Starting /dee2/code/volunteer_pipeline.sh SRR11611369 current disk space = 3057234452480 free memory = 1578839856 SRR11611369 SRAfilesize 7deece52dcc4d56fa2b25dcc3a14f918 SRR11611369.sra SRR11611369.sra file validated SRR11611369 is paired end SRR11611369 is conventional basespace SRR11611369 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611369_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.70375 32.0 32.0 32.0 2.0 32.0 2 31.68875 32.0 32.0 32.0 32.0 32.0 3 34.83375 37.0 32.0 37.0 32.0 37.0 4 36.27875 37.0 37.0 37.0 32.0 37.0 5 36.4225 37.0 37.0 37.0 37.0 37.0 6 38.93275 41.0 41.0 41.0 32.0 41.0 7 39.77075 41.0 41.0 41.0 37.0 41.0 8 39.9645 41.0 41.0 41.0 37.0 41.0 9 40.0645 41.0 41.0 41.0 37.0 41.0 10-14 39.8637 41.0 41.0 41.0 37.0 41.0 15-19 40.0264 41.0 41.0 41.0 37.0 41.0 20-24 40.021049999999995 41.0 41.0 41.0 37.0 41.0 25-29 38.8154 41.0 40.2 41.0 33.0 41.0 30-34 39.542550000000006 41.0 41.0 41.0 37.0 41.0 35-39 39.611650000000004 41.0 41.0 41.0 37.0 41.0 40-44 39.0444 41.0 41.0 41.0 35.0 41.0 45-49 39.23745 41.0 41.0 41.0 35.0 41.0 50-54 39.4514 41.0 41.0 41.0 36.0 41.0 55-59 39.27025 41.0 41.0 41.0 37.0 41.0 60-64 39.35725 41.0 41.0 41.0 37.0 41.0 65-69 39.3861 41.0 41.0 41.0 37.0 41.0 70-74 39.322 41.0 41.0 41.0 37.0 41.0 75-79 39.0706 41.0 40.2 41.0 36.0 41.0 80-84 39.78135 41.0 41.0 41.0 37.0 41.0 85-89 38.94605 41.0 40.2 41.0 34.0 41.0 90-94 39.486149999999995 41.0 41.0 41.0 37.0 41.0 95-99 39.100550000000005 41.0 41.0 41.0 35.0 41.0 100-104 39.02375 41.0 41.0 41.0 34.0 41.0 105-109 38.912299999999995 41.0 40.2 41.0 33.0 41.0 110-114 38.78574999999999 41.0 40.2 41.0 33.0 41.0 115-119 39.28765 41.0 41.0 41.0 36.0 41.0 120-124 38.244350000000004 41.0 38.6 41.0 31.0 41.0 125-129 39.19545 41.0 41.0 41.0 35.0 41.0 130-134 38.744499999999995 41.0 40.2 41.0 33.0 41.0 135-139 38.732350000000004 41.0 41.0 41.0 33.0 41.0 140-144 38.2682 41.0 40.2 41.0 31.0 41.0 145-149 38.8337 41.0 41.0 41.0 33.0 41.0 150 38.40725 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 2.0 21 1.0 22 3.0 23 0.0 24 4.0 25 4.0 26 8.0 27 18.0 28 21.0 29 28.0 30 36.0 31 50.0 32 61.0 33 78.0 34 105.0 35 117.0 36 138.0 37 188.0 38 259.0 39 447.0 40 2430.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.56704980842912 16.003536693191865 15.856174476864132 35.57323902151489 2 22.05 20.3 34.449999999999996 23.200000000000003 3 23.275000000000002 23.075000000000003 28.95 24.7 4 24.775 27.075 23.025000000000002 25.124999999999996 5 24.85 32.75 23.150000000000002 19.25 6 21.0 36.55 23.525 18.925 7 17.625 18.8 43.125 20.45 8 19.15 25.224999999999998 28.7 26.924999999999997 9 21.3 25.124999999999996 29.2 24.375 10-14 21.665 29.505 27.08 21.75 15-19 21.990000000000002 27.91 27.189999999999998 22.91 20-24 22.67 28.4 26.965 21.965 25-29 22.165000000000003 27.950000000000003 27.334999999999997 22.55 30-34 22.11 27.115000000000002 27.98 22.795 35-39 20.93 28.084999999999997 28.055000000000003 22.93 40-44 21.36 27.215 27.71 23.715 45-49 22.555 27.529999999999998 27.955000000000002 21.959999999999997 50-54 22.61 27.325 27.185 22.88 55-59 21.935 27.685 27.750000000000004 22.63 60-64 21.884999999999998 27.36 27.865000000000002 22.89 65-69 22.215 27.815 27.12 22.85 70-74 22.07 27.994999999999997 26.985 22.95 75-79 21.990000000000002 27.125 28.310000000000002 22.575 80-84 22.5 27.605 27.089999999999996 22.805 85-89 21.740000000000002 27.125 28.34 22.795 90-94 22.32 27.474999999999998 27.675 22.53 95-99 22.17 27.27 27.655 22.905 100-104 22.295 27.169999999999998 27.21 23.325000000000003 105-109 22.695 27.16 27.365000000000002 22.78 110-114 22.34 27.224999999999998 27.384999999999998 23.05 115-119 22.3 27.73 27.16 22.81 120-124 22.415 28.000000000000004 26.985 22.6 125-129 22.49 27.865000000000002 26.845000000000002 22.8 130-134 22.765 27.46 27.16 22.615 135-139 23.369999999999997 26.979999999999997 27.235 22.415 140-144 22.605 27.474999999999998 26.700000000000003 23.22 145-149 21.965 27.05 28.044999999999998 22.939999999999998 150 23.474999999999998 26.924999999999997 26.724999999999998 22.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 2.5 27 4.0 28 4.5 29 10.0 30 12.0 31 15.5 32 31.0 33 40.5 34 49.0 35 65.5 36 75.0 37 89.0 38 117.5 39 159.0 40 183.0 41 200.5 42 236.5 43 263.5 44 270.0 45 261.5 46 256.0 47 266.0 48 248.5 49 219.5 50 195.5 51 142.0 52 112.0 53 99.5 54 77.5 55 58.5 56 44.0 57 35.5 58 27.5 59 20.0 60 18.5 61 18.0 62 11.5 63 7.0 64 5.0 65 5.0 66 8.5 67 9.5 68 8.0 69 5.0 70 2.0 71 1.0 72 1.0 73 1.5 74 1.5 75 0.5 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 15.174999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.56473214285714 80.25 2 9.486607142857142 17.0 3 0.78125 2.1 4 0.11160714285714285 0.4 5 0.055803571428571425 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 5 0.125 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8375 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.175 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.7999999999999998 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.0999999999999996 0.0 0.0 0.0 0.0 136-137 2.4125 0.0 0.0 0.0 0.0 138 2.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTACT 10 0.0069954093 143.85 6 TTCCAAC 10 0.0069954093 143.85 2 TGATTCC 25 8.9933915E-4 86.31 4 >>END_MODULE SRR11611369 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611369_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.7775 12.0 2.0 32.0 2.0 32.0 2 31.17125 32.0 32.0 32.0 32.0 32.0 3 31.05375 32.0 32.0 37.0 12.0 37.0 4 32.585 37.0 32.0 37.0 27.0 37.0 5 35.22 37.0 37.0 37.0 32.0 37.0 6 36.706 41.0 37.0 41.0 27.0 41.0 7 36.88325 41.0 37.0 41.0 27.0 41.0 8 37.7325 41.0 37.0 41.0 32.0 41.0 9 39.01175 41.0 41.0 41.0 32.0 41.0 10-14 39.00875 41.0 41.0 41.0 35.0 41.0 15-19 38.676649999999995 41.0 40.2 41.0 33.0 41.0 20-24 36.88135 40.2 36.6 41.0 25.0 41.0 25-29 38.30485 41.0 40.2 41.0 31.0 41.0 30-34 38.817 41.0 40.2 41.0 35.0 41.0 35-39 37.836949999999995 41.0 38.4 41.0 28.0 41.0 40-44 38.61115 41.0 40.2 41.0 34.0 41.0 45-49 38.38645 41.0 39.4 41.0 30.0 41.0 50-54 37.497699999999995 41.0 37.8 41.0 28.0 41.0 55-59 37.40155 41.0 38.6 41.0 27.0 41.0 60-64 38.138799999999996 41.0 38.6 41.0 30.0 41.0 65-69 37.78315 41.0 39.4 41.0 30.0 41.0 70-74 37.5725 41.0 37.0 41.0 28.0 41.0 75-79 36.59285 40.2 36.0 41.0 25.0 41.0 80-84 37.240249999999996 41.0 36.8 41.0 26.0 41.0 85-89 36.4993 41.0 35.0 41.0 23.0 41.0 90-94 36.96495 41.0 37.0 41.0 24.0 41.0 95-99 35.7094 40.2 34.0 41.0 20.0 41.0 100-104 36.10535 41.0 35.0 41.0 23.0 41.0 105-109 34.882 38.4 30.0 41.0 22.0 41.0 110-114 35.753499999999995 40.2 33.0 41.0 21.0 41.0 115-119 35.072500000000005 40.2 34.0 41.0 16.0 41.0 120-124 36.4951 41.0 35.0 41.0 25.0 41.0 125-129 36.05145 41.0 35.0 41.0 22.0 41.0 130-134 35.20185 38.6 32.0 41.0 19.0 41.0 135-139 34.64705 39.4 32.0 41.0 18.0 41.0 140-144 36.584649999999996 41.0 36.0 41.0 22.0 41.0 145-149 35.830349999999996 40.2 36.0 41.0 21.0 41.0 150 36.22875 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 2.0 18 3.0 19 6.0 20 21.0 21 25.0 22 16.0 23 34.0 24 49.0 25 45.0 26 51.0 27 49.0 28 75.0 29 92.0 30 99.0 31 104.0 32 120.0 33 136.0 34 130.0 35 154.0 36 207.0 37 261.0 38 354.0 39 659.0 40 1306.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.613861386138616 14.85148514851485 16.584158415841586 34.95049504950495 2 22.1 20.150000000000002 34.55 23.200000000000003 3 24.45 22.35 29.075 24.125 4 24.474999999999998 27.85 21.925 25.75 5 23.575 31.424999999999997 23.45 21.55 6 18.925 35.5 24.675 20.9 7 17.2 19.6 41.699999999999996 21.5 8 18.925 23.225 30.25 27.6 9 21.175 23.45 30.975 24.4 10-14 21.775 29.459999999999997 26.8 21.965 15-19 21.935 27.584999999999997 27.49 22.99 20-24 22.28 27.765 27.595 22.36 25-29 22.42 27.375 27.54 22.665 30-34 22.295 27.765 27.115000000000002 22.825 35-39 21.975 27.884999999999998 27.365000000000002 22.775000000000002 40-44 22.14 27.575 27.810000000000002 22.475 45-49 22.16 27.77 27.284999999999997 22.785 50-54 22.24 28.470000000000002 26.75 22.54 55-59 22.335 27.93 26.97 22.765 60-64 21.55 27.42 27.87 23.16 65-69 22.21 27.605 27.68 22.505 70-74 22.805 27.560000000000002 27.384999999999998 22.25 75-79 22.715 27.785 27.485 22.015 80-84 22.14 27.825 27.36 22.675 85-89 23.125 27.265 27.284999999999997 22.325 90-94 22.285 27.994999999999997 27.16 22.56 95-99 22.42 27.589999999999996 27.46 22.53 100-104 22.8 27.79 27.055 22.355 105-109 23.94 27.925 26.26 21.875 110-114 23.395 28.084999999999997 26.455000000000002 22.065 115-119 22.869999999999997 27.229999999999997 27.355 22.545 120-124 22.869999999999997 28.035 26.77 22.325 125-129 22.905 27.665 26.97 22.46 130-134 23.855 27.02 26.995 22.13 135-139 23.474999999999998 27.93 26.87 21.725 140-144 23.66 27.810000000000002 26.715 21.815 145-149 23.46 27.77 26.96 21.81 150 25.4 26.75 25.2 22.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 3.5 24 2.5 25 3.0 26 3.0 27 5.5 28 10.0 29 10.0 30 10.5 31 20.5 32 27.5 33 29.5 34 47.5 35 62.0 36 75.5 37 101.0 38 142.5 39 164.5 40 171.0 41 199.0 42 218.0 43 244.0 44 266.5 45 283.5 46 270.5 47 243.0 48 235.5 49 220.5 50 181.0 51 145.5 52 135.5 53 102.0 54 73.5 55 63.0 56 44.0 57 29.0 58 23.0 59 22.5 60 19.0 61 16.5 62 14.5 63 8.5 64 7.0 65 7.5 66 7.0 67 6.0 68 6.0 69 4.5 70 4.0 71 3.0 72 1.0 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 49.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.61904761904762 84.175 2 7.945578231292518 14.6 3 0.40816326530612246 1.125 4 0.027210884353741496 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.1375 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.3625 0.0 0.0 0.0 0.0 126-127 1.5125 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 1.9874999999999998 0.0 0.0 0.0 0.0 134-135 2.1875 0.0 0.0 0.0 0.0 136-137 2.4749999999999996 0.0 0.0 0.0 0.0 138 2.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTTTT 10 0.007044714 143.5125 9 >>END_MODULE Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651788 spots for SRR11611369.sra Written 651788 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra Read 651775 spots for SRR11611369.sra Written 651775 spots for SRR11611369.sra SRR ids: ['SRR11611369.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0c1lv8b_ SRR11611369.sra spots: 13035513 blocks: [[1, 651775], [651776, 1303550], [1303551, 1955325], [1955326, 2607100], [2607101, 3258875], [3258876, 3910650], [3910651, 4562425], [4562426, 5214200], [5214201, 5865975], [5865976, 6517750], [6517751, 7169525], [7169526, 7821300], [7821301, 8473075], [8473076, 9124850], [9124851, 9776625], [9776626, 10428400], [10428401, 11080175], [11080176, 11731950], [11731951, 12383725], [12383726, 13035513]] SRR11611369 file size 4382877 SRR11611369 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11611369 SRR11611369_1.fastq SRR11611369_2.fastq Input file: SRR11611369_1.fastq Paired file: SRR11611369_2.fastq trimmed: SRR11611369-trimmed-pair1.fastq, SRR11611369-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:12:35 2025 >> started Tue Feb 11 01:12:48 2025 >> done (13.417s) 13035513 read pairs processed; of these: 1056 ( 0.01%) short read pairs filtered out after trimming by size control 3550 ( 0.03%) empty read pairs filtered out after trimming by size control 13030907 (99.96%) read pairs available; of these: 526282 ( 4.04%) trimmed read pairs available after processing 12504625 (95.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 112 0.00% 19 87 0.00% 20 82 0.00% 21 96 0.00% 22 78 0.00% 23 103 0.00% 24 84 0.00% 25 117 0.00% 26 122 0.00% 27 111 0.00% 28 119 0.00% 29 155 0.00% 30 112 0.00% 31 145 0.00% 32 160 0.00% 33 154 0.00% 34 166 0.00% 35 141 0.00% 36 180 0.00% 37 177 0.00% 38 206 0.00% 39 198 0.00% 40 180 0.00% 41 219 0.00% 42 206 0.00% 43 240 0.00% 44 225 0.00% 45 236 0.00% 46 214 0.00% 47 240 0.00% 48 245 0.00% 49 257 0.00% 50 285 0.00% 51 251 0.00% 52 254 0.00% 53 216 0.00% 54 249 0.00% 55 243 0.00% 56 277 0.00% 57 275 0.00% 58 273 0.00% 59 286 0.00% 60 291 0.00% 61 325 0.00% 62 369 0.00% 63 339 0.00% 64 320 0.00% 65 352 0.00% 66 349 0.00% 67 302 0.00% 68 307 0.00% 69 377 0.00% 70 392 0.00% 71 448 0.00% 72 523 0.00% 73 493 0.00% 74 518 0.00% 75 537 0.00% 76 487 0.00% 77 511 0.00% 78 537 0.00% 79 565 0.00% 80 645 0.00% 81 679 0.01% 82 866 0.01% 83 1000 0.01% 84 1039 0.01% 85 1038 0.01% 86 1025 0.01% 87 982 0.01% 88 967 0.01% 89 1050 0.01% 90 1094 0.01% 91 1310 0.01% 92 1684 0.01% 93 1898 0.01% 94 2082 0.02% 95 2212 0.02% 96 2172 0.02% 97 2067 0.02% 98 2058 0.02% 99 2174 0.02% 100 2277 0.02% 101 2617 0.02% 102 3144 0.02% 103 3792 0.03% 104 4008 0.03% 105 4392 0.03% 106 4421 0.03% 107 4205 0.03% 108 4020 0.03% 109 4007 0.03% 110 4235 0.03% 111 4551 0.03% 112 5361 0.04% 113 6192 0.05% 114 7136 0.05% 115 7744 0.06% 116 7511 0.06% 117 7191 0.06% 118 7049 0.05% 119 6785 0.05% 120 7125 0.05% 121 7304 0.06% 122 8163 0.06% 123 9151 0.07% 124 10232 0.08% 125 11075 0.08% 126 11213 0.09% 127 11130 0.09% 128 10723 0.08% 129 10027 0.08% 130 9933 0.08% 131 10437 0.08% 132 10726 0.08% 133 12095 0.09% 134 13406 0.10% 135 14140 0.11% 136 14621 0.11% 137 14412 0.11% 138 14082 0.11% 139 13334 0.10% 140 13052 0.10% 141 12988 0.10% 142 13494 0.10% 143 14413 0.11% 144 15589 0.12% 145 17114 0.13% 146 17193 0.13% 147 17820 0.14% 148 17132 0.13% 149 19360 0.15% 150 12504625 95.96% 13030907 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=26 prefix-density=0.15 prefix-fanout=2.6 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=17 fanout-score=28.05 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=7.8 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.50 fanout-score-rank=28 prefix-density=0.14 prefix-fanout=2.7 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=46.11 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.2 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCT SRR11611369 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:13:30 Started mapping on | Feb 11 01:13:30 Finished on | Feb 11 01:14:52 Mapping speed, Million of reads per hour | 572.09 Number of input reads | 13030907 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11906201 Uniquely mapped reads % | 91.37% Average mapped length | 296.67 Number of splices: Total | 10583797 Number of splices: Annotated (sjdb) | 10433587 Number of splices: GT/AG | 10428856 Number of splices: GC/AG | 125907 Number of splices: AT/AC | 8220 Number of splices: Non-canonical | 20814 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.77 Insertion rate per base | 0.01% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 266615 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 460638 % of reads mapped to too many loci | 3.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 858091 858091 858091 N_multimapping 266615 266615 266615 N_noFeature 325011 6108351 6038940 N_ambiguous 143200 29887 29668 UnstrandedReadsAssigned:11437990 PositiveStrandReadsAssigned:5767963 NegativeStrandReadsAssigned:5837593 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11611369 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11611369-trimmed-pair1.fastq SRR11611369-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,030,907 reads, 12,197,509 reads pseudoaligned [quant] estimated average fragment length: 268.725 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,342 rounds 52401 SRR11611369.ke.tsv 34699 SRR11611369.se.tsv 87100 total ==> SRR11611369.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.27 574 27.7442 Potri.005G024800.1.v4.1 1035 767.275 280 30.8726 Potri.004G059700.1.v4.1 961 693.286 16 1.95242 Potri.007G009000.2.v4.1 1416 1148.27 0 0 Potri.003G141000.2.v4.1 2943 2675.27 363.122 11.4829 Potri.016G087400.1.v4.1 270 65.242 644 835.074 Potri.015G069301.1.v4.1 564 296.497 0 0 Potri.010G195200.1.v4.1 1773 1505.27 14 0.786826 Potri.012G127500.1.v4.1 977 709.286 937 111.76 ==> SRR11611369.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 880 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 153 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR11611369 completed mapping pipeline successfully