Starting /dee2/code/volunteer_pipeline.sh SRR11611370 current disk space = 3057350918144 free memory = 1046688288 SRR11611370 SRAfilesize 3ba1b862c10ec9bd3ebfef0dee244cc0 SRR11611370.sra SRR11611370.sra file validated SRR11611370 is paired end SRR11611370 is conventional basespace SRR11611370 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611370_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.96625 32.0 32.0 32.0 2.0 32.0 2 31.56125 32.0 32.0 32.0 32.0 32.0 3 34.91375 37.0 32.0 37.0 32.0 37.0 4 36.25375 37.0 37.0 37.0 32.0 37.0 5 36.305 37.0 37.0 37.0 37.0 37.0 6 38.99225 41.0 41.0 41.0 32.0 41.0 7 39.67 41.0 41.0 41.0 37.0 41.0 8 39.8935 41.0 41.0 41.0 37.0 41.0 9 40.1 41.0 41.0 41.0 37.0 41.0 10-14 39.7959 41.0 41.0 41.0 37.0 41.0 15-19 39.9707 41.0 41.0 41.0 37.0 41.0 20-24 39.9199 41.0 41.0 41.0 37.0 41.0 25-29 38.89020000000001 41.0 40.2 41.0 33.0 41.0 30-34 39.447950000000006 41.0 41.0 41.0 37.0 41.0 35-39 39.4481 41.0 41.0 41.0 37.0 41.0 40-44 38.92915000000001 41.0 41.0 41.0 35.0 41.0 45-49 39.102000000000004 41.0 41.0 41.0 35.0 41.0 50-54 39.203250000000004 41.0 41.0 41.0 36.0 41.0 55-59 39.122550000000004 41.0 41.0 41.0 36.0 41.0 60-64 39.27505 41.0 41.0 41.0 37.0 41.0 65-69 39.300850000000004 41.0 41.0 41.0 36.0 41.0 70-74 39.14555 41.0 41.0 41.0 35.0 41.0 75-79 38.9285 41.0 40.2 41.0 35.0 41.0 80-84 39.525850000000005 41.0 41.0 41.0 37.0 41.0 85-89 38.7524 41.0 40.2 41.0 34.0 41.0 90-94 39.33785 41.0 41.0 41.0 37.0 41.0 95-99 38.85405000000001 41.0 41.0 41.0 33.0 41.0 100-104 38.778800000000004 41.0 41.0 41.0 34.0 41.0 105-109 38.74535 41.0 40.2 41.0 33.0 41.0 110-114 38.5367 41.0 40.2 41.0 33.0 41.0 115-119 39.006949999999996 41.0 41.0 41.0 34.0 41.0 120-124 38.06355 41.0 38.6 41.0 30.0 41.0 125-129 39.0218 41.0 41.0 41.0 34.0 41.0 130-134 38.55095 41.0 40.2 41.0 32.0 41.0 135-139 38.36715 41.0 40.2 41.0 32.0 41.0 140-144 38.022299999999994 41.0 37.8 41.0 31.0 41.0 145-149 38.55970000000001 41.0 40.2 41.0 32.0 41.0 150 37.994 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 2.0 23 5.0 24 6.0 25 4.0 26 6.0 27 23.0 28 24.0 29 34.0 30 45.0 31 51.0 32 79.0 33 107.0 34 97.0 35 124.0 36 147.0 37 175.0 38 251.0 39 455.0 40 2362.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.961471103327494 15.995329830706362 18.359603035610043 33.6835960303561 2 22.625 19.35 36.175000000000004 21.85 3 22.2 23.65 29.825000000000003 24.325 4 24.3 28.499999999999996 21.25 25.95 5 24.474999999999998 34.025 23.525 17.974999999999998 6 20.1 35.099999999999994 23.3 21.5 7 17.974999999999998 20.674999999999997 40.575 20.775 8 18.05 23.775 30.3 27.875 9 18.6 24.8 30.7 25.900000000000002 10-14 22.205 29.085 27.07 21.64 15-19 21.44 27.439999999999998 27.975 23.145 20-24 22.075 27.450000000000003 27.589999999999996 22.884999999999998 25-29 21.565 26.840000000000003 27.950000000000003 23.645 30-34 21.875 27.595 27.325 23.205000000000002 35-39 22.384999999999998 28.139999999999997 27.22 22.255 40-44 22.065 27.43 27.685 22.82 45-49 21.965 27.98 26.965 23.09 50-54 22.14 28.139999999999997 27.315 22.405 55-59 22.615 27.615000000000002 28.000000000000004 21.77 60-64 21.64 28.075 27.71 22.575 65-69 21.815 27.224999999999998 27.900000000000002 23.06 70-74 22.384999999999998 27.87 27.24 22.505 75-79 22.225 27.495000000000005 27.589999999999996 22.689999999999998 80-84 22.439999999999998 28.134999999999998 26.855 22.57 85-89 22.900000000000002 27.525 27.42 22.155 90-94 22.68 27.224999999999998 27.425 22.67 95-99 22.975 27.6 26.805 22.62 100-104 22.96 28.65 26.46 21.93 105-109 22.575 27.150000000000002 27.725 22.55 110-114 22.895 27.67 27.195000000000004 22.24 115-119 22.81 27.839999999999996 26.625 22.725 120-124 23.72 27.93 26.345000000000002 22.005 125-129 22.915 27.58 26.82 22.685 130-134 22.875 27.534999999999997 27.04 22.55 135-139 22.3 27.71 27.555000000000003 22.435 140-144 22.59 27.16 27.095000000000002 23.155 145-149 22.305 28.13 26.840000000000003 22.725 150 23.75 26.8 26.825 22.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.0 24 0.0 25 2.0 26 3.5 27 6.0 28 11.5 29 12.5 30 14.0 31 19.5 32 30.0 33 38.5 34 46.5 35 63.0 36 79.5 37 101.5 38 124.5 39 142.0 40 162.0 41 187.5 42 223.5 43 265.0 44 270.0 45 267.0 46 277.0 47 261.0 48 238.5 49 209.0 50 180.0 51 152.0 52 115.0 53 100.5 54 83.0 55 50.0 56 41.0 57 39.0 58 26.5 59 23.0 60 24.0 61 21.5 62 18.0 63 16.5 64 10.5 65 6.0 66 6.5 67 3.0 68 4.0 69 5.0 70 2.5 71 1.0 72 2.0 73 3.5 74 2.5 75 2.0 76 2.0 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.05 #Duplication Level Percentage of deduplicated Percentage of total 1 89.6446418656302 80.72500000000001 2 9.68906163242643 17.45 3 0.6385341476957246 1.725 4 0.027762354247640203 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4500000000000002 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.8250000000000002 0.0 0.0 0.0 0.0 124-125 1.925 0.0 0.0 0.0 0.0 126-127 2.025 0.0 0.0 0.0 0.0 128-129 2.225 0.0 0.0 0.0 0.0 130-131 2.3499999999999996 0.0 0.0 0.0 0.0 132-133 2.575 0.0 0.0 0.0 0.0 134-135 2.6875 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138 2.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACGCT 10 0.006993593 143.86249 8 >>END_MODULE SRR11611370 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611370_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.9275 32.0 2.0 32.0 2.0 32.0 2 31.04875 32.0 32.0 32.0 32.0 32.0 3 30.97625 32.0 32.0 37.0 12.0 37.0 4 32.42125 37.0 32.0 37.0 27.0 37.0 5 35.1675 37.0 37.0 37.0 32.0 37.0 6 36.66925 41.0 37.0 41.0 27.0 41.0 7 36.87675 41.0 37.0 41.0 27.0 41.0 8 37.68225 41.0 37.0 41.0 32.0 41.0 9 38.8405 41.0 41.0 41.0 32.0 41.0 10-14 38.8971 41.0 41.0 41.0 35.0 41.0 15-19 38.587999999999994 41.0 40.2 41.0 33.0 41.0 20-24 36.7489 40.2 35.6 41.0 24.0 41.0 25-29 38.204499999999996 41.0 39.4 41.0 31.0 41.0 30-34 38.7573 41.0 40.2 41.0 34.0 41.0 35-39 37.69375 41.0 37.6 41.0 28.0 41.0 40-44 38.511199999999995 41.0 40.2 41.0 33.0 41.0 45-49 38.3201 41.0 39.4 41.0 31.0 41.0 50-54 37.267250000000004 41.0 37.0 41.0 27.0 41.0 55-59 37.36265 41.0 38.6 41.0 27.0 41.0 60-64 38.1 41.0 38.6 41.0 30.0 41.0 65-69 37.7735 41.0 39.4 41.0 30.0 41.0 70-74 37.5733 41.0 37.0 41.0 28.0 41.0 75-79 36.6381 40.2 36.0 41.0 25.0 41.0 80-84 37.04205 41.0 36.0 41.0 25.0 41.0 85-89 36.3603 41.0 35.0 41.0 23.0 41.0 90-94 36.701649999999994 41.0 37.0 41.0 24.0 41.0 95-99 35.67835 40.2 34.0 41.0 20.0 41.0 100-104 35.9419 41.0 34.0 41.0 23.0 41.0 105-109 34.674699999999994 38.4 30.0 41.0 20.0 41.0 110-114 35.7773 40.2 33.0 41.0 21.0 41.0 115-119 35.0311 40.2 32.0 41.0 16.0 41.0 120-124 36.37644999999999 41.0 35.0 41.0 24.0 41.0 125-129 35.9072 41.0 35.0 41.0 22.0 41.0 130-134 34.885949999999994 38.6 32.0 41.0 17.0 41.0 135-139 34.62765 39.4 32.0 41.0 18.0 41.0 140-144 36.4418 41.0 36.0 41.0 22.0 41.0 145-149 35.579150000000006 40.2 34.0 41.0 21.0 41.0 150 35.983 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 12.0 19 12.0 20 17.0 21 27.0 22 29.0 23 22.0 24 43.0 25 52.0 26 70.0 27 71.0 28 70.0 29 73.0 30 95.0 31 92.0 32 122.0 33 120.0 34 129.0 35 169.0 36 192.0 37 284.0 38 376.0 39 651.0 40 1270.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.876138433515482 14.5264116575592 18.670309653916213 34.92714025500911 2 21.875 19.900000000000002 35.425000000000004 22.8 3 23.275000000000002 23.575 28.249999999999996 24.9 4 24.975 26.75 24.0 24.275 5 24.349999999999998 32.225 23.625 19.8 6 19.825 36.199999999999996 24.349999999999998 19.625 7 18.175 18.75 41.9 21.175 8 20.474999999999998 22.675 31.125000000000004 25.724999999999998 9 21.675 24.05 30.099999999999998 24.175 10-14 22.470000000000002 28.42 26.784999999999997 22.325 15-19 21.665 28.335 27.810000000000002 22.189999999999998 20-24 22.259999999999998 27.810000000000002 27.495000000000005 22.435 25-29 21.995 28.139999999999997 26.950000000000003 22.915 30-34 22.175 28.305000000000003 26.985 22.535 35-39 22.035 28.21 27.05 22.705000000000002 40-44 21.935 27.445000000000004 27.525 23.095 45-49 21.985 27.279999999999998 27.665 23.07 50-54 22.205 27.3 27.689999999999998 22.805 55-59 21.59 27.395000000000003 27.77 23.244999999999997 60-64 22.11 27.43 27.905 22.555 65-69 22.509999999999998 27.065 27.950000000000003 22.475 70-74 21.66 27.089999999999996 27.935 23.315 75-79 22.05 27.55 27.595 22.805 80-84 22.335 27.095000000000002 27.744999999999997 22.825 85-89 23.105 27.169999999999998 27.474999999999998 22.25 90-94 22.345000000000002 27.169999999999998 27.445000000000004 23.04 95-99 23.135 26.755000000000003 27.765 22.345000000000002 100-104 22.62 27.439999999999998 26.900000000000002 23.04 105-109 23.615 28.095 26.400000000000002 21.89 110-114 22.53 27.810000000000002 26.884999999999998 22.775000000000002 115-119 22.81 27.650000000000002 26.540000000000003 23.0 120-124 22.415 27.450000000000003 27.08 23.055 125-129 22.564999999999998 27.644999999999996 26.740000000000002 23.05 130-134 23.995 27.24 26.87 21.895 135-139 23.855 27.544999999999998 26.784999999999997 21.815 140-144 22.86 27.034999999999997 27.584999999999997 22.52 145-149 23.665 27.075 26.979999999999997 22.28 150 22.975 26.275 28.050000000000004 22.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 2.5 18 1.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 3.5 25 3.5 26 5.0 27 6.0 28 5.5 29 6.5 30 13.0 31 21.0 32 24.0 33 23.5 34 37.0 35 71.0 36 92.5 37 100.0 38 122.5 39 148.0 40 189.5 41 231.0 42 237.5 43 250.5 44 262.5 45 261.0 46 254.0 47 253.5 48 238.5 49 203.0 50 164.5 51 137.5 52 130.0 53 108.0 54 78.5 55 58.0 56 51.0 57 40.0 58 26.5 59 22.5 60 19.0 61 16.5 62 14.5 63 13.0 64 9.5 65 7.0 66 4.5 67 3.5 68 4.0 69 3.5 70 3.0 71 2.5 72 3.0 73 1.5 74 2.5 75 3.0 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 45.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.325 #Duplication Level Percentage of deduplicated Percentage of total 1 92.14730571351205 85.075 2 7.446520444083402 13.750000000000002 3 0.3520173300839426 0.975 4 0.05415651232060655 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.025 0.0 40-41 0.125 0.0 0.0 0.025 0.0 42-43 0.125 0.0 0.0 0.025 0.0 44-45 0.125 0.0 0.0 0.025 0.0 46-47 0.125 0.0 0.0 0.025 0.0 48-49 0.125 0.0 0.0 0.025 0.0 50-51 0.125 0.0 0.0 0.025 0.0 52-53 0.125 0.0 0.0 0.025 0.0 54-55 0.125 0.0 0.0 0.025 0.0 56-57 0.125 0.0 0.0 0.025 0.0 58-59 0.125 0.0 0.0 0.025 0.0 60-61 0.125 0.0 0.0 0.025 0.0 62-63 0.125 0.0 0.0 0.025 0.0 64-65 0.1375 0.0 0.0 0.025 0.0 66-67 0.15 0.0 0.0 0.025 0.0 68-69 0.15 0.0 0.0 0.025 0.0 70-71 0.15 0.0 0.0 0.025 0.0 72-73 0.15 0.0 0.0 0.025 0.0 74-75 0.15 0.0 0.0 0.025 0.0 76-77 0.15 0.0 0.0 0.025 0.0 78-79 0.15 0.0 0.0 0.025 0.0 80-81 0.15 0.0 0.0 0.025 0.0 82-83 0.1875 0.0 0.0 0.025 0.0 84-85 0.225 0.0 0.0 0.025 0.0 86-87 0.25 0.0 0.0 0.025 0.0 88-89 0.275 0.0 0.0 0.025 0.0 90-91 0.3125 0.0 0.0 0.025 0.0 92-93 0.35 0.0 0.0 0.025 0.0 94-95 0.375 0.0 0.0 0.025 0.0 96-97 0.425 0.0 0.0 0.025 0.0 98-99 0.425 0.0 0.0 0.025 0.0 100-101 0.44999999999999996 0.0 0.0 0.025 0.0 102-103 0.5125 0.0 0.0 0.025 0.0 104-105 0.5625 0.0 0.0 0.025 0.0 106-107 0.6375 0.0 0.0 0.025 0.0 108-109 0.7250000000000001 0.0 0.0 0.025 0.0 110-111 0.85 0.0 0.0 0.025 0.0 112-113 0.95 0.0 0.0 0.025 0.0 114-115 1.125 0.0 0.0 0.025 0.0 116-117 1.3875 0.0 0.0 0.025 0.0 118-119 1.5499999999999998 0.0 0.0 0.025 0.0 120-121 1.7875 0.0 0.0 0.025 0.0 122-123 1.9249999999999998 0.0 0.0 0.025 0.0 124-125 2.05 0.0 0.0 0.025 0.0 126-127 2.1500000000000004 0.0 0.0 0.025 0.0 128-129 2.325 0.0 0.0 0.025 0.0 130-131 2.45 0.0 0.0 0.025 0.0 132-133 2.65 0.0 0.0 0.025 0.0 134-135 2.7625 0.0 0.0 0.025 0.0 136-137 2.8875 0.0 0.0 0.025 0.0 138 2.95 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTAT 10 0.0070373793 143.5625 5 GGTTCTA 10 0.0070373793 143.5625 4 >>END_MODULE Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598242 spots for SRR11611370.sra Written 598242 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra Read 598232 spots for SRR11611370.sra Written 598232 spots for SRR11611370.sra SRR ids: ['SRR11611370.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zqu4gfyq SRR11611370.sra spots: 11964650 blocks: [[1, 598232], [598233, 1196464], [1196465, 1794696], [1794697, 2392928], [2392929, 2991160], [2991161, 3589392], [3589393, 4187624], [4187625, 4785856], [4785857, 5384088], [5384089, 5982320], [5982321, 6580552], [6580553, 7178784], [7178785, 7777016], [7777017, 8375248], [8375249, 8973480], [8973481, 9571712], [9571713, 10169944], [10169945, 10768176], [10768177, 11366408], [11366409, 11964650]] SRR11611370 file size 4021042 SRR11611370 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11611370 SRR11611370_1.fastq SRR11611370_2.fastq Input file: SRR11611370_1.fastq Paired file: SRR11611370_2.fastq trimmed: SRR11611370-trimmed-pair1.fastq, SRR11611370-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:24:21 2025 >> started Tue Feb 11 00:24:35 2025 >> done (13.295s) 11964650 read pairs processed; of these: 1186 ( 0.01%) short read pairs filtered out after trimming by size control 2911 ( 0.02%) empty read pairs filtered out after trimming by size control 11960553 (99.97%) read pairs available; of these: 541693 ( 4.53%) trimmed read pairs available after processing 11418860 (95.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 105 0.00% 19 97 0.00% 20 104 0.00% 21 101 0.00% 22 93 0.00% 23 117 0.00% 24 98 0.00% 25 109 0.00% 26 137 0.00% 27 104 0.00% 28 130 0.00% 29 114 0.00% 30 146 0.00% 31 146 0.00% 32 144 0.00% 33 129 0.00% 34 148 0.00% 35 151 0.00% 36 148 0.00% 37 166 0.00% 38 124 0.00% 39 164 0.00% 40 172 0.00% 41 161 0.00% 42 192 0.00% 43 176 0.00% 44 164 0.00% 45 197 0.00% 46 174 0.00% 47 165 0.00% 48 175 0.00% 49 212 0.00% 50 214 0.00% 51 232 0.00% 52 242 0.00% 53 251 0.00% 54 253 0.00% 55 242 0.00% 56 238 0.00% 57 204 0.00% 58 226 0.00% 59 261 0.00% 60 270 0.00% 61 290 0.00% 62 345 0.00% 63 351 0.00% 64 357 0.00% 65 328 0.00% 66 332 0.00% 67 283 0.00% 68 376 0.00% 69 410 0.00% 70 428 0.00% 71 505 0.00% 72 559 0.00% 73 598 0.00% 74 673 0.01% 75 577 0.00% 76 548 0.00% 77 590 0.00% 78 593 0.00% 79 648 0.01% 80 641 0.01% 81 813 0.01% 82 962 0.01% 83 1238 0.01% 84 1272 0.01% 85 1251 0.01% 86 1207 0.01% 87 1171 0.01% 88 1158 0.01% 89 1220 0.01% 90 1385 0.01% 91 1566 0.01% 92 1990 0.02% 93 2504 0.02% 94 2662 0.02% 95 2680 0.02% 96 2681 0.02% 97 2572 0.02% 98 2375 0.02% 99 2535 0.02% 100 2737 0.02% 101 3097 0.03% 102 3605 0.03% 103 4332 0.04% 104 4961 0.04% 105 5036 0.04% 106 5183 0.04% 107 4882 0.04% 108 4733 0.04% 109 4745 0.04% 110 4650 0.04% 111 5135 0.04% 112 5998 0.05% 113 7099 0.06% 114 7838 0.07% 115 8566 0.07% 116 8515 0.07% 117 8271 0.07% 118 7813 0.07% 119 7301 0.06% 120 7406 0.06% 121 7757 0.06% 122 8481 0.07% 123 9436 0.08% 124 10647 0.09% 125 11472 0.10% 126 12111 0.10% 127 11644 0.10% 128 10955 0.09% 129 10271 0.09% 130 10078 0.08% 131 10106 0.08% 132 10626 0.09% 133 12069 0.10% 134 12797 0.11% 135 14432 0.12% 136 14521 0.12% 137 14756 0.12% 138 14086 0.12% 139 13357 0.11% 140 12694 0.11% 141 12229 0.10% 142 12715 0.11% 143 13324 0.11% 144 14860 0.12% 145 16101 0.13% 146 16991 0.14% 147 16941 0.14% 148 16419 0.14% 149 18044 0.15% 150 11418860 95.47% 11960553 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=33 prefix-density=0.13 prefix-fanout=2.5 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=17 fanout-score=151.42 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=20.5 sequence=GCTGCTGCTGCT criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=29 prefix-density=0.12 prefix-fanout=2.8 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=14 fanout-score=273.15 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=31.1 sequence=AAGAAGAAGAAA SRR11611370 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:25:15 Started mapping on | Feb 11 00:25:15 Finished on | Feb 11 00:26:32 Mapping speed, Million of reads per hour | 559.19 Number of input reads | 11960553 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10767425 Uniquely mapped reads % | 90.02% Average mapped length | 296.22 Number of splices: Total | 9894995 Number of splices: Annotated (sjdb) | 9745828 Number of splices: GT/AG | 9738494 Number of splices: GC/AG | 126243 Number of splices: AT/AC | 7325 Number of splices: Non-canonical | 22933 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 2.53 Insertion rate per base | 0.01% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295493 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 483810 % of reads mapped to too many loci | 4.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.67% % of reads unmapped: other | 0.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 897635 897635 897635 N_multimapping 295493 295493 295493 N_noFeature 341520 5568388 5474695 N_ambiguous 123454 28729 29123 UnstrandedReadsAssigned:10302451 PositiveStrandReadsAssigned:5170308 NegativeStrandReadsAssigned:5263607 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11611370 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11611370-trimmed-pair1.fastq SRR11611370-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,960,553 reads, 11,108,965 reads pseudoaligned [quant] estimated average fragment length: 270.912 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR11611370.ke.tsv 34699 SRR11611370.se.tsv 87100 total ==> SRR11611370.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.09 414 22.2303 Potri.005G024800.1.v4.1 1035 765.088 130 15.9493 Potri.004G059700.1.v4.1 961 691.088 13 1.76571 Potri.007G009000.2.v4.1 1416 1146.09 0 0 Potri.003G141000.2.v4.1 2943 2673.09 425.149 14.9292 Potri.016G087400.1.v4.1 270 68.3874 539 739.811 Potri.015G069301.1.v4.1 564 294.374 0 0 Potri.010G195200.1.v4.1 1773 1503.09 24 1.49877 Potri.012G127500.1.v4.1 977 707.088 3070 407.543 ==> SRR11611370.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 743 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 117 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 114 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR11611370 completed mapping pipeline successfully