Starting /dee2/code/volunteer_pipeline.sh SRR11611372 current disk space = 3057359679488 free memory = 1183329696 SRR11611372 SRAfilesize 85e450da4a3ea53841556f802ac7b3d9 SRR11611372.sra SRR11611372.sra file validated SRR11611372 is paired end SRR11611372 is conventional basespace SRR11611372 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611372_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.27375 32.0 32.0 32.0 2.0 32.0 2 31.6275 32.0 32.0 32.0 32.0 32.0 3 34.7275 37.0 32.0 37.0 32.0 37.0 4 36.22125 37.0 37.0 37.0 32.0 37.0 5 36.335 37.0 37.0 37.0 37.0 37.0 6 39.09175 41.0 41.0 41.0 37.0 41.0 7 39.747 41.0 41.0 41.0 37.0 41.0 8 39.98675 41.0 41.0 41.0 37.0 41.0 9 40.15325 41.0 41.0 41.0 37.0 41.0 10-14 39.90455000000001 41.0 41.0 41.0 37.0 41.0 15-19 40.0466 41.0 41.0 41.0 37.0 41.0 20-24 39.99250000000001 41.0 41.0 41.0 37.0 41.0 25-29 38.841699999999996 41.0 40.2 41.0 33.0 41.0 30-34 39.5347 41.0 41.0 41.0 37.0 41.0 35-39 39.55525 41.0 41.0 41.0 37.0 41.0 40-44 38.983 41.0 41.0 41.0 35.0 41.0 45-49 39.26305 41.0 41.0 41.0 35.0 41.0 50-54 39.38269999999999 41.0 41.0 41.0 36.0 41.0 55-59 39.3214 41.0 41.0 41.0 37.0 41.0 60-64 39.471700000000006 41.0 41.0 41.0 37.0 41.0 65-69 39.38485 41.0 41.0 41.0 36.0 41.0 70-74 39.36375 41.0 41.0 41.0 37.0 41.0 75-79 39.12474999999999 41.0 40.2 41.0 36.0 41.0 80-84 39.726150000000004 41.0 41.0 41.0 37.0 41.0 85-89 38.9083 41.0 40.2 41.0 34.0 41.0 90-94 39.49204999999999 41.0 41.0 41.0 37.0 41.0 95-99 39.044650000000004 41.0 41.0 41.0 34.0 41.0 100-104 39.005199999999995 41.0 41.0 41.0 34.0 41.0 105-109 38.8964 41.0 40.2 41.0 33.0 41.0 110-114 38.6993 41.0 40.2 41.0 34.0 41.0 115-119 39.268100000000004 41.0 41.0 41.0 36.0 41.0 120-124 38.19515 41.0 38.6 41.0 31.0 41.0 125-129 39.19304999999999 41.0 41.0 41.0 36.0 41.0 130-134 38.6487 41.0 40.2 41.0 33.0 41.0 135-139 38.5963 41.0 41.0 41.0 32.0 41.0 140-144 38.290499999999994 41.0 40.2 41.0 31.0 41.0 145-149 38.7394 41.0 41.0 41.0 32.0 41.0 150 38.05775 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 1.0 22 2.0 23 1.0 24 3.0 25 8.0 26 6.0 27 14.0 28 21.0 29 31.0 30 47.0 31 66.0 32 64.0 33 67.0 34 90.0 35 108.0 36 155.0 37 188.0 38 248.0 39 451.0 40 2426.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.997607655502392 15.460526315789474 17.105263157894736 35.4366028708134 2 21.425 20.4 34.925 23.25 3 22.25 24.45 29.849999999999998 23.45 4 24.8 28.799999999999997 21.45 24.95 5 24.8 32.025 22.7 20.474999999999998 6 19.575 35.9 24.05 20.474999999999998 7 17.325 19.875 42.375 20.424999999999997 8 20.1 24.099999999999998 28.7 27.1 9 20.724999999999998 24.275 29.825000000000003 25.174999999999997 10-14 20.79 28.525 27.26 23.425 15-19 21.66 27.950000000000003 27.884999999999998 22.505 20-24 21.46 28.555000000000003 27.425 22.56 25-29 22.275 27.095000000000002 27.98 22.650000000000002 30-34 21.8 28.42 27.11 22.67 35-39 22.375 28.015 27.755000000000003 21.855 40-44 22.49 27.92 27.334999999999997 22.255 45-49 22.005 27.689999999999998 27.284999999999997 23.02 50-54 21.81 28.01 27.275 22.905 55-59 21.72 28.005000000000003 27.250000000000004 23.025000000000002 60-64 21.63 28.095 27.845 22.43 65-69 22.275 28.17 27.150000000000002 22.405 70-74 21.709999999999997 28.005000000000003 27.515 22.770000000000003 75-79 21.775 27.389999999999997 27.975 22.86 80-84 22.17 27.884999999999998 27.235 22.71 85-89 22.400000000000002 28.215 27.075 22.31 90-94 22.18 28.12 26.985 22.715 95-99 22.335 28.09 27.279999999999998 22.295 100-104 22.52 28.000000000000004 27.05 22.43 105-109 22.41 27.88 27.6 22.11 110-114 23.13 27.675 26.715 22.48 115-119 22.08 27.775 27.384999999999998 22.759999999999998 120-124 22.935 27.744999999999997 26.424999999999997 22.895 125-129 22.965 27.63 26.450000000000003 22.955000000000002 130-134 22.29 28.43 26.565 22.715 135-139 22.185 27.705000000000002 27.32 22.79 140-144 23.07 27.57 26.695 22.665 145-149 22.42 27.875 27.455000000000002 22.25 150 22.05 28.000000000000004 26.474999999999998 23.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 4.5 27 4.0 28 5.0 29 10.5 30 17.5 31 20.0 32 22.5 33 30.0 34 42.0 35 59.5 36 79.5 37 97.5 38 124.5 39 157.0 40 186.5 41 222.5 42 242.5 43 259.0 44 283.5 45 281.0 46 279.0 47 247.5 48 209.5 49 202.0 50 176.5 51 151.0 52 128.0 53 104.5 54 80.0 55 55.0 56 39.5 57 35.5 58 29.0 59 23.0 60 18.5 61 13.0 62 11.5 63 8.5 64 5.5 65 5.5 66 5.0 67 3.5 68 4.5 69 5.0 70 2.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 16.400000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.525 #Duplication Level Percentage of deduplicated Percentage of total 1 90.49986191659762 81.925 2 8.588787627727147 15.55 3 0.8561170947252139 2.325 4 0.055233360950013806 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.9 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.625 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.8875000000000002 0.0 0.0 0.0 0.0 128-129 2.0375 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.7125 0.0 0.0 0.0 0.0 138 2.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGCGA 10 0.006997227 143.8375 7 >>END_MODULE SRR11611372 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611372_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 15.92625 2.0 2.0 32.0 2.0 32.0 2 31.28625 32.0 32.0 32.0 32.0 32.0 3 31.07625 32.0 32.0 37.0 12.0 37.0 4 32.55375 37.0 32.0 37.0 27.0 37.0 5 35.5 37.0 37.0 37.0 32.0 37.0 6 36.892 41.0 37.0 41.0 27.0 41.0 7 37.0235 41.0 37.0 41.0 27.0 41.0 8 37.99125 41.0 37.0 41.0 32.0 41.0 9 39.1085 41.0 41.0 41.0 37.0 41.0 10-14 39.2838 41.0 41.0 41.0 37.0 41.0 15-19 38.963 41.0 41.0 41.0 35.0 41.0 20-24 37.192750000000004 41.0 36.6 41.0 26.0 41.0 25-29 38.5466 41.0 40.2 41.0 33.0 41.0 30-34 39.10005 41.0 41.0 41.0 36.0 41.0 35-39 38.17895 41.0 40.2 41.0 30.0 41.0 40-44 38.90755 41.0 41.0 41.0 35.0 41.0 45-49 38.7438 41.0 41.0 41.0 35.0 41.0 50-54 37.80965 41.0 37.8 41.0 28.0 41.0 55-59 37.864700000000006 41.0 38.6 41.0 29.0 41.0 60-64 38.54025 41.0 39.4 41.0 32.0 41.0 65-69 38.134100000000004 41.0 39.4 41.0 30.0 41.0 70-74 37.88175 41.0 38.6 41.0 30.0 41.0 75-79 37.085100000000004 41.0 36.0 41.0 27.0 41.0 80-84 37.5202 41.0 37.6 41.0 27.0 41.0 85-89 36.70465 41.0 35.0 41.0 24.0 41.0 90-94 37.349849999999996 41.0 37.0 41.0 26.0 41.0 95-99 36.134550000000004 40.2 34.0 41.0 24.0 41.0 100-104 36.42285 41.0 35.0 41.0 24.0 41.0 105-109 35.16435 38.4 31.0 41.0 23.0 41.0 110-114 36.058800000000005 40.2 35.0 41.0 23.0 41.0 115-119 35.55075 41.0 34.0 41.0 18.0 41.0 120-124 36.908100000000005 41.0 37.0 41.0 25.0 41.0 125-129 36.34925 41.0 37.0 41.0 23.0 41.0 130-134 35.4457 38.6 34.0 41.0 19.0 41.0 135-139 35.06945 40.2 32.0 41.0 18.0 41.0 140-144 36.82185 41.0 37.0 41.0 25.0 41.0 145-149 36.00085 40.2 36.0 41.0 21.0 41.0 150 36.593 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 2.0 19 5.0 20 8.0 21 17.0 22 14.0 23 32.0 24 28.0 25 44.0 26 47.0 27 56.0 28 73.0 29 88.0 30 89.0 31 95.0 32 116.0 33 111.0 34 121.0 35 160.0 36 194.0 37 278.0 38 394.0 39 717.0 40 1308.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.29831932773109 15.336134453781513 17.594537815126053 33.77100840336135 2 22.1 21.525 33.85 22.525000000000002 3 25.275 24.2 28.349999999999998 22.175 4 26.25 28.625 20.875 24.25 5 23.200000000000003 34.425 23.724999999999998 18.65 6 19.225 35.675000000000004 25.7 19.400000000000002 7 18.475 18.25 42.65 20.625 8 19.650000000000002 22.275 30.525000000000002 27.55 9 21.275 23.400000000000002 31.4 23.925 10-14 22.105 29.07 26.51 22.314999999999998 15-19 22.195 28.335 27.12 22.35 20-24 22.625 28.38 26.55 22.445 25-29 22.25 28.265 26.66 22.825 30-34 21.55 27.575 27.76 23.115 35-39 22.365 28.08 26.779999999999998 22.775000000000002 40-44 22.365 28.04 27.88 21.715 45-49 22.445 27.74 27.485 22.33 50-54 22.85 27.67 27.325 22.155 55-59 22.175 27.965 27.07 22.79 60-64 22.055 27.72 27.52 22.705000000000002 65-69 22.33 27.894999999999996 27.345000000000002 22.43 70-74 22.264999999999997 27.57 27.685 22.48 75-79 22.555 27.255000000000003 27.32 22.869999999999997 80-84 22.405 27.485 27.55 22.56 85-89 22.48 27.339999999999996 27.575 22.605 90-94 22.125 27.925 27.065 22.884999999999998 95-99 22.535 27.175 27.83 22.46 100-104 23.0 27.560000000000002 26.97 22.470000000000002 105-109 23.53 27.565 27.0 21.905 110-114 23.244999999999997 27.785 27.284999999999997 21.685 115-119 22.935 27.284999999999997 27.0 22.78 120-124 22.985 27.595 27.060000000000002 22.36 125-129 22.68 27.439999999999998 27.83 22.05 130-134 23.01 27.224999999999998 27.29 22.475 135-139 23.405 27.089999999999996 27.57 21.935 140-144 22.705000000000002 27.93 27.455000000000002 21.91 145-149 23.549999999999997 27.700000000000003 26.995 21.755 150 23.849999999999998 28.299999999999997 26.075 21.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 3.0 27 8.0 28 9.0 29 8.5 30 14.0 31 21.0 32 23.0 33 32.0 34 53.5 35 65.5 36 69.5 37 92.5 38 129.0 39 161.0 40 186.5 41 205.5 42 231.0 43 265.5 44 262.5 45 270.0 46 286.0 47 271.5 48 246.0 49 205.5 50 171.0 51 133.5 52 109.0 53 100.5 54 82.0 55 61.5 56 50.0 57 40.5 58 27.0 59 16.0 60 13.0 61 15.5 62 15.0 63 10.0 64 6.0 65 3.5 66 3.0 67 4.0 68 3.5 69 2.5 70 2.0 71 0.5 72 1.0 73 1.5 74 1.5 75 1.5 76 1.0 77 1.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 52.400000000000006 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.2 #Duplication Level Percentage of deduplicated Percentage of total 1 92.24511930585683 85.05 2 7.077006507592191 13.05 3 0.6507592190889371 1.7999999999999998 4 0.027114967462039046 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0875 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.2625 0.0 0.0 0.0 0.0 120-121 1.3625 0.0 0.0 0.0 0.0 122-123 1.5750000000000002 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.8875000000000002 0.0 0.0 0.0 0.0 128-129 2.0375 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.4124999999999996 0.0 0.0 0.0 0.0 134-135 2.5375 0.0 0.0 0.0 0.0 136-137 2.6875 0.0 0.0 0.0 0.0 138 2.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCACGC 10 7.882311E-4 294.33334 1 CACGCAC 10 0.0070483834 143.4875 3 ACGCACA 10 0.0070483834 143.4875 4 AACTTTG 10 0.0070483834 143.4875 5 TAACTGA 10 0.0070483834 143.4875 3 GCACAAC 10 0.0070483834 143.4875 6 >>END_MODULE Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699563 spots for SRR11611372.sra Written 699563 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra Read 699553 spots for SRR11611372.sra Written 699553 spots for SRR11611372.sra SRR ids: ['SRR11611372.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j0hiadt0 SRR11611372.sra spots: 13991070 blocks: [[1, 699553], [699554, 1399106], [1399107, 2098659], [2098660, 2798212], [2798213, 3497765], [3497766, 4197318], [4197319, 4896871], [4896872, 5596424], [5596425, 6295977], [6295978, 6995530], [6995531, 7695083], [7695084, 8394636], [8394637, 9094189], [9094190, 9793742], [9793743, 10493295], [10493296, 11192848], [11192849, 11892401], [11892402, 12591954], [12591955, 13291507], [13291508, 13991070]] SRR11611372 file size 4705751 SRR11611372 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11611372 SRR11611372_1.fastq SRR11611372_2.fastq Input file: SRR11611372_1.fastq Paired file: SRR11611372_2.fastq trimmed: SRR11611372-trimmed-pair1.fastq, SRR11611372-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:51:22 2025 >> started Tue Feb 11 00:51:38 2025 >> done (16.190s) 13991070 read pairs processed; of these: 1594 ( 0.01%) short read pairs filtered out after trimming by size control 5385 ( 0.04%) empty read pairs filtered out after trimming by size control 13984091 (99.95%) read pairs available; of these: 677203 ( 4.84%) trimmed read pairs available after processing 13306888 (95.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 119 0.00% 19 87 0.00% 20 104 0.00% 21 141 0.00% 22 124 0.00% 23 123 0.00% 24 138 0.00% 25 164 0.00% 26 155 0.00% 27 173 0.00% 28 158 0.00% 29 175 0.00% 30 183 0.00% 31 174 0.00% 32 199 0.00% 33 161 0.00% 34 197 0.00% 35 194 0.00% 36 178 0.00% 37 189 0.00% 38 192 0.00% 39 228 0.00% 40 242 0.00% 41 195 0.00% 42 238 0.00% 43 231 0.00% 44 263 0.00% 45 251 0.00% 46 285 0.00% 47 236 0.00% 48 269 0.00% 49 268 0.00% 50 304 0.00% 51 316 0.00% 52 274 0.00% 53 317 0.00% 54 299 0.00% 55 292 0.00% 56 304 0.00% 57 336 0.00% 58 320 0.00% 59 332 0.00% 60 353 0.00% 61 366 0.00% 62 429 0.00% 63 461 0.00% 64 408 0.00% 65 405 0.00% 66 401 0.00% 67 378 0.00% 68 428 0.00% 69 432 0.00% 70 495 0.00% 71 540 0.00% 72 705 0.01% 73 751 0.01% 74 682 0.00% 75 730 0.01% 76 675 0.00% 77 640 0.00% 78 627 0.00% 79 764 0.01% 80 778 0.01% 81 948 0.01% 82 1067 0.01% 83 1396 0.01% 84 1458 0.01% 85 1504 0.01% 86 1390 0.01% 87 1380 0.01% 88 1308 0.01% 89 1426 0.01% 90 1557 0.01% 91 1968 0.01% 92 2221 0.02% 93 2684 0.02% 94 3198 0.02% 95 3257 0.02% 96 3096 0.02% 97 2964 0.02% 98 2855 0.02% 99 2957 0.02% 100 3192 0.02% 101 3800 0.03% 102 4371 0.03% 103 5207 0.04% 104 5957 0.04% 105 6246 0.04% 106 6107 0.04% 107 5854 0.04% 108 5594 0.04% 109 5574 0.04% 110 5799 0.04% 111 6401 0.05% 112 7250 0.05% 113 8383 0.06% 114 9801 0.07% 115 10540 0.08% 116 10260 0.07% 117 10100 0.07% 118 9454 0.07% 119 9208 0.07% 120 9124 0.07% 121 9664 0.07% 122 10607 0.08% 123 11796 0.08% 124 13284 0.09% 125 14391 0.10% 126 14627 0.10% 127 14650 0.10% 128 13792 0.10% 129 12930 0.09% 130 12471 0.09% 131 12832 0.09% 132 13385 0.10% 133 14922 0.11% 134 16665 0.12% 135 18296 0.13% 136 18364 0.13% 137 18595 0.13% 138 17716 0.13% 139 16728 0.12% 140 16060 0.11% 141 15660 0.11% 142 16504 0.12% 143 17490 0.13% 144 19204 0.14% 145 20545 0.15% 146 21350 0.15% 147 22254 0.16% 148 21437 0.15% 149 23552 0.17% 150 13306888 95.16% 13984091 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=4.28 fanout-score-rank=27 prefix-density=0.14 prefix-fanout=3.1 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=196.12 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=24.1 sequence=AGCAGCAGCAGC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=3.93 fanout-score-rank=34 prefix-density=0.12 prefix-fanout=2.9 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=161.12 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=24.3 sequence=CAGCAGCAGCAA SRR11611372 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:52:21 Started mapping on | Feb 11 00:52:21 Finished on | Feb 11 00:53:48 Mapping speed, Million of reads per hour | 578.65 Number of input reads | 13984091 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12852632 Uniquely mapped reads % | 91.91% Average mapped length | 296.27 Number of splices: Total | 11967477 Number of splices: Annotated (sjdb) | 11785292 Number of splices: GT/AG | 11777242 Number of splices: GC/AG | 154433 Number of splices: AT/AC | 8914 Number of splices: Non-canonical | 26888 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.80 Insertion rate per base | 0.01% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 348437 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 390703 % of reads mapped to too many loci | 2.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.29% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 783022 783022 783022 N_multimapping 348437 348437 348437 N_noFeature 384007 6600743 6556748 N_ambiguous 145282 33041 33379 UnstrandedReadsAssigned:12323343 PositiveStrandReadsAssigned:6218848 NegativeStrandReadsAssigned:6262505 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11611372 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11611372-trimmed-pair1.fastq SRR11611372-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,984,091 reads, 13,052,806 reads pseudoaligned [quant] estimated average fragment length: 262.341 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR11611372.ke.tsv 34699 SRR11611372.se.tsv 87100 total ==> SRR11611372.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.66 559 25.8316 Potri.005G024800.1.v4.1 1035 773.659 157 16.4732 Potri.004G059700.1.v4.1 961 699.659 15 1.74033 Potri.007G009000.2.v4.1 1416 1154.66 0 0 Potri.003G141000.2.v4.1 2943 2681.66 460 13.9246 Potri.016G087400.1.v4.1 270 68.111 612 729.394 Potri.015G069301.1.v4.1 564 302.857 0 0 Potri.010G195200.1.v4.1 1773 1511.66 28 1.5036 Potri.012G127500.1.v4.1 977 715.659 3306 374.994 ==> SRR11611372.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 826 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 163 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 174 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR11611372 completed mapping pipeline successfully