Starting /dee2/code/volunteer_pipeline.sh SRR11611373 current disk space = 3057397952512 free memory = 1468783536 SRR11611373 SRAfilesize 2dee3d79e74f31ddb10388dcdb544a35 SRR11611373.sra SRR11611373.sra file validated SRR11611373 is paired end SRR11611373 is conventional basespace SRR11611373 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611373_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.60875 32.0 32.0 32.0 2.0 32.0 2 31.6375 32.0 32.0 32.0 32.0 32.0 3 34.85875 37.0 32.0 37.0 32.0 37.0 4 36.28125 37.0 37.0 37.0 32.0 37.0 5 36.3775 37.0 37.0 37.0 37.0 37.0 6 39.2555 41.0 41.0 41.0 37.0 41.0 7 39.867 41.0 41.0 41.0 37.0 41.0 8 40.1045 41.0 41.0 41.0 37.0 41.0 9 40.203 41.0 41.0 41.0 37.0 41.0 10-14 39.9591 41.0 41.0 41.0 37.0 41.0 15-19 40.12555 41.0 41.0 41.0 37.0 41.0 20-24 40.13265 41.0 41.0 41.0 37.0 41.0 25-29 39.03574999999999 41.0 40.2 41.0 34.0 41.0 30-34 39.6229 41.0 41.0 41.0 37.0 41.0 35-39 39.623949999999994 41.0 41.0 41.0 37.0 41.0 40-44 39.195550000000004 41.0 41.0 41.0 36.0 41.0 45-49 39.40925 41.0 41.0 41.0 36.0 41.0 50-54 39.50645 41.0 41.0 41.0 36.0 41.0 55-59 39.319900000000004 41.0 41.0 41.0 37.0 41.0 60-64 39.5117 41.0 41.0 41.0 37.0 41.0 65-69 39.5568 41.0 41.0 41.0 37.0 41.0 70-74 39.3741 41.0 41.0 41.0 36.0 41.0 75-79 39.18575 41.0 40.2 41.0 36.0 41.0 80-84 39.7357 41.0 41.0 41.0 37.0 41.0 85-89 39.02685 41.0 40.2 41.0 34.0 41.0 90-94 39.563100000000006 41.0 41.0 41.0 37.0 41.0 95-99 39.15894999999999 41.0 41.0 41.0 34.0 41.0 100-104 39.07000000000001 41.0 41.0 41.0 35.0 41.0 105-109 38.9574 41.0 40.2 41.0 33.0 41.0 110-114 38.81545 41.0 40.2 41.0 34.0 41.0 115-119 39.354 41.0 41.0 41.0 37.0 41.0 120-124 38.36005 41.0 38.6 41.0 31.0 41.0 125-129 39.28435 41.0 41.0 41.0 37.0 41.0 130-134 38.8359 41.0 40.2 41.0 35.0 41.0 135-139 38.64075 41.0 41.0 41.0 33.0 41.0 140-144 38.2992 41.0 40.2 41.0 31.0 41.0 145-149 38.816050000000004 41.0 41.0 41.0 32.0 41.0 150 38.37425 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 0.0 21 0.0 22 1.0 23 2.0 24 4.0 25 7.0 26 10.0 27 21.0 28 11.0 29 28.0 30 32.0 31 54.0 32 59.0 33 80.0 34 83.0 35 105.0 36 132.0 37 182.0 38 264.0 39 453.0 40 2470.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.788665879574975 16.76505312868949 16.558441558441558 34.887839433293976 2 22.275 19.925 36.075 21.725 3 25.0 22.6 29.825000000000003 22.575 4 24.5 26.900000000000002 23.125 25.474999999999998 5 23.875 33.7 22.525000000000002 19.900000000000002 6 20.45 34.949999999999996 24.3 20.3 7 16.975 19.35 43.325 20.349999999999998 8 19.1 22.725 30.775000000000002 27.400000000000002 9 20.625 24.0 29.549999999999997 25.825 10-14 21.19 30.044999999999998 27.295 21.47 15-19 21.515 28.73 27.189999999999998 22.564999999999998 20-24 21.67 28.410000000000004 27.529999999999998 22.39 25-29 22.189999999999998 28.16 27.655 21.995 30-34 21.91 28.449999999999996 26.955000000000002 22.685 35-39 21.81 28.384999999999998 27.33 22.475 40-44 21.67 27.765 28.105000000000004 22.46 45-49 21.099999999999998 28.07 27.57 23.26 50-54 21.7 28.315 27.450000000000003 22.535 55-59 21.795 27.675 27.395000000000003 23.135 60-64 21.740000000000002 27.589999999999996 28.299999999999997 22.37 65-69 21.55 27.935 27.955000000000002 22.56 70-74 21.735 27.939999999999998 27.495000000000005 22.830000000000002 75-79 22.095000000000002 27.584999999999997 27.384999999999998 22.935 80-84 21.745 27.91 27.365000000000002 22.98 85-89 21.875 27.93 27.265 22.93 90-94 21.735 28.24 27.534999999999997 22.49 95-99 22.134999999999998 27.98 27.215 22.67 100-104 21.515 28.585 26.650000000000002 23.25 105-109 21.805 27.51 28.02 22.665 110-114 21.645 28.110000000000003 27.82 22.425 115-119 22.275 27.450000000000003 27.735 22.54 120-124 22.0 27.495000000000005 27.925 22.58 125-129 21.78 27.805000000000003 27.785 22.63 130-134 22.32 28.050000000000004 26.815 22.814999999999998 135-139 22.105 28.28 26.665 22.95 140-144 22.009999999999998 28.415000000000003 27.05 22.525000000000002 145-149 21.740000000000002 28.4 27.55 22.31 150 21.0 28.625 27.325 23.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 2.0 24 2.0 25 2.5 26 3.0 27 3.0 28 7.0 29 12.5 30 15.0 31 23.5 32 30.0 33 33.5 34 47.5 35 67.5 36 96.0 37 106.0 38 124.5 39 170.0 40 196.0 41 203.5 42 223.5 43 245.0 44 261.5 45 285.5 46 283.0 47 252.0 48 230.5 49 201.5 50 166.0 51 155.0 52 131.0 53 93.5 54 64.5 55 50.0 56 46.0 57 33.5 58 26.5 59 24.5 60 17.0 61 8.5 62 8.0 63 7.5 64 6.0 65 8.5 66 8.0 67 6.0 68 2.0 69 0.5 70 1.0 71 2.0 72 2.5 73 1.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 15.299999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.75 #Duplication Level Percentage of deduplicated Percentage of total 1 89.88857938718662 80.675 2 8.969359331476323 16.1 3 0.9749303621169917 2.625 4 0.1671309192200557 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.23750000000000002 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8500000000000001 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.625 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 2.0375 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.525 0.0 0.0 0.0 0.0 132-133 2.7125 0.0 0.0 0.0 0.0 134-135 2.925 0.0 0.0 0.0 0.0 136-137 3.125 0.0 0.0 0.0 0.0 138 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTTCA 10 0.0069954093 143.85 4 >>END_MODULE SRR11611373 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611373_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.27 27.0 2.0 32.0 2.0 32.0 2 31.2275 32.0 32.0 32.0 32.0 32.0 3 31.0675 32.0 32.0 37.0 12.0 37.0 4 32.785 37.0 32.0 37.0 27.0 37.0 5 35.555 37.0 37.0 37.0 32.0 37.0 6 36.833 41.0 37.0 41.0 27.0 41.0 7 37.155 41.0 37.0 41.0 27.0 41.0 8 37.86825 41.0 37.0 41.0 32.0 41.0 9 39.0555 41.0 41.0 41.0 37.0 41.0 10-14 39.132 41.0 41.0 41.0 35.0 41.0 15-19 38.853899999999996 41.0 41.0 41.0 35.0 41.0 20-24 37.1238 41.0 36.6 41.0 28.0 41.0 25-29 38.45265 41.0 40.2 41.0 32.0 41.0 30-34 38.9973 41.0 41.0 41.0 35.0 41.0 35-39 38.12415 41.0 40.2 41.0 31.0 41.0 40-44 38.7432 41.0 41.0 41.0 35.0 41.0 45-49 38.69655 41.0 41.0 41.0 35.0 41.0 50-54 37.751400000000004 41.0 37.8 41.0 28.0 41.0 55-59 37.8409 41.0 38.6 41.0 28.0 41.0 60-64 38.3859 41.0 39.4 41.0 32.0 41.0 65-69 38.137800000000006 41.0 39.4 41.0 30.0 41.0 70-74 37.8352 41.0 38.6 41.0 29.0 41.0 75-79 37.00685 41.0 36.0 41.0 27.0 41.0 80-84 37.45435 41.0 36.8 41.0 27.0 41.0 85-89 36.66700000000001 41.0 36.0 41.0 24.0 41.0 90-94 37.237 41.0 37.0 41.0 25.0 41.0 95-99 36.0952 40.2 34.0 41.0 21.0 41.0 100-104 36.35975 41.0 35.0 41.0 23.0 41.0 105-109 35.07925 38.4 31.0 41.0 23.0 41.0 110-114 36.17755 40.2 35.0 41.0 22.0 41.0 115-119 35.543 41.0 34.0 41.0 18.0 41.0 120-124 36.73605 41.0 35.0 41.0 25.0 41.0 125-129 36.238150000000005 41.0 37.0 41.0 22.0 41.0 130-134 35.40345000000001 39.4 34.0 41.0 18.0 41.0 135-139 35.045049999999996 40.2 32.0 41.0 18.0 41.0 140-144 36.825900000000004 41.0 37.0 41.0 25.0 41.0 145-149 35.98010000000001 40.2 36.0 41.0 21.0 41.0 150 36.4345 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 1.0 18 8.0 19 9.0 20 11.0 21 18.0 22 33.0 23 22.0 24 34.0 25 33.0 26 56.0 27 61.0 28 79.0 29 74.0 30 72.0 31 98.0 32 106.0 33 120.0 34 124.0 35 161.0 36 198.0 37 251.0 38 377.0 39 684.0 40 1368.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.663797226207556 15.925394548063126 18.41224294595887 32.99856527977044 2 21.3 22.0 34.35 22.35 3 23.075000000000003 25.45 29.099999999999998 22.375 4 25.900000000000002 28.325 21.65 24.125 5 24.099999999999998 32.75 23.549999999999997 19.6 6 19.675 36.1 24.05 20.175 7 18.224999999999998 19.8 40.925 21.05 8 18.575 23.65 30.325000000000003 27.450000000000003 9 20.5 24.375 30.25 24.875 10-14 20.855 29.315 27.365000000000002 22.465 15-19 21.91 28.405 27.615000000000002 22.07 20-24 22.42 27.76 27.310000000000002 22.509999999999998 25-29 21.47 28.82 28.005000000000003 21.705 30-34 21.61 28.084999999999997 27.845 22.46 35-39 22.105 27.785 27.544999999999998 22.564999999999998 40-44 21.365000000000002 28.83 27.61 22.195 45-49 21.98 27.560000000000002 27.87 22.59 50-54 22.525000000000002 27.48 27.71 22.285 55-59 22.485 28.03 27.405 22.08 60-64 21.465 28.37 27.865000000000002 22.3 65-69 21.54 28.24 27.485 22.735 70-74 21.98 27.750000000000004 27.765 22.505 75-79 22.325 28.18 27.01 22.485 80-84 21.615000000000002 28.194999999999997 27.725 22.465 85-89 22.285 27.975 27.525 22.215 90-94 21.66 27.255000000000003 28.21 22.875 95-99 23.115 27.99 27.134999999999998 21.759999999999998 100-104 22.225 27.815 27.825 22.134999999999998 105-109 23.185 28.43 26.66 21.725 110-114 22.189999999999998 27.744999999999997 27.685 22.38 115-119 22.935 27.74 27.500000000000004 21.825 120-124 22.42 27.66 27.655 22.264999999999997 125-129 23.02 27.555000000000003 27.084999999999997 22.34 130-134 23.465 27.384999999999998 27.735 21.415 135-139 23.3 28.349999999999998 27.27 21.08 140-144 23.385 28.335 26.840000000000003 21.44 145-149 23.385 27.384999999999998 27.529999999999998 21.7 150 24.025 28.325 26.1 21.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 2.0 24 3.0 25 4.0 26 6.0 27 6.5 28 5.5 29 11.5 30 20.5 31 21.0 32 21.5 33 34.5 34 54.5 35 65.5 36 86.0 37 119.0 38 153.5 39 175.0 40 193.5 41 227.5 42 248.0 43 270.5 44 271.5 45 256.0 46 247.0 47 242.5 48 229.5 49 201.5 50 163.5 51 132.0 52 118.5 53 96.0 54 68.0 55 51.5 56 43.5 57 34.0 58 24.5 59 16.0 60 14.5 61 11.0 62 6.5 63 8.0 64 8.0 65 4.5 66 2.5 67 2.5 68 4.0 69 3.0 70 1.5 71 1.0 72 2.5 73 2.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 47.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 91.78007621121394 84.3 2 7.593903102885139 13.950000000000001 3 0.5988023952095809 1.6500000000000001 4 0.027218290691344585 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.7250000000000001 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.2625 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.8 0.0 0.0 0.0 0.0 126-127 2.0625 0.0 0.0 0.0 0.0 128-129 2.3375 0.0 0.0 0.0 0.0 130-131 2.575 0.0 0.0 0.0 0.0 132-133 2.7625 0.0 0.0 0.0 0.0 134-135 2.9625 0.0 0.0 0.0 0.0 136-137 3.2 0.0 0.0 0.0 0.0 138 3.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629117 spots for SRR11611373.sra Written 629117 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra Read 629116 spots for SRR11611373.sra Written 629116 spots for SRR11611373.sra SRR ids: ['SRR11611373.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rbo2k1pz SRR11611373.sra spots: 12582321 blocks: [[1, 629116], [629117, 1258232], [1258233, 1887348], [1887349, 2516464], [2516465, 3145580], [3145581, 3774696], [3774697, 4403812], [4403813, 5032928], [5032929, 5662044], [5662045, 6291160], [6291161, 6920276], [6920277, 7549392], [7549393, 8178508], [8178509, 8807624], [8807625, 9436740], [9436741, 10065856], [10065857, 10694972], [10694973, 11324088], [11324089, 11953204], [11953205, 12582321]] SRR11611373 file size 4229747 SRR11611373 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11611373 SRR11611373_1.fastq SRR11611373_2.fastq Input file: SRR11611373_1.fastq Paired file: SRR11611373_2.fastq trimmed: SRR11611373-trimmed-pair1.fastq, SRR11611373-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:55:21 2025 >> started Tue Feb 11 00:55:35 2025 >> done (14.550s) 12582321 read pairs processed; of these: 1194 ( 0.01%) short read pairs filtered out after trimming by size control 2533 ( 0.02%) empty read pairs filtered out after trimming by size control 12578594 (99.97%) read pairs available; of these: 534913 ( 4.25%) trimmed read pairs available after processing 12043681 (95.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 82 0.00% 19 102 0.00% 20 92 0.00% 21 97 0.00% 22 88 0.00% 23 116 0.00% 24 93 0.00% 25 117 0.00% 26 121 0.00% 27 130 0.00% 28 121 0.00% 29 119 0.00% 30 143 0.00% 31 139 0.00% 32 159 0.00% 33 135 0.00% 34 129 0.00% 35 144 0.00% 36 174 0.00% 37 177 0.00% 38 168 0.00% 39 156 0.00% 40 181 0.00% 41 190 0.00% 42 217 0.00% 43 225 0.00% 44 219 0.00% 45 188 0.00% 46 238 0.00% 47 202 0.00% 48 237 0.00% 49 246 0.00% 50 254 0.00% 51 238 0.00% 52 266 0.00% 53 222 0.00% 54 271 0.00% 55 293 0.00% 56 283 0.00% 57 228 0.00% 58 276 0.00% 59 316 0.00% 60 317 0.00% 61 347 0.00% 62 338 0.00% 63 368 0.00% 64 388 0.00% 65 369 0.00% 66 342 0.00% 67 342 0.00% 68 370 0.00% 69 429 0.00% 70 415 0.00% 71 514 0.00% 72 591 0.00% 73 575 0.00% 74 609 0.00% 75 619 0.00% 76 531 0.00% 77 577 0.00% 78 545 0.00% 79 640 0.01% 80 711 0.01% 81 830 0.01% 82 1005 0.01% 83 1135 0.01% 84 1260 0.01% 85 1248 0.01% 86 1166 0.01% 87 1140 0.01% 88 1150 0.01% 89 1161 0.01% 90 1408 0.01% 91 1591 0.01% 92 1981 0.02% 93 2356 0.02% 94 2578 0.02% 95 2702 0.02% 96 2561 0.02% 97 2543 0.02% 98 2471 0.02% 99 2440 0.02% 100 2698 0.02% 101 2997 0.02% 102 3538 0.03% 103 4230 0.03% 104 4939 0.04% 105 5181 0.04% 106 5087 0.04% 107 4953 0.04% 108 4584 0.04% 109 4539 0.04% 110 4795 0.04% 111 5139 0.04% 112 5968 0.05% 113 6712 0.05% 114 7718 0.06% 115 8339 0.07% 116 8442 0.07% 117 7903 0.06% 118 7409 0.06% 119 7152 0.06% 120 7322 0.06% 121 7381 0.06% 122 8224 0.07% 123 9599 0.08% 124 10570 0.08% 125 11286 0.09% 126 11472 0.09% 127 11487 0.09% 128 10726 0.09% 129 10321 0.08% 130 9705 0.08% 131 10000 0.08% 132 10709 0.09% 133 11396 0.09% 134 13019 0.10% 135 14090 0.11% 136 14170 0.11% 137 14126 0.11% 138 13637 0.11% 139 13123 0.10% 140 12357 0.10% 141 12578 0.10% 142 13051 0.10% 143 13482 0.11% 144 14567 0.12% 145 15658 0.12% 146 16587 0.13% 147 16840 0.13% 148 16103 0.13% 149 18749 0.15% 150 12043681 95.75% 12578594 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=6.27 fanout-score-rank=27 prefix-density=0.13 prefix-fanout=3.8 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=9 fanout-score=316.35 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=33.5 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=4.06 fanout-score-rank=31 prefix-density=0.11 prefix-fanout=2.9 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=13 fanout-score=420.70 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=36.6 sequence=TTCTTCTTCTTT SRR11611373 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:56:22 Started mapping on | Feb 11 00:56:22 Finished on | Feb 11 00:58:05 Mapping speed, Million of reads per hour | 439.64 Number of input reads | 12578594 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11455922 Uniquely mapped reads % | 91.07% Average mapped length | 296.45 Number of splices: Total | 11066813 Number of splices: Annotated (sjdb) | 10893851 Number of splices: GT/AG | 10881905 Number of splices: GC/AG | 150240 Number of splices: AT/AC | 8521 Number of splices: Non-canonical | 26147 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.78 Insertion rate per base | 0.01% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437590 % of reads mapped to multiple loci | 3.48% Number of reads mapped to too many loci | 294406 % of reads mapped to too many loci | 2.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.64% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 685082 685082 685082 N_multimapping 437590 437590 437590 N_noFeature 350115 5919781 5828163 N_ambiguous 121847 31457 32570 UnstrandedReadsAssigned:10983960 PositiveStrandReadsAssigned:5504684 NegativeStrandReadsAssigned:5595189 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11611373 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11611373-trimmed-pair1.fastq SRR11611373-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,578,594 reads, 11,686,651 reads pseudoaligned [quant] estimated average fragment length: 273.992 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR11611373.ke.tsv 34699 SRR11611373.se.tsv 87100 total ==> SRR11611373.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.01 412 19.8571 Potri.005G024800.1.v4.1 1035 762.008 113 12.472 Potri.004G059700.1.v4.1 961 688.008 32 3.91176 Potri.007G009000.2.v4.1 1416 1143.01 1 0.0735811 Potri.003G141000.2.v4.1 2943 2670.01 490 15.4347 Potri.016G087400.1.v4.1 270 66.9853 599 752.078 Potri.015G069301.1.v4.1 564 291.271 0 0 Potri.010G195200.1.v4.1 1773 1500.01 34 1.90634 Potri.012G127500.1.v4.1 977 704.008 5534 661.115 ==> SRR11611373.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 329 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 168 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 529 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR11611373 completed mapping pipeline successfully