268.5 46 247.5 47 240.5 48 217.0 49 176.5 50 149.5 51 119.5 52 113.0 53 98.5 54 77.5 55 85.0 56 71.5 57 46.5 58 37.5 59 27.5 60 24.0 61 18.5 62 17.5 63 26.0 64 14.5 65 3.0 66 1.5 67 3.5 68 7.5 69 9.5 70 6.5 71 7.5 72 5.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 41.349999999999994 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.075 #Duplication Level Percentage of deduplicated Percentage of total 1 92.96583405110536 80.95 2 5.0818260120585705 8.85 3 0.8326155612977318 2.175 4 0.4019523399368361 1.4000000000000001 5 0.17226528854435832 0.75 6 0.20097616996841805 1.05 7 0.057421762848119444 0.35000000000000003 8 0.057421762848119444 0.4 9 0.0 0.0 >10 0.22968705139247778 4.075 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TATTTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACA 45 1.125 No Hit ATGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTTACTT 26 0.65 No Hit NATTTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACA 25 0.625 No Hit TGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGG 19 0.475 No Hit NTGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTTACTT 14 0.35000000000000003 No Hit NGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGG 13 0.325 No Hit TACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCC 11 0.27499999999999997 No Hit CAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTC 10 0.25 No Hit NAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTC 8 0.2 No Hit ACCTGGGGCTGTAGTATGTTCCAAGGGTTGGGCTGTTCGCCCATTAAAGC 8 0.2 No Hit NATTTTACTTATTCCGTGAATCGGAGGCGGGGCGCTGCCCCTCTTTTTGG 7 0.17500000000000002 No Hit CGGGCCGCCTTGAAGTACAATTCCCACCGAGCGGCGGGTAGAATCCTTTG 7 0.17500000000000002 No Hit ACTACTTTTAACGTTATTTTACTTATTCCGTGAATCGGAGGCGGGGCGCT 6 0.15 No Hit NAAGACGAACAACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAA 6 0.15 No Hit NGCAACAAACCCCGACTTCTGGAAGGGACGCATTTATTAGATAAAAGGTC 6 0.15 No Hit TAAAAAGCTCGTAGTTGGACTTTGGGTTGGGTCGGCCGGTCCGCCTCAGG 6 0.15 No Hit NGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA 6 0.15 No Hit TATTTTACTTATTCCGTGAATCGGAGGCGGGGCGCTGCCCCTCTTTTTGG 6 0.15 No Hit AGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTA 6 0.15 No Hit NAAAAAGCTCGTAGTTGGACTTTGGGTTGGGTCGGCCGGTCCGCCTCAGG 5 0.125 No Hit NGGTGAAAGAGCCGCGCGGGCCGCCTTGAAGTACAATTCCCACCGAGCGG 5 0.125 No Hit CTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCC 5 0.125 No Hit NTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCC 5 0.125 No Hit NACCTGGGGCTGTAGTATGTTCCAAGGGTTGGGCTGTTCGCCCATTAAAG 5 0.125 No Hit NATCCGGGCTAGATGCGACGCGTGCGCCCGCCGTCCGATTGCCGACCTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.037500000000000006 0.0 0.0 0.0 0.0 20-21 0.0625 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.21250000000000002 0.0 0.0 0.0 0.0 36-37 0.2375 0.0 0.0 0.0 0.0 38-39 0.2875 0.0 0.0 0.0 0.0 40-41 0.375 0.0 0.0 0.0 0.0 42-43 0.4 0.0 0.0 0.0 0.0 44-45 0.4125 0.0 0.0 0.0 0.0 46-47 0.475 0.0 0.0 0.0 0.0 48-49 0.525 0.0 0.0 0.0 0.0 50-51 0.5375000000000001 0.0 0.0 0.0 0.0 52-53 0.5625 0.0 0.0 0.0 0.0 54-55 0.6 0.0 0.0 0.0 0.0 56-57 0.65 0.0 0.0 0.0 0.0 58-59 0.675 0.0 0.0 0.0 0.0 60-61 0.7625 0.0 0.0 0.0 0.0 62-63 0.8999999999999999 0.0 0.0 0.0 0.0 64-65 1.125 0.0 0.0 0.0 0.0 66-67 1.25 0.0 0.0 0.0 0.0 68-69 1.35 0.0 0.0 0.0 0.0 70-71 1.4874999999999998 0.0 0.0 0.0 0.0 72-73 1.7125 0.0 0.0 0.0 0.0 74-75 2.025 0.0 0.0 0.0 0.0 76-77 2.1624999999999996 0.0 0.0 0.0 0.0 78-79 2.3375 0.0 0.0 0.0 0.0 80-81 2.5125 0.0 0.0 0.0 0.0 82-83 2.775 0.0 0.0 0.0 0.0 84-85 2.9749999999999996 0.0 0.0 0.0 0.0 86-87 3.2375 0.0 0.0 0.0 0.0 88-89 3.5125 0.0 0.0 0.0 0.0 90-91 4.1 0.0 0.0 0.0 0.0 92-93 4.525 0.0 0.0 0.0 0.0 94-95 4.8125 0.0 0.0 0.0 0.0 96-97 5.35 0.0 0.0 0.0 0.0 98-99 5.9375 0.0 0.0 0.0 0.0 100-101 6.325 0.0 0.0 0.0 0.0 102-103 6.824999999999999 0.0 0.0 0.0 0.0 104-105 7.3125 0.0 0.0 0.0 0.0 106-107 7.6875 0.0 0.0 0.0 0.0 108-109 8.4375 0.0 0.0 0.0 0.0 110-111 9.175 0.0 0.0 0.0 0.0 112-113 10.1125 0.0 0.0 0.0 0.0 114-115 11.325 0.0 0.0 0.0 0.0 116-117 12.125 0.0 0.0 0.0 0.0 118-119 13.025 0.0 0.0 0.0 0.0 120-121 13.8125 0.0 0.0 0.0 0.0 122-123 14.9375 0.0 0.0 0.0 0.0 124-125 15.9875 0.0 0.0 0.0 0.0 126-127 17.0875 0.0 0.0 0.0 0.0 128-129 18.362499999999997 0.0 0.0 0.0 0.0 130-131 19.737499999999997 0.0 0.0 0.0 0.0 132-133 21.0 0.0 0.0 0.0 0.0 134-135 22.4125 0.0 0.0 0.0 0.0 136-137 23.775 0.0 0.0 0.0 0.0 138-139 25.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGCGCT 15 0.004595387 164.07092 1 TGTCCTA 10 0.0068892627 144.5875 145 TTTTAGT 10 0.0068892627 144.5875 3 CTCCTGG 30 9.280302E-8 120.48958 6 GCGCTCC 30 9.280302E-8 120.48958 3 TCCTGGC 30 9.280302E-8 120.48958 7 CCTGGCC 30 9.280302E-8 120.48958 8 TGCGCTC 35 2.3273424E-7 103.27679 2 CGCTCCT 35 2.3273424E-7 103.27679 4 CTGGCCT 35 2.3273424E-7 103.27679 9 ACCACCG 50 1.9459421E-6 72.29375 145 GCTCCTG 50 1.9459421E-6 72.29375 5 ACGCTCT 25 5.0613703E-4 28.9175 80-84 CCTACGC 25 5.0613703E-4 28.9175 75-79 GCAAGCC 20 0.0060183136 28.9175 70-74 AAATTAG 20 0.0060183136 28.9175 55-59 ATTAGCA 25 5.0613703E-4 28.9175 90-94 ATTAGAG 20 0.0060183136 28.9175 55-59 GCCTACG 25 5.0613703E-4 28.9175 75-79 TCTGGAT 25 5.0613703E-4 28.9175 85-89 >>END_MODULE Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319109 READS because READLEN < 1 Read 2319109 spots for SRR11462738.sra Written 2319109 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra Rejected 2319091 READS because READLEN < 1 Read 2319091 spots for SRR11462738.sra Written 2319091 spots for SRR11462738.sra SRR ids: ['SRR11462738.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fh9hqqib SRR11462738.sra spots: 46381838 blocks: [[1, 2319091], [2319092, 4638182], [4638183, 6957273], [6957274, 9276364], [9276365, 11595455], [11595456, 13914546], [13914547, 16233637], [16233638, 18552728], [18552729, 20871819], [20871820, 23190910], [23190911, 25510001], [25510002, 27829092], [27829093, 30148183], [30148184, 32467274], [32467275, 34786365], [34786366, 37105456], [37105457, 39424547], [39424548, 41743638], [41743639, 44062729], [44062730, 46381838]] SRR11462738 file size 15740877 SRR11462738 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11462738 SRR11462738_1.fastq Input file: SRR11462738_1.fastq trimmed: SRR11462738-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 12:04:35 2025 >> started Wed Feb 12 12:05:01 2025 >> done (25.417s) 46381838 reads processed; of these: 10696 ( 0.02%) short reads filtered out after trimming by size control 1019 ( 0.00%) empty reads filtered out after trimming by size control 46370123 (99.97%) reads available; of these: 6586554 (14.20%) trimmed reads available after processing 39783569 (85.80%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2458 0.01% 19 2744 0.01% 20 3394 0.01% 21 3438 0.01% 22 3672 0.01% 23 4166 0.01% 24 4535 0.01% 25 4431 0.01% 26 4437 0.01% 27 5467 0.01% 28 4974 0.01% 29 5434 0.01% 30 5847 0.01% 31 5759 0.01% 32 5903 0.01% 33 6172 0.01% 34 6501 0.01% 35 6906 0.01% 36 6884 0.01% 37 9553 0.02% 38 7602 0.02% 39 8190 0.02% 40 8241 0.02% 41 8377 0.02% 42 10039 0.02% 43 10501 0.02% 44 9843 0.02% 45 11263 0.02% 46 11119 0.02% 47 15727 0.03% 48 13062 0.03% 49 16868 0.04% 50 13111 0.03% 51 14534 0.03% 52 15255 0.03% 53 16053 0.03% 54 18922 0.04% 55 17555 0.04% 56 18421 0.04% 57 20614 0.04% 58 19749 0.04% 59 21741 0.05% 60 23154 0.05% 61 22509 0.05% 62 53396 0.12% 63 24257 0.05% 64 28946 0.06% 65 26138 0.06% 66 27498 0.06% 67 29224 0.06% 68 28602 0.06% 69 40196 0.09% 70 32352 0.07% 71 36956 0.08% 72 39822 0.09% 73 46576 0.10% 74 51688 0.11% 75 43258 0.09% 76 40234 0.09% 77 55154 0.12% 78 46977 0.10% 79 60779 0.13% 80 48205 0.10% 81 51819 0.11% 82 55995 0.12% 83 57952 0.12% 84 67950 0.15% 85 63986 0.14% 86 70215 0.15% 87 73628 0.16% 88 72555 0.16% 89 168064 0.36% 90 79701 0.17% 91 91215 0.20% 92 82768 0.18% 93 86086 0.19% 94 96763 0.21% 95 93904 0.20% 96 123227 0.27% 97 125111 0.27% 98 104761 0.23% 99 111491 0.24% 100 110476 0.24% 101 125257 0.27% 102 150225 0.32% 103 130498 0.28% 104 134815 0.29% 105 136841 0.30% 106 144675 0.31% 107 152896 0.33% 108 161840 0.35% 109 195877 0.42% 110 171252 0.37% 111 177825 0.38% 112 452134 0.98% 113 192976 0.42% 114 191954 0.41% 115 193648 0.42% 116 201296 0.43% 117 220090 0.47% 118 224515 0.48% 119 224870 0.48% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 0 0.00% 140 0 0.00% 141 0 0.00% 142 0 0.00% 143 0 0.00% 144 0 0.00% 145 0 0.00% 146 0 0.00% 147 0 0.00% 148 0 0.00% 149 0 0.00% 150 20 0.00% 151 39783569 85.80% 46370123 reads passed initial QC criterion=sequence-density sequence-density=12.12 sequence-density-rank=1 fanout-score=39.98 fanout-score-rank=1 prefix-density=14.49 prefix-fanout=33.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCACCGGATCTCGTATGCCGTCTTCTGCTTGAA criterion=fanout-score sequence-density=12.12 sequence-density-rank=1 fanout-score=39.98 fanout-score-rank=1 prefix-density=14.49 prefix-fanout=33.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCACCGGATCTCGTATGCCGTCTTCTGCTTGAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCACCGGATCTCGTATGCCGTCTTCTGCTTGAA -o SRR11462738 - Input file: STDIN trimmed: SRR11462738-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCACCGGATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 12:06:36 2025 >> started Wed Feb 12 12:07:20 2025 >> done (44.192s) 39236258 reads processed; of these: 379 ( 0.00%) short reads filtered out after trimming by size control 9 ( 0.00%) empty reads filtered out after trimming by size control 39235870 (100.00%) reads available; of these: 8999332 (22.94%) trimmed reads available after processing 30236538 (77.06%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2125 0.01% 19 2419 0.01% 20 2901 0.01% 21 2941 0.01% 22 3171 0.01% 23 3574 0.01% 24 3847 0.01% 25 3789 0.01% 26 3767 0.01% 27 4639 0.01% 28 4263 0.01% 29 4664 0.01% 30 4991 0.01% 31 4843 0.01% 32 5012 0.01% 33 5335 0.01% 34 5542 0.01% 35 5860 0.01% 36 5860 0.01% 37 8191 0.02% 38 6530 0.02% 39 7015 0.02% 40 7044 0.02% 41 7125 0.02% 42 8528 0.02% 43 9016 0.02% 44 8408 0.02% 45 9741 0.02% 46 9510 0.02% 47 13451 0.03% 48 11119 0.03% 49 14395 0.04% 50 11333 0.03% 51 12485 0.03% 52 13186 0.03% 53 13863 0.04% 54 16075 0.04% 55 14980 0.04% 56 15517 0.04% 57 17527 0.04% 58 16700 0.04% 59 18457 0.05% 60 19836 0.05% 61 19304 0.05% 62 45469 0.12% 63 20741 0.05% 64 24652 0.06% 65 22322 0.06% 66 23482 0.06% 67 25026 0.06% 68 24575 0.06% 69 34086 0.09% 70 28253 0.07% 71 31574 0.08% 72 34072 0.09% 73 39685 0.10% 74 43914 0.11% 75 36228 0.09% 76 34257 0.09% 77 47198 0.12% 78 40115 0.10% 79 51738 0.13% 80 41098 0.10% 81 46769 0.12% 82 47682 0.12% 83 49289 0.13% 84 55108 0.14% 85 54661 0.14% 86 60028 0.15% 87 63325 0.16% 88 62241 0.16% 89 143253 0.37% 90 68739 0.18% 91 77990 0.20% 92 71084 0.18% 93 72964 0.19% 94 82753 0.21% 95 79659 0.20% 96 105371 0.27% 97 106231 0.27% 98 89436 0.23% 99 95481 0.24% 100 94369 0.24% 101 107357 0.27% 102 128004 0.33% 103 111530 0.28% 104 114996 0.29% 105 116585 0.30% 106 123222 0.31% 107 129627 0.33% 108 138432 0.35% 109 166727 0.42% 110 146258 0.37% 111 151304 0.39% 112 386359 0.98% 113 163634 0.42% 114 163329 0.42% 115 163568 0.42% 116 171091 0.44% 117 180748 0.46% 118 184158 0.47% 119 187543 0.48% 120 207763 0.53% 121 218191 0.56% 122 214116 0.55% 123 269928 0.69% 124 266916 0.68% 125 218485 0.56% 126 237121 0.60% 127 250270 0.64% 128 249464 0.64% 129 242287 0.62% 130 244365 0.62% 131 268338 0.68% 132 390014 0.99% 133 328758 0.84% 134 276701 0.71% 135 297010 0.76% 136 282482 0.72% 137 298533 0.76% 138 326169 0.83% 139 301909 0.77% 140 314053 0.80% 141 291538 0.74% 142 319837 0.82% 143 322992 0.82% 144 293548 0.75% 145 355715 0.91% 146 307820 0.78% 147 431949 1.10% 148 780395 1.99% 149 0 0.00% 150 10 0.00% 151 24830924 63.29% criterion=sequence-density sequence-density=1.55 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=31 prefix-density=1.55 prefix-fanout=2.0 sequence=ACGTGAGCTGGGTTCAGAACGTCGTGAGAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=153.73 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=18.1 sequence=TTGATGCTGAGAATTCTCCAAGCGTGGTTGCCATCAACGTGAGCCCTATTGAATATGGGCATGTGCTGTTAATCCCACGTGTCCTGGATTGCTTGCCTCAGAGGATTGATCGTGATAGCTTCTTGCTTGCACTTCACATGGCAGCTGAAGCTGGGGATCCATACTTCCGACTGGGTTACAATAGCTTGGGTGCTTTTGCAACCATTAACCATCTTCACTTCCAGGCTTACTACTTGACTGTGCCTTTTCCGATTGAGAAGG Started job on | Feb 12 12:07:59 Started mapping on | Feb 12 12:07:59 Finished on | Feb 12 12:10:10 Mapping speed, Million of reads per hour | 1274.28 Number of input reads | 46369735 Average input read length | 140 UNIQUE READS: Uniquely mapped reads number | 35528761 Uniquely mapped reads % | 76.62% Average mapped length | 137.76 Number of splices: Total | 15513743 Number of splices: Annotated (sjdb) | 15183473 Number of splices: GT/AG | 15253582 Number of splices: GC/AG | 204273 Number of splices: AT/AC | 10090 Number of splices: Non-canonical | 45798 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.03 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1113474 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 6523165 % of reads mapped to too many loci | 14.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.69% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 9727500 9727500 9727500 N_multimapping 1113474 1113474 1113474 N_noFeature 2230171 2744480 34324509 N_ambiguous 823932 134134 879 UnstrandedReadsAssigned:32474658 PositiveStrandReadsAssigned:32650147 NegativeStrandReadsAssigned:1203373 Dataset is classified positive stranded MeadianReadLen=151 20thPercentileLength=129 echo kmer=125 SRR11462738 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR11462738-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 46,369,735 reads, 35,289,308 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR11462738.ke.tsv 34699 SRR11462738.se.tsv 87100 total ==> SRR11462738.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1548 24.6087 Potri.005G024800.1.v4.1 1035 936 674 21.9673 Potri.004G059700.1.v4.1 961 862 11 0.389294 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 3963.68 42.5168 Potri.016G087400.1.v4.1 270 171 1918 342.172 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 328 5.97737 Potri.012G127500.1.v4.1 977 878 39 1.35507 ==> SRR11462738.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 88 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 22 SRR11462738 completed mapping pipeline successfully