Starting /dee2/code/volunteer_pipeline.sh SRR11611371 current disk space = 3057405632512 free memory = 1317258624 SRR11611371 SRAfilesize db93131bc021678b83003d31b2b98c47 SRR11611371.sra SRR11611371.sra file validated SRR11611371 is paired end SRR11611371 is conventional basespace SRR11611371 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611371_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.5375 32.0 32.0 32.0 2.0 32.0 2 31.6175 32.0 32.0 32.0 32.0 32.0 3 34.83875 37.0 32.0 37.0 32.0 37.0 4 36.17875 37.0 37.0 37.0 32.0 37.0 5 36.3675 37.0 37.0 37.0 37.0 37.0 6 39.02175 41.0 41.0 41.0 37.0 41.0 7 39.775 41.0 41.0 41.0 37.0 41.0 8 39.975 41.0 41.0 41.0 37.0 41.0 9 40.09 41.0 41.0 41.0 37.0 41.0 10-14 39.9 41.0 41.0 41.0 37.0 41.0 15-19 40.095099999999995 41.0 41.0 41.0 37.0 41.0 20-24 40.005100000000006 41.0 41.0 41.0 37.0 41.0 25-29 38.8875 41.0 40.2 41.0 33.0 41.0 30-34 39.530449999999995 41.0 41.0 41.0 37.0 41.0 35-39 39.4764 41.0 41.0 41.0 37.0 41.0 40-44 39.0295 41.0 41.0 41.0 36.0 41.0 45-49 39.2768 41.0 41.0 41.0 35.0 41.0 50-54 39.3614 41.0 41.0 41.0 36.0 41.0 55-59 39.2643 41.0 41.0 41.0 37.0 41.0 60-64 39.32825 41.0 41.0 41.0 37.0 41.0 65-69 39.3504 41.0 41.0 41.0 36.0 41.0 70-74 39.26685 41.0 41.0 41.0 36.0 41.0 75-79 39.0444 41.0 40.2 41.0 36.0 41.0 80-84 39.635749999999994 41.0 41.0 41.0 37.0 41.0 85-89 38.857299999999995 41.0 40.2 41.0 34.0 41.0 90-94 39.421099999999996 41.0 41.0 41.0 37.0 41.0 95-99 38.981100000000005 41.0 41.0 41.0 33.0 41.0 100-104 38.9665 41.0 41.0 41.0 35.0 41.0 105-109 38.78240000000001 41.0 40.2 41.0 33.0 41.0 110-114 38.650349999999996 41.0 40.2 41.0 33.0 41.0 115-119 39.1866 41.0 41.0 41.0 36.0 41.0 120-124 38.13205000000001 41.0 38.6 41.0 30.0 41.0 125-129 39.09145 41.0 41.0 41.0 35.0 41.0 130-134 38.621500000000005 41.0 40.2 41.0 33.0 41.0 135-139 38.580799999999996 41.0 41.0 41.0 32.0 41.0 140-144 38.104400000000005 41.0 40.2 41.0 30.0 41.0 145-149 38.660900000000005 41.0 41.0 41.0 33.0 41.0 150 38.0845 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 1.0 22 0.0 23 3.0 24 7.0 25 5.0 26 14.0 27 20.0 28 25.0 29 31.0 30 44.0 31 57.0 32 73.0 33 67.0 34 92.0 35 114.0 36 141.0 37 189.0 38 262.0 39 421.0 40 2432.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.68321513002364 16.696217494089836 15.455082742316783 35.16548463356974 2 21.15 20.7 34.525 23.625 3 23.3 22.375 29.95 24.375 4 25.074999999999996 27.175 23.3 24.45 5 25.3 30.55 24.349999999999998 19.8 6 20.724999999999998 35.075 24.775 19.425 7 18.15 19.650000000000002 41.925000000000004 20.275000000000002 8 19.8 22.375 31.474999999999998 26.35 9 21.95 24.075 29.375 24.6 10-14 21.545 29.345 26.950000000000003 22.16 15-19 21.8 28.175 27.62 22.405 20-24 22.335 26.43 28.405 22.830000000000002 25-29 21.83 28.165000000000003 27.62 22.384999999999998 30-34 22.189999999999998 26.965 27.994999999999997 22.85 35-39 22.1 27.555000000000003 26.82 23.525 40-44 22.314999999999998 27.975 27.205000000000002 22.505 45-49 22.37 27.005000000000003 27.605 23.02 50-54 21.68 27.0 28.205000000000002 23.115 55-59 22.16 27.13 28.134999999999998 22.575 60-64 22.470000000000002 26.955000000000002 28.110000000000003 22.465 65-69 22.13 27.939999999999998 27.35 22.58 70-74 22.58 27.365000000000002 27.634999999999998 22.42 75-79 22.985 27.084999999999997 27.525 22.405 80-84 21.81 28.405 26.865 22.919999999999998 85-89 22.2 27.525 27.560000000000002 22.715 90-94 22.45 27.084999999999997 27.97 22.495 95-99 21.785 27.875 27.534999999999997 22.805 100-104 22.259999999999998 27.88 27.224999999999998 22.634999999999998 105-109 21.985 27.0 28.035 22.98 110-114 22.105 27.765 27.694999999999997 22.435 115-119 23.23 27.865000000000002 26.834999999999997 22.07 120-124 22.439999999999998 28.015 27.255000000000003 22.29 125-129 22.720000000000002 26.755000000000003 28.175 22.35 130-134 23.005 27.13 27.71 22.155 135-139 22.515 27.224999999999998 27.900000000000002 22.36 140-144 21.98 27.32 27.48 23.22 145-149 22.625 27.74 27.1 22.535 150 22.675 26.25 27.200000000000003 23.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 4.0 27 4.5 28 6.0 29 13.0 30 15.5 31 16.0 32 16.5 33 29.5 34 38.5 35 53.5 36 74.5 37 103.0 38 132.0 39 164.0 40 191.5 41 208.5 42 220.0 43 237.0 44 254.5 45 260.5 46 270.5 47 268.5 48 246.0 49 220.0 50 193.5 51 156.0 52 120.0 53 97.5 54 85.0 55 62.5 56 47.0 57 41.0 58 30.5 59 16.0 60 10.5 61 15.0 62 17.5 63 15.0 64 11.0 65 6.0 66 5.0 67 4.0 68 3.5 69 2.5 70 2.5 71 2.5 72 2.5 73 2.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 15.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.04437049362174 81.175 2 8.985024958402663 16.2 3 0.9706045479755963 2.625 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.8999999999999999 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.25 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.825 0.0 0.0 0.0 0.0 130-131 2.025 0.0 0.0 0.0 0.0 132-133 2.2375 0.0 0.0 0.0 0.0 134-135 2.5250000000000004 0.0 0.0 0.0 0.0 136-137 2.7875 0.0 0.0 0.0 0.0 138 2.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAGAC 10 0.004273739 169.23529 1 ACTGATT 10 0.0069954093 143.85 6 AATTATA 10 0.0069954093 143.85 8 CTGATTA 10 0.0069954093 143.85 7 GACTGAT 10 0.0069954093 143.85 5 GATTACG 10 0.0069954093 143.85 9 >>END_MODULE SRR11611371 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611371_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.07875 12.0 2.0 32.0 2.0 32.0 2 31.28 32.0 32.0 32.0 32.0 32.0 3 31.19625 32.0 32.0 37.0 27.0 37.0 4 32.555 37.0 32.0 37.0 27.0 37.0 5 35.395 37.0 37.0 37.0 32.0 37.0 6 36.79025 41.0 37.0 41.0 27.0 41.0 7 37.1075 41.0 37.0 41.0 27.0 41.0 8 37.96825 41.0 37.0 41.0 32.0 41.0 9 39.06625 41.0 41.0 41.0 37.0 41.0 10-14 39.1234 41.0 41.0 41.0 35.0 41.0 15-19 38.810199999999995 41.0 40.2 41.0 34.0 41.0 20-24 37.0836 41.0 36.6 41.0 26.0 41.0 25-29 38.35625 41.0 40.2 41.0 31.0 41.0 30-34 38.98125 41.0 41.0 41.0 35.0 41.0 35-39 38.0228 41.0 40.2 41.0 28.0 41.0 40-44 38.8153 41.0 40.2 41.0 35.0 41.0 45-49 38.55695 41.0 40.2 41.0 32.0 41.0 50-54 37.617149999999995 41.0 37.8 41.0 28.0 41.0 55-59 37.6867 41.0 38.6 41.0 28.0 41.0 60-64 38.33065 41.0 38.6 41.0 32.0 41.0 65-69 38.06429999999999 41.0 39.4 41.0 30.0 41.0 70-74 37.7383 41.0 37.8 41.0 28.0 41.0 75-79 36.83215 40.2 36.0 41.0 26.0 41.0 80-84 37.36755 41.0 36.8 41.0 28.0 41.0 85-89 36.66805 41.0 36.0 41.0 24.0 41.0 90-94 37.11695 41.0 37.0 41.0 25.0 41.0 95-99 36.01765 40.2 34.0 41.0 21.0 41.0 100-104 36.28215 41.0 35.0 41.0 23.0 41.0 105-109 35.06025 38.4 31.0 41.0 22.0 41.0 110-114 36.00165 40.2 35.0 41.0 22.0 41.0 115-119 35.204950000000004 41.0 34.0 41.0 16.0 41.0 120-124 36.700300000000006 41.0 35.0 41.0 25.0 41.0 125-129 36.220150000000004 41.0 37.0 41.0 23.0 41.0 130-134 35.26645 38.6 33.0 41.0 19.0 41.0 135-139 34.79505 40.2 32.0 41.0 18.0 41.0 140-144 36.654999999999994 41.0 37.0 41.0 23.0 41.0 145-149 35.88415 40.2 36.0 41.0 21.0 41.0 150 36.2525 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 2.0 18 0.0 19 7.0 20 12.0 21 20.0 22 24.0 23 26.0 24 26.0 25 51.0 26 48.0 27 60.0 28 73.0 29 92.0 30 99.0 31 98.0 32 118.0 33 119.0 34 139.0 35 158.0 36 211.0 37 249.0 38 341.0 39 700.0 40 1325.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.75181071945919 17.189763399323997 17.044905842588122 32.013520038628684 2 21.975 20.150000000000002 34.75 23.125 3 23.849999999999998 24.025 29.049999999999997 23.075000000000003 4 26.275 27.125 21.3 25.3 5 24.125 32.824999999999996 23.025000000000002 20.025000000000002 6 19.825 36.0 24.15 20.025000000000002 7 19.725 19.875 41.875 18.525 8 20.4 23.175 29.875 26.55 9 21.8 24.349999999999998 29.099999999999998 24.75 10-14 21.2 29.32 26.97 22.509999999999998 15-19 21.305 27.13 28.360000000000003 23.205000000000002 20-24 22.0 28.54 26.865 22.595000000000002 25-29 21.645 28.34 27.125 22.89 30-34 21.68 28.444999999999997 27.185 22.689999999999998 35-39 21.404999999999998 27.884999999999998 27.79 22.919999999999998 40-44 22.15 28.035 27.505000000000003 22.31 45-49 21.82 27.24 27.839999999999996 23.1 50-54 21.97 28.060000000000002 27.634999999999998 22.335 55-59 22.54 27.96 27.0 22.5 60-64 21.695 27.815 27.61 22.88 65-69 22.205 27.975 27.16 22.66 70-74 21.69 28.075 27.584999999999997 22.650000000000002 75-79 22.61 27.815 26.895000000000003 22.68 80-84 22.314999999999998 27.765 27.500000000000004 22.42 85-89 22.81 27.625 27.735 21.83 90-94 23.03 27.334999999999997 27.415 22.220000000000002 95-99 22.645 27.565 27.48 22.31 100-104 22.91 28.22 26.895000000000003 21.975 105-109 23.080000000000002 27.775 27.055 22.09 110-114 23.23 27.875 26.75 22.145 115-119 23.22 28.29 26.334999999999997 22.155 120-124 22.615 27.725 26.96 22.7 125-129 23.335 27.139999999999997 27.229999999999997 22.295 130-134 23.06 27.235 26.995 22.71 135-139 23.62 27.765 26.58 22.035 140-144 23.155 27.694999999999997 26.745 22.405 145-149 23.47 27.534999999999997 26.47 22.525000000000002 150 22.5 28.1 26.525 22.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 4.0 26 5.0 27 4.5 28 7.0 29 10.5 30 14.5 31 21.0 32 29.5 33 36.5 34 46.5 35 63.0 36 74.0 37 97.5 38 139.0 39 176.0 40 208.5 41 214.0 42 210.5 43 237.5 44 274.0 45 281.0 46 259.0 47 248.5 48 245.0 49 202.0 50 171.0 51 147.5 52 113.5 53 97.5 54 78.5 55 57.5 56 44.5 57 40.5 58 32.0 59 20.5 60 14.0 61 12.5 62 11.5 63 10.0 64 7.0 65 6.0 66 3.5 67 2.0 68 2.5 69 3.0 70 4.0 71 2.5 72 1.0 73 1.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 48.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.9 #Duplication Level Percentage of deduplicated Percentage of total 1 91.86615886833515 84.425 2 7.453754080522307 13.700000000000001 3 0.6800870511425462 1.875 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.8500000000000001 0.0 0.0 0.0 0.0 116-117 0.9875 0.0 0.0 0.0 0.0 118-119 1.05 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.2000000000000002 0.0 0.0 0.0 0.0 124-125 1.325 0.0 0.0 0.0 0.0 126-127 1.5125000000000002 0.0 0.0 0.0 0.0 128-129 1.7375 0.0 0.0 0.0 0.0 130-131 1.925 0.0 0.0 0.0 0.0 132-133 2.1375 0.0 0.0 0.0 0.0 134-135 2.4000000000000004 0.0 0.0 0.0 0.0 136-137 2.6875 0.0 0.0 0.0 0.0 138 2.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGTGG 10 0.0070428792 143.525 4 AGAGAGT 10 0.0070428792 143.525 2 GTGGAGT 10 0.0070428792 143.525 7 GGAGTAC 10 0.0070428792 143.525 9 >>END_MODULE Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649169 spots for SRR11611371.sra Written 649169 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra Read 649158 spots for SRR11611371.sra Written 649158 spots for SRR11611371.sra SRR ids: ['SRR11611371.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xy3fnhnb SRR11611371.sra spots: 12983171 blocks: [[1, 649158], [649159, 1298316], [1298317, 1947474], [1947475, 2596632], [2596633, 3245790], [3245791, 3894948], [3894949, 4544106], [4544107, 5193264], [5193265, 5842422], [5842423, 6491580], [6491581, 7140738], [7140739, 7789896], [7789897, 8439054], [8439055, 9088212], [9088213, 9737370], [9737371, 10386528], [10386529, 11035686], [11035687, 11684844], [11684845, 12334002], [12334003, 12983171]] SRR11611371 file size 4365191 SRR11611371 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11611371 SRR11611371_1.fastq SRR11611371_2.fastq Input file: SRR11611371_1.fastq Paired file: SRR11611371_2.fastq trimmed: SRR11611371-trimmed-pair1.fastq, SRR11611371-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:15:43 2025 >> started Tue Feb 11 00:15:57 2025 >> done (14.022s) 12983171 read pairs processed; of these: 1472 ( 0.01%) short read pairs filtered out after trimming by size control 3618 ( 0.03%) empty read pairs filtered out after trimming by size control 12978081 (99.96%) read pairs available; of these: 574878 ( 4.43%) trimmed read pairs available after processing 12403203 (95.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 138 0.00% 19 126 0.00% 20 118 0.00% 21 127 0.00% 22 82 0.00% 23 137 0.00% 24 126 0.00% 25 144 0.00% 26 173 0.00% 27 130 0.00% 28 137 0.00% 29 153 0.00% 30 190 0.00% 31 143 0.00% 32 170 0.00% 33 150 0.00% 34 149 0.00% 35 160 0.00% 36 173 0.00% 37 179 0.00% 38 187 0.00% 39 167 0.00% 40 183 0.00% 41 226 0.00% 42 193 0.00% 43 233 0.00% 44 210 0.00% 45 204 0.00% 46 200 0.00% 47 223 0.00% 48 200 0.00% 49 239 0.00% 50 234 0.00% 51 253 0.00% 52 288 0.00% 53 266 0.00% 54 250 0.00% 55 268 0.00% 56 261 0.00% 57 286 0.00% 58 255 0.00% 59 292 0.00% 60 273 0.00% 61 336 0.00% 62 405 0.00% 63 375 0.00% 64 370 0.00% 65 346 0.00% 66 335 0.00% 67 347 0.00% 68 364 0.00% 69 433 0.00% 70 393 0.00% 71 482 0.00% 72 633 0.00% 73 662 0.01% 74 635 0.00% 75 538 0.00% 76 513 0.00% 77 536 0.00% 78 515 0.00% 79 680 0.01% 80 731 0.01% 81 869 0.01% 82 968 0.01% 83 1147 0.01% 84 1238 0.01% 85 1201 0.01% 86 1137 0.01% 87 1069 0.01% 88 1132 0.01% 89 1165 0.01% 90 1333 0.01% 91 1621 0.01% 92 1759 0.01% 93 2302 0.02% 94 2549 0.02% 95 2615 0.02% 96 2667 0.02% 97 2392 0.02% 98 2335 0.02% 99 2494 0.02% 100 2611 0.02% 101 3094 0.02% 102 3598 0.03% 103 4265 0.03% 104 4890 0.04% 105 5177 0.04% 106 5191 0.04% 107 4905 0.04% 108 4664 0.04% 109 4713 0.04% 110 4973 0.04% 111 5256 0.04% 112 6160 0.05% 113 6911 0.05% 114 7946 0.06% 115 8854 0.07% 116 8679 0.07% 117 8324 0.06% 118 8105 0.06% 119 7734 0.06% 120 7847 0.06% 121 8023 0.06% 122 8986 0.07% 123 10045 0.08% 124 11506 0.09% 125 12337 0.10% 126 12581 0.10% 127 12750 0.10% 128 11701 0.09% 129 11001 0.08% 130 10587 0.08% 131 10797 0.08% 132 11291 0.09% 133 12719 0.10% 134 14138 0.11% 135 15420 0.12% 136 15741 0.12% 137 15704 0.12% 138 15101 0.12% 139 14256 0.11% 140 14010 0.11% 141 13383 0.10% 142 13920 0.11% 143 14761 0.11% 144 16316 0.13% 145 17801 0.14% 146 18729 0.14% 147 19017 0.15% 148 18117 0.14% 149 20325 0.16% 150 12403203 95.57% 12978081 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=3.86 fanout-score-rank=28 prefix-density=0.13 prefix-fanout=2.9 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=159.05 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=20.4 sequence=GCAGCAGCAACAA criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=3.98 fanout-score-rank=29 prefix-density=0.13 prefix-fanout=2.9 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=13 fanout-score=262.03 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=30.7 sequence=AAGAAGAAGAAA SRR11611371 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:16:47 Started mapping on | Feb 11 00:16:47 Finished on | Feb 11 00:18:17 Mapping speed, Million of reads per hour | 519.12 Number of input reads | 12978081 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11851109 Uniquely mapped reads % | 91.32% Average mapped length | 296.35 Number of splices: Total | 10866893 Number of splices: Annotated (sjdb) | 10703858 Number of splices: GT/AG | 10698242 Number of splices: GC/AG | 136182 Number of splices: AT/AC | 7860 Number of splices: Non-canonical | 24609 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.81 Insertion rate per base | 0.01% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 349967 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 386968 % of reads mapped to too many loci | 2.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.45% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 777005 777005 777005 N_multimapping 349967 349967 349967 N_noFeature 350729 6120024 6010571 N_ambiguous 135140 31686 32480 UnstrandedReadsAssigned:11365240 PositiveStrandReadsAssigned:5699399 NegativeStrandReadsAssigned:5808058 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11611371 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11611371-trimmed-pair1.fastq SRR11611371-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,978,081 reads, 12,118,752 reads pseudoaligned [quant] estimated average fragment length: 266.601 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR11611371.ke.tsv 34699 SRR11611371.se.tsv 87100 total ==> SRR11611371.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.4 548 26.9368 Potri.005G024800.1.v4.1 1035 769.399 216 24.1825 Potri.004G059700.1.v4.1 961 695.399 16 1.98192 Potri.007G009000.2.v4.1 1416 1150.4 0 0 Potri.003G141000.2.v4.1 2943 2677.4 476 15.3141 Potri.016G087400.1.v4.1 270 66.6537 634 819.34 Potri.015G069301.1.v4.1 564 298.534 0 0 Potri.010G195200.1.v4.1 1773 1507.4 15 0.85716 Potri.012G127500.1.v4.1 977 711.399 2840 343.878 ==> SRR11611371.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 817 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 145 Potri.001G212900.v4.1 15 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 87 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR11611371 completed mapping pipeline successfully