Starting /dee2/code/volunteer_pipeline.sh SRR11611367 current disk space = 3057379926016 free memory = 1348998200 SRR11611367 SRAfilesize 2126d944dcf1e8178a64ec6b1fe7f0ee SRR11611367.sra SRR11611367.sra file validated SRR11611367 is paired end SRR11611367 is conventional basespace SRR11611367 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611367_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.5775 32.0 32.0 32.0 2.0 32.0 2 31.7125 32.0 32.0 32.0 32.0 32.0 3 34.895 37.0 32.0 37.0 32.0 37.0 4 36.25125 37.0 37.0 37.0 32.0 37.0 5 36.315 37.0 37.0 37.0 37.0 37.0 6 39.13025 41.0 41.0 41.0 37.0 41.0 7 39.65525 41.0 41.0 41.0 37.0 41.0 8 40.00425 41.0 41.0 41.0 37.0 41.0 9 39.9805 41.0 41.0 41.0 37.0 41.0 10-14 39.8882 41.0 41.0 41.0 37.0 41.0 15-19 40.0445 41.0 41.0 41.0 37.0 41.0 20-24 40.0507 41.0 41.0 41.0 37.0 41.0 25-29 38.993199999999995 41.0 40.2 41.0 33.0 41.0 30-34 39.5612 41.0 41.0 41.0 37.0 41.0 35-39 39.502250000000004 41.0 41.0 41.0 37.0 41.0 40-44 39.06155 41.0 41.0 41.0 36.0 41.0 45-49 39.2512 41.0 41.0 41.0 35.0 41.0 50-54 39.34205 41.0 41.0 41.0 36.0 41.0 55-59 39.259949999999996 41.0 41.0 41.0 37.0 41.0 60-64 39.414 41.0 41.0 41.0 37.0 41.0 65-69 39.4039 41.0 41.0 41.0 36.0 41.0 70-74 39.2844 41.0 41.0 41.0 36.0 41.0 75-79 39.03090000000001 41.0 40.2 41.0 36.0 41.0 80-84 39.667750000000005 41.0 41.0 41.0 37.0 41.0 85-89 38.8725 41.0 40.2 41.0 34.0 41.0 90-94 39.42975 41.0 41.0 41.0 37.0 41.0 95-99 38.95785 41.0 41.0 41.0 33.0 41.0 100-104 38.914 41.0 41.0 41.0 34.0 41.0 105-109 38.897149999999996 41.0 40.2 41.0 33.0 41.0 110-114 38.709649999999996 41.0 40.2 41.0 33.0 41.0 115-119 39.216499999999996 41.0 41.0 41.0 36.0 41.0 120-124 38.21145 41.0 38.6 41.0 31.0 41.0 125-129 39.0926 41.0 41.0 41.0 36.0 41.0 130-134 38.67035 41.0 40.2 41.0 33.0 41.0 135-139 38.6232 41.0 41.0 41.0 32.0 41.0 140-144 38.23855 41.0 40.2 41.0 31.0 41.0 145-149 38.70309999999999 41.0 41.0 41.0 33.0 41.0 150 38.25225 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 1.0 21 3.0 22 3.0 23 2.0 24 5.0 25 9.0 26 8.0 27 17.0 28 27.0 29 31.0 30 43.0 31 49.0 32 67.0 33 86.0 34 89.0 35 98.0 36 140.0 37 162.0 38 262.0 39 441.0 40 2455.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.57531010041347 14.825753101004135 17.01122268163024 35.58771411695216 2 22.325 18.75 35.325 23.599999999999998 3 24.05 22.0 29.775000000000002 24.175 4 25.35 27.900000000000002 21.475 25.275 5 23.974999999999998 33.125 23.3 19.6 6 20.25 35.55 23.849999999999998 20.349999999999998 7 18.5 19.925 41.175 20.4 8 19.925 23.575 28.675 27.825 9 20.075000000000003 25.650000000000002 30.75 23.525 10-14 21.66 29.235 27.375 21.73 15-19 22.24 27.650000000000002 27.465 22.645 20-24 22.32 27.82 27.115000000000002 22.745 25-29 22.215 28.24 26.834999999999997 22.71 30-34 22.264999999999997 27.755000000000003 27.755000000000003 22.225 35-39 22.225 27.88 27.284999999999997 22.61 40-44 22.040000000000003 27.305 27.955000000000002 22.7 45-49 22.57 27.689999999999998 27.16 22.58 50-54 22.75 27.500000000000004 27.38 22.37 55-59 21.795 28.52 27.095000000000002 22.59 60-64 22.02 28.505000000000003 27.38 22.095000000000002 65-69 22.905 27.705000000000002 26.87 22.52 70-74 22.32 27.089999999999996 28.005000000000003 22.585 75-79 23.215 27.155 27.3 22.33 80-84 22.470000000000002 27.700000000000003 27.16 22.67 85-89 22.445 27.49 27.675 22.39 90-94 23.0 28.044999999999998 27.400000000000002 21.555 95-99 22.91 27.589999999999996 27.02 22.48 100-104 22.46 27.865000000000002 27.134999999999998 22.54 105-109 22.39 27.065 27.955000000000002 22.59 110-114 23.14 27.605 27.145000000000003 22.11 115-119 22.405 27.67 27.105 22.82 120-124 22.66 27.515 27.425 22.400000000000002 125-129 23.345 27.060000000000002 27.944999999999997 21.65 130-134 22.61 27.57 26.974999999999998 22.845 135-139 22.36 27.544999999999998 27.445000000000004 22.650000000000002 140-144 23.45 27.24 26.355 22.955000000000002 145-149 22.564999999999998 26.884999999999998 27.96 22.59 150 23.05 27.075 27.425 22.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.5 19 1.5 20 0.0 21 1.0 22 1.0 23 0.0 24 1.5 25 3.5 26 5.0 27 6.5 28 7.5 29 8.5 30 11.0 31 16.5 32 27.0 33 35.5 34 43.0 35 57.5 36 71.5 37 92.5 38 127.0 39 148.0 40 167.0 41 189.5 42 219.5 43 258.5 44 280.0 45 278.5 46 264.5 47 255.0 48 242.5 49 213.0 50 170.5 51 138.0 52 138.0 53 120.0 54 85.5 55 62.5 56 44.0 57 39.0 58 36.0 59 27.5 60 19.0 61 19.5 62 14.5 63 9.5 64 8.0 65 5.0 66 3.0 67 6.5 68 7.5 69 3.5 70 2.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 15.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.2 #Duplication Level Percentage of deduplicated Percentage of total 1 88.9854260089686 79.375 2 10.00560538116592 17.849999999999998 3 0.9248878923766817 2.475 4 0.08408071748878924 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.9874999999999999 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.25 0.0 0.0 0.0 0.0 124-125 1.4625 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.85 0.0 0.0 0.0 0.0 130-131 1.975 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.2 0.0 0.0 0.0 0.0 136-137 2.3875 0.0 0.0 0.0 0.0 138 2.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGATG 10 0.0069954093 143.85 2 AGAGGCT 10 0.0069954093 143.85 9 GAGAGGC 10 0.0069954093 143.85 8 GAGATGA 10 0.0069954093 143.85 3 TGAGAGG 10 0.0069954093 143.85 7 >>END_MODULE SRR11611367 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611367_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.75375 32.0 2.0 32.0 2.0 32.0 2 31.185 32.0 32.0 32.0 32.0 32.0 3 31.27875 32.0 32.0 37.0 27.0 37.0 4 32.595 37.0 32.0 37.0 27.0 37.0 5 35.305 37.0 37.0 37.0 32.0 37.0 6 36.858 41.0 37.0 41.0 27.0 41.0 7 37.156 41.0 37.0 41.0 27.0 41.0 8 37.9765 41.0 37.0 41.0 32.0 41.0 9 39.0295 41.0 41.0 41.0 37.0 41.0 10-14 39.1212 41.0 41.0 41.0 35.0 41.0 15-19 38.818599999999996 41.0 41.0 41.0 34.0 41.0 20-24 37.181799999999996 41.0 36.6 41.0 27.0 41.0 25-29 38.453 41.0 40.2 41.0 32.0 41.0 30-34 38.92274999999999 41.0 40.2 41.0 35.0 41.0 35-39 37.990899999999996 41.0 39.2 41.0 28.0 41.0 40-44 38.80185 41.0 41.0 41.0 35.0 41.0 45-49 38.614 41.0 41.0 41.0 33.0 41.0 50-54 37.60325 41.0 37.8 41.0 28.0 41.0 55-59 37.7296 41.0 38.6 41.0 29.0 41.0 60-64 38.34740000000001 41.0 38.6 41.0 32.0 41.0 65-69 37.9845 41.0 39.4 41.0 30.0 41.0 70-74 37.764199999999995 41.0 37.8 41.0 29.0 41.0 75-79 36.888600000000004 40.2 36.0 41.0 27.0 41.0 80-84 37.3195 41.0 36.8 41.0 26.0 41.0 85-89 36.681850000000004 41.0 36.0 41.0 24.0 41.0 90-94 37.22045 41.0 37.0 41.0 26.0 41.0 95-99 35.95835 40.2 34.0 41.0 21.0 41.0 100-104 36.3088 41.0 35.0 41.0 23.0 41.0 105-109 34.941849999999995 38.4 30.0 41.0 23.0 41.0 110-114 36.05585 40.2 35.0 41.0 23.0 41.0 115-119 35.460300000000004 41.0 34.0 41.0 16.0 41.0 120-124 36.73010000000001 41.0 36.0 41.0 25.0 41.0 125-129 36.22805000000001 41.0 37.0 41.0 22.0 41.0 130-134 35.324299999999994 38.6 34.0 41.0 19.0 41.0 135-139 34.88955 40.2 32.0 41.0 18.0 41.0 140-144 36.62089999999999 41.0 36.0 41.0 23.0 41.0 145-149 36.025800000000004 41.0 36.0 41.0 21.0 41.0 150 36.33775 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 2.0 17 1.0 18 7.0 19 6.0 20 12.0 21 13.0 22 23.0 23 22.0 24 43.0 25 44.0 26 53.0 27 67.0 28 69.0 29 84.0 30 86.0 31 120.0 32 106.0 33 97.0 34 130.0 35 165.0 36 197.0 37 236.0 38 393.0 39 664.0 40 1358.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.24074074074074 14.49074074074074 17.77777777777778 34.49074074074074 2 21.475 21.099999999999998 34.0 23.425 3 23.5 23.825 27.275 25.4 4 25.624999999999996 27.150000000000002 21.725 25.5 5 26.375 31.5 22.55 19.575 6 20.7 36.25 23.35 19.7 7 18.3 19.425 40.550000000000004 21.725 8 19.425 23.75 30.7 26.125 9 20.45 24.825 29.849999999999998 24.875 10-14 20.885 29.580000000000002 27.139999999999997 22.395 15-19 21.529999999999998 27.26 28.055000000000003 23.155 20-24 21.78 28.255000000000003 27.544999999999998 22.42 25-29 21.895 28.060000000000002 26.93 23.115 30-34 21.759999999999998 28.005000000000003 28.12 22.115000000000002 35-39 21.805 28.005000000000003 26.865 23.325000000000003 40-44 21.68 28.155 27.43 22.735 45-49 21.89 28.04 27.26 22.81 50-54 21.625 28.470000000000002 27.01 22.895 55-59 22.994999999999997 27.794999999999998 26.46 22.75 60-64 21.625 27.560000000000002 28.294999999999998 22.52 65-69 21.78 27.705000000000002 27.525 22.99 70-74 22.115000000000002 27.68 27.279999999999998 22.925 75-79 20.990000000000002 27.96 27.18 23.87 80-84 22.88 27.21 27.279999999999998 22.63 85-89 22.615 27.794999999999998 27.48 22.11 90-94 22.165000000000003 27.765 27.275 22.795 95-99 23.085 28.115000000000002 26.840000000000003 21.959999999999997 100-104 22.35 27.855 27.12 22.675 105-109 22.900000000000002 27.865000000000002 27.169999999999998 22.065 110-114 22.66 27.834999999999997 26.735 22.770000000000003 115-119 22.384999999999998 27.744999999999997 27.279999999999998 22.59 120-124 22.53 27.525 27.650000000000002 22.295 125-129 22.259999999999998 28.26 26.700000000000003 22.78 130-134 22.71 27.279999999999998 27.189999999999998 22.82 135-139 23.125 28.165000000000003 26.290000000000003 22.42 140-144 23.375 27.005000000000003 27.060000000000002 22.56 145-149 23.09 28.185 26.1 22.625 150 22.125 27.650000000000002 27.525 22.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.5 24 3.5 25 3.0 26 5.0 27 11.5 28 14.5 29 9.5 30 12.5 31 21.5 32 34.0 33 50.0 34 62.5 35 64.5 36 72.5 37 99.5 38 124.5 39 148.0 40 168.5 41 185.5 42 217.5 43 253.0 44 268.0 45 265.5 46 278.5 47 269.0 48 229.5 49 203.0 50 168.5 51 137.5 52 128.0 53 110.5 54 81.0 55 59.5 56 46.0 57 35.5 58 28.0 59 21.5 60 19.0 61 19.5 62 17.5 63 12.5 64 5.5 65 4.5 66 4.0 67 3.0 68 2.5 69 2.5 70 3.5 71 3.5 72 2.0 73 1.0 74 0.5 75 0.0 76 0.5 77 1.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 46.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.35 #Duplication Level Percentage of deduplicated Percentage of total 1 91.43404488232075 83.525 2 7.744937055281882 14.149999999999999 3 0.7389162561576355 2.025 4 0.08210180623973727 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.2375 0.0 0.0 0.0 0.0 122-123 1.325 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.7125 0.0 0.0 0.0 0.0 128-129 1.875 0.0 0.0 0.0 0.0 130-131 2.025 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.25 0.0 0.0 0.0 0.0 136-137 2.425 0.0 0.0 0.0 0.0 138 2.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTAGTA 10 0.0070392117 143.55 8 CACCTGG 10 0.0070392117 143.55 7 AGCAAGA 10 0.0070392117 143.55 2 CCTGGTT 10 0.0070392117 143.55 9 >>END_MODULE Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643580 spots for SRR11611367.sra Written 643580 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra Read 643577 spots for SRR11611367.sra Written 643577 spots for SRR11611367.sra SRR ids: ['SRR11611367.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yx3a69zv SRR11611367.sra spots: 12871543 blocks: [[1, 643577], [643578, 1287154], [1287155, 1930731], [1930732, 2574308], [2574309, 3217885], [3217886, 3861462], [3861463, 4505039], [4505040, 5148616], [5148617, 5792193], [5792194, 6435770], [6435771, 7079347], [7079348, 7722924], [7722925, 8366501], [8366502, 9010078], [9010079, 9653655], [9653656, 10297232], [10297233, 10940809], [10940810, 11584386], [11584387, 12227963], [12227964, 12871543]] SRR11611367 file size 4327473 SRR11611367 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11611367 SRR11611367_1.fastq SRR11611367_2.fastq Input file: SRR11611367_1.fastq Paired file: SRR11611367_2.fastq trimmed: SRR11611367-trimmed-pair1.fastq, SRR11611367-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:55:12 2025 >> started Mon Feb 10 23:55:26 2025 >> done (13.824s) 12871543 read pairs processed; of these: 849 ( 0.01%) short read pairs filtered out after trimming by size control 4885 ( 0.04%) empty read pairs filtered out after trimming by size control 12865809 (99.96%) read pairs available; of these: 514019 ( 4.00%) trimmed read pairs available after processing 12351790 (96.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 85 0.00% 19 68 0.00% 20 89 0.00% 21 82 0.00% 22 90 0.00% 23 100 0.00% 24 107 0.00% 25 111 0.00% 26 135 0.00% 27 146 0.00% 28 124 0.00% 29 141 0.00% 30 136 0.00% 31 156 0.00% 32 155 0.00% 33 168 0.00% 34 153 0.00% 35 152 0.00% 36 158 0.00% 37 188 0.00% 38 224 0.00% 39 197 0.00% 40 197 0.00% 41 213 0.00% 42 218 0.00% 43 256 0.00% 44 237 0.00% 45 224 0.00% 46 243 0.00% 47 272 0.00% 48 198 0.00% 49 278 0.00% 50 276 0.00% 51 269 0.00% 52 254 0.00% 53 301 0.00% 54 254 0.00% 55 272 0.00% 56 250 0.00% 57 243 0.00% 58 274 0.00% 59 285 0.00% 60 331 0.00% 61 308 0.00% 62 358 0.00% 63 340 0.00% 64 345 0.00% 65 346 0.00% 66 333 0.00% 67 353 0.00% 68 342 0.00% 69 407 0.00% 70 458 0.00% 71 465 0.00% 72 532 0.00% 73 546 0.00% 74 568 0.00% 75 526 0.00% 76 531 0.00% 77 513 0.00% 78 548 0.00% 79 566 0.00% 80 677 0.01% 81 785 0.01% 82 806 0.01% 83 962 0.01% 84 1041 0.01% 85 1015 0.01% 86 951 0.01% 87 981 0.01% 88 1003 0.01% 89 1015 0.01% 90 1129 0.01% 91 1420 0.01% 92 1674 0.01% 93 1906 0.01% 94 2113 0.02% 95 2161 0.02% 96 2274 0.02% 97 2093 0.02% 98 2082 0.02% 99 2150 0.02% 100 2357 0.02% 101 2732 0.02% 102 3223 0.03% 103 3735 0.03% 104 4105 0.03% 105 4647 0.04% 106 4478 0.03% 107 4203 0.03% 108 3979 0.03% 109 4145 0.03% 110 4341 0.03% 111 4714 0.04% 112 5149 0.04% 113 6185 0.05% 114 6955 0.05% 115 7390 0.06% 116 7509 0.06% 117 7528 0.06% 118 6963 0.05% 119 6686 0.05% 120 6772 0.05% 121 7256 0.06% 122 7951 0.06% 123 8765 0.07% 124 10031 0.08% 125 10684 0.08% 126 10828 0.08% 127 10823 0.08% 128 10162 0.08% 129 9999 0.08% 130 9753 0.08% 131 9741 0.08% 132 10718 0.08% 133 11328 0.09% 134 12547 0.10% 135 13424 0.10% 136 13960 0.11% 137 14178 0.11% 138 13508 0.10% 139 13123 0.10% 140 12463 0.10% 141 12282 0.10% 142 12756 0.10% 143 13666 0.11% 144 14862 0.12% 145 16533 0.13% 146 17134 0.13% 147 17057 0.13% 148 17172 0.13% 149 18586 0.14% 150 12351790 96.00% 12865809 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.44 fanout-score-rank=24 prefix-density=0.16 prefix-fanout=2.7 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=44.96 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=2.2 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGG criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=25 prefix-density=0.15 prefix-fanout=2.7 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=51.73 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=2.1 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCT SRR11611367 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:56:15 Started mapping on | Feb 10 23:56:15 Finished on | Feb 10 23:57:37 Mapping speed, Million of reads per hour | 564.84 Number of input reads | 12865809 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11726931 Uniquely mapped reads % | 91.15% Average mapped length | 296.60 Number of splices: Total | 10303026 Number of splices: Annotated (sjdb) | 10150431 Number of splices: GT/AG | 10153867 Number of splices: GC/AG | 120106 Number of splices: AT/AC | 8227 Number of splices: Non-canonical | 20826 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.75 Insertion rate per base | 0.01% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268778 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 478839 % of reads mapped to too many loci | 3.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 870100 870100 870100 N_multimapping 268778 268778 268778 N_noFeature 360318 6030833 5974388 N_ambiguous 141861 29930 30273 UnstrandedReadsAssigned:11224752 PositiveStrandReadsAssigned:5666168 NegativeStrandReadsAssigned:5722270 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11611367 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11611367-trimmed-pair1.fastq SRR11611367-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,865,809 reads, 12,004,454 reads pseudoaligned [quant] estimated average fragment length: 265.554 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR11611367.ke.tsv 34699 SRR11611367.se.tsv 87100 total ==> SRR11611367.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.45 529 25.2922 Potri.005G024800.1.v4.1 1035 770.446 276 30.0324 Potri.004G059700.1.v4.1 961 696.446 10 1.20375 Potri.007G009000.2.v4.1 1416 1151.45 0 0 Potri.003G141000.2.v4.1 2943 2678.45 382.142 11.961 Potri.016G087400.1.v4.1 270 63.9492 638 836.391 Potri.015G069301.1.v4.1 564 299.636 0 0 Potri.010G195200.1.v4.1 1773 1508.45 29 1.61173 Potri.012G127500.1.v4.1 977 712.446 1068 125.673 ==> SRR11611367.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 884 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 142 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR11611367 completed mapping pipeline successfully