Starting /dee2/code/volunteer_pipeline.sh SRR11611368 current disk space = 3057424486400 free memory = 1062339108 SRR11611368 SRAfilesize 2a965785d581e2709b06d5de3216fafa SRR11611368.sra SRR11611368.sra file validated SRR11611368 is paired end SRR11611368 is conventional basespace SRR11611368 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611368_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.07 32.0 32.0 32.0 2.0 32.0 2 31.655 32.0 32.0 32.0 32.0 32.0 3 35.03125 37.0 32.0 37.0 32.0 37.0 4 36.28 37.0 37.0 37.0 32.0 37.0 5 36.40125 37.0 37.0 37.0 37.0 37.0 6 39.2085 41.0 41.0 41.0 37.0 41.0 7 39.88125 41.0 41.0 41.0 37.0 41.0 8 40.0295 41.0 41.0 41.0 37.0 41.0 9 40.174 41.0 41.0 41.0 37.0 41.0 10-14 39.93775 41.0 41.0 41.0 37.0 41.0 15-19 40.04715 41.0 41.0 41.0 37.0 41.0 20-24 40.0212 41.0 41.0 41.0 37.0 41.0 25-29 38.9736 41.0 40.2 41.0 33.0 41.0 30-34 39.606700000000004 41.0 41.0 41.0 37.0 41.0 35-39 39.66799999999999 41.0 41.0 41.0 37.0 41.0 40-44 39.09905 41.0 41.0 41.0 36.0 41.0 45-49 39.31445 41.0 41.0 41.0 35.0 41.0 50-54 39.449749999999995 41.0 41.0 41.0 36.0 41.0 55-59 39.2898 41.0 41.0 41.0 37.0 41.0 60-64 39.48845 41.0 41.0 41.0 37.0 41.0 65-69 39.49575 41.0 41.0 41.0 37.0 41.0 70-74 39.35695 41.0 41.0 41.0 36.0 41.0 75-79 39.14895 41.0 40.2 41.0 36.0 41.0 80-84 39.6763 41.0 41.0 41.0 37.0 41.0 85-89 38.917500000000004 41.0 40.2 41.0 34.0 41.0 90-94 39.530899999999995 41.0 41.0 41.0 37.0 41.0 95-99 39.08735 41.0 41.0 41.0 35.0 41.0 100-104 39.028499999999994 41.0 41.0 41.0 34.0 41.0 105-109 38.93155 41.0 40.2 41.0 33.0 41.0 110-114 38.733000000000004 41.0 40.2 41.0 33.0 41.0 115-119 39.17715 41.0 41.0 41.0 35.0 41.0 120-124 38.312 41.0 38.6 41.0 32.0 41.0 125-129 39.1934 41.0 41.0 41.0 36.0 41.0 130-134 38.62910000000001 41.0 40.2 41.0 33.0 41.0 135-139 38.66465 41.0 41.0 41.0 33.0 41.0 140-144 38.23695 41.0 40.2 41.0 31.0 41.0 145-149 38.708 41.0 41.0 41.0 32.0 41.0 150 38.26025 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 1.0 22 1.0 23 1.0 24 3.0 25 5.0 26 14.0 27 16.0 28 29.0 29 24.0 30 34.0 31 50.0 32 58.0 33 66.0 34 91.0 35 123.0 36 154.0 37 176.0 38 263.0 39 466.0 40 2422.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.81157313172434 14.975283512649026 17.301541145681885 35.91160220994475 2 20.8 20.4 34.325 24.474999999999998 3 23.425 21.75 30.025000000000002 24.8 4 24.15 26.775 22.7 26.375 5 24.55 31.525 24.175 19.75 6 20.45 34.225 23.625 21.7 7 17.625 18.475 43.75 20.150000000000002 8 17.974999999999998 22.975 31.8 27.250000000000004 9 19.950000000000003 23.825 30.675 25.55 10-14 21.595 29.189999999999998 27.224999999999998 21.990000000000002 15-19 21.435000000000002 27.37 28.52 22.675 20-24 22.395 28.18 27.27 22.155 25-29 21.98 27.665 27.894999999999996 22.46 30-34 21.805 28.075 27.525 22.595000000000002 35-39 21.595 28.794999999999998 26.97 22.64 40-44 21.884999999999998 28.08 27.755000000000003 22.28 45-49 21.925 27.755000000000003 27.384999999999998 22.935 50-54 21.84 28.02 27.36 22.78 55-59 22.395 28.125 26.76 22.720000000000002 60-64 21.785 27.37 27.665 23.18 65-69 22.64 28.32 26.950000000000003 22.09 70-74 22.189999999999998 28.425 26.795 22.59 75-79 22.220000000000002 27.685 27.229999999999997 22.865 80-84 22.259999999999998 27.805000000000003 27.505000000000003 22.43 85-89 22.105 27.529999999999998 27.495000000000005 22.869999999999997 90-94 22.259999999999998 27.305 27.284999999999997 23.150000000000002 95-99 22.025 28.005000000000003 27.54 22.43 100-104 21.560000000000002 28.48 27.24 22.720000000000002 105-109 22.125 27.11 27.83 22.935 110-114 22.31 28.435 26.58 22.675 115-119 21.945 27.810000000000002 27.589999999999996 22.655 120-124 22.45 26.584999999999997 27.96 23.005 125-129 22.915 27.084999999999997 27.474999999999998 22.525000000000002 130-134 22.55 27.375 27.500000000000004 22.575 135-139 22.64 27.800000000000004 27.32 22.24 140-144 23.06 27.450000000000003 27.200000000000003 22.29 145-149 23.205000000000002 26.935 27.034999999999997 22.825 150 21.825 27.575 28.825 21.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 4.5 27 6.5 28 8.0 29 13.5 30 16.5 31 23.5 32 32.5 33 36.0 34 37.0 35 49.0 36 81.0 37 105.5 38 126.0 39 157.0 40 178.5 41 199.5 42 247.5 43 260.0 44 243.0 45 254.0 46 267.0 47 251.5 48 253.0 49 247.0 50 186.0 51 130.5 52 106.5 53 96.0 54 79.5 55 63.0 56 45.5 57 38.5 58 32.5 59 25.5 60 20.0 61 12.5 62 11.5 63 10.0 64 8.5 65 7.5 66 4.5 67 4.5 68 5.5 69 3.5 70 1.0 71 1.0 72 1.5 73 1.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.025000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.25 #Duplication Level Percentage of deduplicated Percentage of total 1 89.07563025210085 79.5 2 9.859943977591037 17.599999999999998 3 1.0084033613445378 2.7 4 0.05602240896358543 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.6499999999999999 0.0 0.0 0.0 0.0 116-117 0.7875 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.1125 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.4 0.0 0.0 0.0 0.0 130-131 1.65 0.0 0.0 0.0 0.0 132-133 1.775 0.0 0.0 0.0 0.0 134-135 1.9249999999999998 0.0 0.0 0.0 0.0 136-137 2.225 0.0 0.0 0.0 0.0 138 2.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11611368 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611368_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.7175 32.0 2.0 32.0 2.0 32.0 2 31.145 32.0 32.0 32.0 32.0 32.0 3 31.49 32.0 32.0 37.0 27.0 37.0 4 32.7175 37.0 32.0 37.0 27.0 37.0 5 35.37125 37.0 37.0 37.0 32.0 37.0 6 36.954 41.0 37.0 41.0 27.0 41.0 7 37.335 41.0 37.0 41.0 27.0 41.0 8 37.94325 41.0 37.0 41.0 32.0 41.0 9 39.161 41.0 41.0 41.0 37.0 41.0 10-14 39.205400000000004 41.0 41.0 41.0 36.0 41.0 15-19 38.913650000000004 41.0 41.0 41.0 35.0 41.0 20-24 37.0721 41.0 36.6 41.0 25.0 41.0 25-29 38.4611 41.0 40.2 41.0 32.0 41.0 30-34 38.986900000000006 41.0 41.0 41.0 36.0 41.0 35-39 38.09134999999999 41.0 40.2 41.0 32.0 41.0 40-44 38.8529 41.0 41.0 41.0 35.0 41.0 45-49 38.6586 41.0 41.0 41.0 33.0 41.0 50-54 37.70125 41.0 37.8 41.0 28.0 41.0 55-59 37.67715 41.0 38.6 41.0 27.0 41.0 60-64 38.292500000000004 41.0 38.6 41.0 31.0 41.0 65-69 38.10445 41.0 39.4 41.0 30.0 41.0 70-74 37.867399999999996 41.0 38.6 41.0 30.0 41.0 75-79 37.04495 41.0 36.0 41.0 27.0 41.0 80-84 37.52345 41.0 36.8 41.0 29.0 41.0 85-89 36.86365 41.0 36.0 41.0 25.0 41.0 90-94 37.21935 41.0 37.0 41.0 27.0 41.0 95-99 36.07965 40.2 34.0 41.0 20.0 41.0 100-104 36.52005 41.0 36.0 41.0 24.0 41.0 105-109 35.25425 39.4 31.0 41.0 23.0 41.0 110-114 36.206900000000005 40.2 35.0 41.0 22.0 41.0 115-119 35.50035 41.0 34.0 41.0 16.0 41.0 120-124 36.859 41.0 36.0 41.0 25.0 41.0 125-129 36.3324 41.0 37.0 41.0 22.0 41.0 130-134 35.40785 38.6 34.0 41.0 19.0 41.0 135-139 35.03365 40.2 32.0 41.0 18.0 41.0 140-144 36.75965 41.0 37.0 41.0 23.0 41.0 145-149 36.145799999999994 41.0 36.0 41.0 22.0 41.0 150 36.5855 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 1.0 18 2.0 19 9.0 20 12.0 21 18.0 22 11.0 23 32.0 24 32.0 25 40.0 26 50.0 27 63.0 28 65.0 29 92.0 30 94.0 31 91.0 32 104.0 33 107.0 34 158.0 35 160.0 36 200.0 37 246.0 38 363.0 39 621.0 40 1427.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.177215189873415 15.364469663902225 16.193801833260586 34.26451331296377 2 20.875 23.5 33.525 22.1 3 24.375 23.325000000000003 28.675 23.625 4 25.0 29.099999999999998 20.349999999999998 25.55 5 25.674999999999997 31.374999999999996 22.975 19.975 6 18.725 36.5 23.875 20.9 7 18.5 19.8 41.425 20.275000000000002 8 18.375 22.175 31.525 27.925 9 21.125 23.325000000000003 30.325000000000003 25.224999999999998 10-14 21.675 28.845 27.05 22.43 15-19 21.61 27.950000000000003 27.93 22.509999999999998 20-24 22.575 28.37 27.0 22.055 25-29 21.709999999999997 28.285 27.355 22.650000000000002 30-34 21.805 28.665000000000003 27.42 22.11 35-39 22.0 27.505000000000003 27.025 23.47 40-44 21.92 27.33 28.035 22.715 45-49 21.675 27.965 27.73 22.63 50-54 21.81 27.865000000000002 27.794999999999998 22.53 55-59 22.415 28.065 27.245 22.275 60-64 21.765 28.32 27.405 22.509999999999998 65-69 23.16 28.02 26.96 21.86 70-74 21.785 28.18 27.400000000000002 22.634999999999998 75-79 22.62 27.24 27.595 22.545 80-84 21.975 27.68 27.735 22.61 85-89 22.765 28.310000000000002 26.419999999999998 22.505 90-94 22.56 27.72 27.13 22.59 95-99 23.200000000000003 26.995 27.98 21.825 100-104 22.59 28.37 26.645000000000003 22.395 105-109 22.82 28.02 27.07 22.09 110-114 23.135 27.965 26.57 22.33 115-119 22.384999999999998 27.544999999999998 27.52 22.55 120-124 23.165 28.075 26.97 21.790000000000003 125-129 23.325000000000003 27.985 27.3 21.39 130-134 23.075000000000003 27.500000000000004 27.38 22.045 135-139 23.555 27.865000000000002 26.665 21.915000000000003 140-144 22.97 27.16 27.639999999999997 22.23 145-149 23.77 27.950000000000003 26.215 22.065 150 22.175 28.9 27.075 21.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 1.5 26 1.0 27 3.5 28 9.5 29 13.5 30 13.5 31 17.0 32 25.0 33 31.0 34 48.5 35 63.5 36 80.0 37 115.0 38 135.0 39 158.5 40 180.0 41 205.0 42 232.0 43 253.0 44 272.0 45 271.5 46 271.0 47 269.5 48 239.5 49 209.0 50 185.0 51 142.5 52 117.5 53 100.0 54 73.5 55 46.5 56 40.0 57 37.5 58 23.0 59 19.0 60 21.5 61 18.0 62 15.5 63 14.0 64 7.0 65 3.0 66 2.0 67 4.0 68 4.0 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 42.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.05 #Duplication Level Percentage of deduplicated Percentage of total 1 90.85667215815486 82.72500000000001 2 8.511806699615596 15.5 3 0.5766062602965404 1.575 4 0.054914881933003847 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 0.95 0.0 0.0 0.0 0.0 120-121 1.05 0.0 0.0 0.0 0.0 122-123 1.125 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.45 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.8125 0.0 0.0 0.0 0.0 132-133 1.9375 0.0 0.0 0.0 0.0 134-135 2.1 0.0 0.0 0.0 0.0 136-137 2.4 0.0 0.0 0.0 0.0 138 2.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552117 spots for SRR11611368.sra Written 552117 spots for SRR11611368.sra Read 552129 spots for SRR11611368.sra Written 552129 spots for SRR11611368.sra SRR ids: ['SRR11611368.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v7pn2hkb SRR11611368.sra spots: 11042352 blocks: [[1, 552117], [552118, 1104234], [1104235, 1656351], [1656352, 2208468], [2208469, 2760585], [2760586, 3312702], [3312703, 3864819], [3864820, 4416936], [4416937, 4969053], [4969054, 5521170], [5521171, 6073287], [6073288, 6625404], [6625405, 7177521], [7177522, 7729638], [7729639, 8281755], [8281756, 8833872], [8833873, 9385989], [9385990, 9938106], [9938107, 10490223], [10490224, 11042352]] SRR11611368 file size 3709406 SRR11611368 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11611368 SRR11611368_1.fastq SRR11611368_2.fastq Input file: SRR11611368_1.fastq Paired file: SRR11611368_2.fastq trimmed: SRR11611368-trimmed-pair1.fastq, SRR11611368-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:10:47 2025 >> started Tue Feb 11 00:10:58 2025 >> done (11.690s) 11042352 read pairs processed; of these: 800 ( 0.01%) short read pairs filtered out after trimming by size control 3953 ( 0.04%) empty read pairs filtered out after trimming by size control 11037599 (99.96%) read pairs available; of these: 470005 ( 4.26%) trimmed read pairs available after processing 10567594 (95.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 75 0.00% 19 63 0.00% 20 73 0.00% 21 79 0.00% 22 74 0.00% 23 82 0.00% 24 94 0.00% 25 100 0.00% 26 102 0.00% 27 108 0.00% 28 103 0.00% 29 123 0.00% 30 136 0.00% 31 138 0.00% 32 143 0.00% 33 134 0.00% 34 126 0.00% 35 153 0.00% 36 155 0.00% 37 143 0.00% 38 153 0.00% 39 207 0.00% 40 144 0.00% 41 173 0.00% 42 159 0.00% 43 183 0.00% 44 194 0.00% 45 192 0.00% 46 169 0.00% 47 204 0.00% 48 191 0.00% 49 202 0.00% 50 204 0.00% 51 235 0.00% 52 249 0.00% 53 255 0.00% 54 278 0.00% 55 270 0.00% 56 233 0.00% 57 242 0.00% 58 275 0.00% 59 265 0.00% 60 278 0.00% 61 307 0.00% 62 345 0.00% 63 343 0.00% 64 312 0.00% 65 335 0.00% 66 288 0.00% 67 268 0.00% 68 299 0.00% 69 380 0.00% 70 395 0.00% 71 456 0.00% 72 457 0.00% 73 525 0.00% 74 485 0.00% 75 540 0.00% 76 476 0.00% 77 484 0.00% 78 481 0.00% 79 611 0.01% 80 669 0.01% 81 690 0.01% 82 849 0.01% 83 1099 0.01% 84 1044 0.01% 85 991 0.01% 86 1001 0.01% 87 919 0.01% 88 944 0.01% 89 1065 0.01% 90 1206 0.01% 91 1357 0.01% 92 1667 0.02% 93 2001 0.02% 94 2161 0.02% 95 2380 0.02% 96 2175 0.02% 97 2091 0.02% 98 2087 0.02% 99 2155 0.02% 100 2338 0.02% 101 2566 0.02% 102 3144 0.03% 103 3702 0.03% 104 4244 0.04% 105 4331 0.04% 106 4482 0.04% 107 4022 0.04% 108 3964 0.04% 109 3974 0.04% 110 4141 0.04% 111 4543 0.04% 112 5162 0.05% 113 6097 0.06% 114 6649 0.06% 115 7126 0.06% 116 7052 0.06% 117 6853 0.06% 118 6687 0.06% 119 6381 0.06% 120 6379 0.06% 121 6639 0.06% 122 7548 0.07% 123 8182 0.07% 124 9266 0.08% 125 9894 0.09% 126 10119 0.09% 127 9950 0.09% 128 9464 0.09% 129 8909 0.08% 130 8649 0.08% 131 9042 0.08% 132 9268 0.08% 133 10590 0.10% 134 11160 0.10% 135 11950 0.11% 136 12584 0.11% 137 12541 0.11% 138 12000 0.11% 139 11392 0.10% 140 11061 0.10% 141 11075 0.10% 142 11434 0.10% 143 12226 0.11% 144 13101 0.12% 145 14360 0.13% 146 14618 0.13% 147 14860 0.13% 148 14563 0.13% 149 16226 0.15% 150 10567594 95.74% 11037599 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=31 prefix-density=0.14 prefix-fanout=2.4 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=8 fanout-score=97.23 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=16.7 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAACAAAACGGCCAGATGGGTTGAGGTGAAAGATAGTTTTCTCATCAAGGTACTTCTCCGGGATAACAGGCTTGATGACATACTCCTTTAGATCAGCGGCAATTTCATCATTTGTGACAGTCTCATCATGCTGAGTAGAGATGAGAACAGTGTGGACACGAACAGGGACCATTGCACCATTGTCATTGAAG criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.16 fanout-score-rank=35 prefix-density=0.13 prefix-fanout=2.6 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=109.50 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=17.1 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAACAAAACGGCCAGATGGGTTGAGGTGAAAGATAGTTTTCTCATCAAGGTACTTCTCCGGGATAACAGGCTTGATGACATACTCCTTTAGATCAGCGGCAATTTCATCATTTGTGACAGTCTCATCATGCTGAGTAGAGATGAGAACAGTGTGGACACGAACAGGGACCATTGCACCATTGTCATTGAAG SRR11611368 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:11:55 Started mapping on | Feb 11 00:11:55 Finished on | Feb 11 00:13:07 Mapping speed, Million of reads per hour | 551.88 Number of input reads | 11037599 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10107033 Uniquely mapped reads % | 91.57% Average mapped length | 296.42 Number of splices: Total | 9082464 Number of splices: Annotated (sjdb) | 8952928 Number of splices: GT/AG | 8949968 Number of splices: GC/AG | 107934 Number of splices: AT/AC | 7014 Number of splices: Non-canonical | 17548 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.78 Insertion rate per base | 0.01% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234933 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 351787 % of reads mapped to too many loci | 3.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.53% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 695633 695633 695633 N_multimapping 234933 234933 234933 N_noFeature 283696 5184191 5138708 N_ambiguous 120895 26564 26744 UnstrandedReadsAssigned:9702442 PositiveStrandReadsAssigned:4896278 NegativeStrandReadsAssigned:4941581 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11611368 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11611368-trimmed-pair1.fastq SRR11611368-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,037,599 reads, 10,309,683 reads pseudoaligned [quant] estimated average fragment length: 270.95 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,338 rounds 52401 SRR11611368.ke.tsv 34699 SRR11611368.se.tsv 87100 total ==> SRR11611368.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.05 549.127 30.8935 Potri.005G024800.1.v4.1 1035 765.05 335 43.0628 Potri.004G059700.1.v4.1 961 691.05 11 1.56542 Potri.007G009000.2.v4.1 1416 1146.05 0 0 Potri.003G141000.2.v4.1 2943 2673.05 339 12.4721 Potri.016G087400.1.v4.1 270 66.8228 562 827.102 Potri.015G069301.1.v4.1 564 294.261 0 0 Potri.010G195200.1.v4.1 1773 1503.05 32 2.09375 Potri.012G127500.1.v4.1 977 707.05 1155 160.65 ==> SRR11611368.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 763 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 127 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR11611368 completed mapping pipeline successfully