Starting /dee2/code/volunteer_pipeline.sh SRR11611374 current disk space = 3057350676480 free memory = 1163688096 SRR11611374 SRAfilesize 8ba5eec80d57a7d0c9ef62cbb5335e12 SRR11611374.sra SRR11611374.sra file validated SRR11611374 is paired end SRR11611374 is conventional basespace SRR11611374 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611374_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.54125 32.0 32.0 32.0 2.0 32.0 2 31.58 32.0 32.0 32.0 32.0 32.0 3 34.96 37.0 32.0 37.0 32.0 37.0 4 36.2875 37.0 37.0 37.0 32.0 37.0 5 36.39375 37.0 37.0 37.0 37.0 37.0 6 39.0105 41.0 41.0 41.0 32.0 41.0 7 39.65375 41.0 41.0 41.0 37.0 41.0 8 39.98625 41.0 41.0 41.0 37.0 41.0 9 40.12925 41.0 41.0 41.0 37.0 41.0 10-14 39.83735 41.0 41.0 41.0 37.0 41.0 15-19 40.00825 41.0 41.0 41.0 37.0 41.0 20-24 40.0061 41.0 41.0 41.0 37.0 41.0 25-29 38.91085 41.0 40.2 41.0 33.0 41.0 30-34 39.5292 41.0 41.0 41.0 37.0 41.0 35-39 39.4755 41.0 41.0 41.0 37.0 41.0 40-44 39.03795000000001 41.0 41.0 41.0 36.0 41.0 45-49 39.275200000000005 41.0 41.0 41.0 35.0 41.0 50-54 39.3665 41.0 41.0 41.0 36.0 41.0 55-59 39.2035 41.0 41.0 41.0 36.0 41.0 60-64 39.329750000000004 41.0 41.0 41.0 37.0 41.0 65-69 39.303 41.0 41.0 41.0 36.0 41.0 70-74 39.23085 41.0 41.0 41.0 36.0 41.0 75-79 38.943 41.0 40.2 41.0 36.0 41.0 80-84 39.59905 41.0 41.0 41.0 37.0 41.0 85-89 38.86535 41.0 40.2 41.0 34.0 41.0 90-94 39.396249999999995 41.0 41.0 41.0 37.0 41.0 95-99 39.044850000000004 41.0 41.0 41.0 34.0 41.0 100-104 38.94605 41.0 41.0 41.0 34.0 41.0 105-109 38.822 41.0 40.2 41.0 33.0 41.0 110-114 38.64725 41.0 40.2 41.0 33.0 41.0 115-119 39.1384 41.0 41.0 41.0 36.0 41.0 120-124 38.233 41.0 38.6 41.0 31.0 41.0 125-129 39.114 41.0 41.0 41.0 35.0 41.0 130-134 38.6291 41.0 40.2 41.0 33.0 41.0 135-139 38.5602 41.0 40.2 41.0 32.0 41.0 140-144 38.20985 41.0 40.2 41.0 31.0 41.0 145-149 38.5774 41.0 41.0 41.0 32.0 41.0 150 38.19525 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 0.0 23 4.0 24 7.0 25 2.0 26 9.0 27 15.0 28 27.0 29 34.0 30 40.0 31 61.0 32 79.0 33 66.0 34 108.0 35 118.0 36 150.0 37 181.0 38 222.0 39 436.0 40 2438.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.217985202048947 16.1923733636881 18.29823562891292 34.29140580535003 2 20.4 21.2 35.125 23.275000000000002 3 22.75 23.5 29.925 23.825 4 26.450000000000003 26.575 22.225 24.75 5 24.75 32.375 24.474999999999998 18.4 6 19.55 36.75 22.475 21.224999999999998 7 17.45 19.725 43.2 19.625 8 19.0 24.05 29.075 27.875 9 20.575 25.0 29.825000000000003 24.6 10-14 22.0 29.17 26.71 22.12 15-19 21.27 27.98 27.99 22.759999999999998 20-24 22.02 28.025 27.485 22.470000000000002 25-29 21.765 28.165000000000003 27.435 22.634999999999998 30-34 21.73 28.585 27.694999999999997 21.990000000000002 35-39 22.11 27.939999999999998 27.015 22.935 40-44 21.985 28.255000000000003 27.42 22.34 45-49 22.0 27.91 27.639999999999997 22.45 50-54 21.85 28.299999999999997 27.47 22.38 55-59 22.42 27.555000000000003 27.98 22.045 60-64 22.134999999999998 27.11 27.584999999999997 23.169999999999998 65-69 22.650000000000002 27.900000000000002 27.005000000000003 22.445 70-74 21.95 28.000000000000004 27.185 22.865 75-79 22.115000000000002 27.779999999999998 27.689999999999998 22.415 80-84 22.040000000000003 27.71 27.255000000000003 22.994999999999997 85-89 22.21 27.655 27.224999999999998 22.91 90-94 22.085 27.935 26.865 23.115 95-99 21.68 28.63 27.060000000000002 22.63 100-104 22.365 28.34 26.825 22.470000000000002 105-109 22.16 28.294999999999998 27.075 22.470000000000002 110-114 22.314999999999998 27.615000000000002 27.245 22.825 115-119 22.685 27.935 27.084999999999997 22.295 120-124 22.25 27.889999999999997 27.785 22.075 125-129 22.564999999999998 27.694999999999997 27.3 22.439999999999998 130-134 23.14 26.875 27.389999999999997 22.595000000000002 135-139 22.38 27.37 28.000000000000004 22.25 140-144 22.66 27.189999999999998 27.52 22.63 145-149 22.335 28.044999999999998 27.08 22.54 150 23.225 28.525 25.974999999999998 22.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.5 25 3.0 26 4.0 27 5.0 28 5.5 29 8.5 30 14.0 31 21.5 32 23.5 33 35.5 34 52.5 35 70.5 36 86.5 37 99.0 38 139.0 39 177.0 40 172.0 41 203.0 42 240.0 43 254.0 44 266.5 45 263.5 46 262.0 47 240.5 48 226.5 49 209.5 50 178.5 51 137.0 52 105.0 53 94.5 54 85.0 55 66.0 56 53.5 57 46.0 58 32.0 59 22.0 60 17.0 61 13.5 62 8.5 63 9.0 64 10.5 65 9.0 66 5.5 67 2.5 68 1.5 69 1.0 70 1.0 71 1.0 72 2.0 73 3.5 74 2.0 75 2.0 76 3.0 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.425 #Duplication Level Percentage of deduplicated Percentage of total 1 89.46044171093095 80.0 2 9.337433603578418 16.7 3 1.118255521386637 3.0 4 0.08386916410399776 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.2000000000000002 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.65 0.0 0.0 0.0 0.0 128-129 1.7875 0.0 0.0 0.0 0.0 130-131 1.9625 0.0 0.0 0.0 0.0 132-133 2.0999999999999996 0.0 0.0 0.0 0.0 134-135 2.425 0.0 0.0 0.0 0.0 136-137 2.6125 0.0 0.0 0.0 0.0 138 2.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11611374 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611374_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.10625 32.0 2.0 32.0 2.0 32.0 2 31.19 32.0 32.0 32.0 32.0 32.0 3 31.535 32.0 32.0 37.0 27.0 37.0 4 32.7925 37.0 32.0 37.0 27.0 37.0 5 35.29375 37.0 37.0 37.0 32.0 37.0 6 36.95475 41.0 37.0 41.0 27.0 41.0 7 37.2735 41.0 37.0 41.0 27.0 41.0 8 37.86025 41.0 37.0 41.0 32.0 41.0 9 38.96425 41.0 41.0 41.0 37.0 41.0 10-14 39.056999999999995 41.0 41.0 41.0 35.0 41.0 15-19 38.70805 41.0 40.2 41.0 34.0 41.0 20-24 37.028949999999995 41.0 36.6 41.0 25.0 41.0 25-29 38.3121 41.0 40.2 41.0 32.0 41.0 30-34 38.85625 41.0 41.0 41.0 35.0 41.0 35-39 37.9516 41.0 39.2 41.0 28.0 41.0 40-44 38.7218 41.0 41.0 41.0 35.0 41.0 45-49 38.5055 41.0 40.2 41.0 32.0 41.0 50-54 37.54455 41.0 37.8 41.0 28.0 41.0 55-59 37.6221 41.0 38.6 41.0 28.0 41.0 60-64 38.24905 41.0 38.6 41.0 31.0 41.0 65-69 37.96565 41.0 39.4 41.0 30.0 41.0 70-74 37.738600000000005 41.0 37.8 41.0 28.0 41.0 75-79 36.8688 41.0 36.0 41.0 25.0 41.0 80-84 37.3163 41.0 36.8 41.0 26.0 41.0 85-89 36.728049999999996 41.0 36.0 41.0 24.0 41.0 90-94 37.2235 41.0 37.0 41.0 25.0 41.0 95-99 36.14095 40.2 34.0 41.0 21.0 41.0 100-104 36.35175 41.0 36.0 41.0 23.0 41.0 105-109 35.1323 38.4 33.0 41.0 22.0 41.0 110-114 36.190099999999994 40.2 35.0 41.0 23.0 41.0 115-119 35.56385 41.0 34.0 41.0 16.0 41.0 120-124 36.8995 41.0 37.0 41.0 25.0 41.0 125-129 36.3754 41.0 36.0 41.0 23.0 41.0 130-134 35.3815 39.4 34.0 41.0 19.0 41.0 135-139 35.06395 40.2 32.0 41.0 18.0 41.0 140-144 36.7302 41.0 37.0 41.0 23.0 41.0 145-149 36.0248 41.0 36.0 41.0 21.0 41.0 150 36.4865 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 3.0 19 12.0 20 15.0 21 24.0 22 23.0 23 28.0 24 37.0 25 48.0 26 62.0 27 50.0 28 75.0 29 71.0 30 85.0 31 100.0 32 123.0 33 120.0 34 117.0 35 131.0 36 204.0 37 227.0 38 356.0 39 626.0 40 1461.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.924315619967793 16.908212560386474 16.545893719806763 34.62157809983897 2 21.925 21.475 32.725 23.875 3 23.225 24.275 27.975 24.525 4 24.7 28.325 21.825 25.15 5 24.025 33.975 23.525 18.475 6 21.125 36.225 23.65 19.0 7 18.625 19.15 41.425 20.8 8 19.900000000000002 22.85 30.45 26.8 9 19.575 24.925 30.45 25.05 10-14 21.715 29.54 26.82 21.925 15-19 21.584999999999997 28.365000000000002 27.224999999999998 22.825 20-24 21.985 27.98 27.205000000000002 22.830000000000002 25-29 22.06 27.99 27.584999999999997 22.365 30-34 21.240000000000002 28.055000000000003 28.189999999999998 22.515 35-39 22.175 27.32 27.894999999999996 22.61 40-44 21.865000000000002 28.57 27.229999999999997 22.335 45-49 22.015 27.67 27.27 23.044999999999998 50-54 21.57 27.865000000000002 27.825 22.74 55-59 22.125 26.87 28.21 22.795 60-64 22.32 27.575 27.395000000000003 22.71 65-69 22.46 27.950000000000003 27.200000000000003 22.39 70-74 21.46 28.355000000000004 27.115000000000002 23.07 75-79 22.205 27.994999999999997 27.405 22.395 80-84 21.975 27.965 27.73 22.33 85-89 22.62 28.155 26.889999999999997 22.335 90-94 22.81 28.035 27.245 21.91 95-99 22.509999999999998 28.050000000000004 27.375 22.065 100-104 22.37 28.365000000000002 26.995 22.27 105-109 23.65 27.47 26.740000000000002 22.14 110-114 23.044999999999998 27.735 26.815 22.405 115-119 22.395 28.155 27.02 22.43 120-124 22.985 27.834999999999997 26.825 22.355 125-129 23.185 27.165 27.084999999999997 22.564999999999998 130-134 23.11 27.639999999999997 26.8 22.45 135-139 23.29 28.1 26.334999999999997 22.275 140-144 23.215 27.97 27.029999999999998 21.785 145-149 23.205000000000002 27.83 26.93 22.035 150 24.224999999999998 27.275 26.3 22.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 1.5 25 4.0 26 4.0 27 7.5 28 11.5 29 11.0 30 14.5 31 17.5 32 28.0 33 39.5 34 52.0 35 73.0 36 88.0 37 98.5 38 126.5 39 157.0 40 175.0 41 205.5 42 236.0 43 265.0 44 282.5 45 283.5 46 266.0 47 234.0 48 229.5 49 220.5 50 169.5 51 129.0 52 116.0 53 96.0 54 75.0 55 57.0 56 39.0 57 30.0 58 28.0 59 28.0 60 24.5 61 14.0 62 9.5 63 9.5 64 5.5 65 3.0 66 2.5 67 3.0 68 2.5 69 5.5 70 5.0 71 2.5 72 3.5 73 2.5 74 1.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 37.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.125 #Duplication Level Percentage of deduplicated Percentage of total 1 91.19341563786008 83.1 2 7.928669410150892 14.45 3 0.823045267489712 2.25 4 0.054869684499314134 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.075 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.3250000000000002 0.0 0.0 0.0 0.0 122-123 1.525 0.0 0.0 0.0 0.0 124-125 1.6375 0.0 0.0 0.0 0.0 126-127 1.7999999999999998 0.0 0.0 0.0 0.0 128-129 1.9375 0.0 0.0 0.0 0.0 130-131 2.075 0.0 0.0 0.0 0.0 132-133 2.2375 0.0 0.0 0.0 0.0 134-135 2.575 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138 2.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCAAG 10 0.0070282277 143.625 6 >>END_MODULE Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490585 spots for SRR11611374.sra Written 490585 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra Read 490584 spots for SRR11611374.sra Written 490584 spots for SRR11611374.sra SRR ids: ['SRR11611374.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dnzk33t8 SRR11611374.sra spots: 9811681 blocks: [[1, 490584], [490585, 981168], [981169, 1471752], [1471753, 1962336], [1962337, 2452920], [2452921, 2943504], [2943505, 3434088], [3434089, 3924672], [3924673, 4415256], [4415257, 4905840], [4905841, 5396424], [5396425, 5887008], [5887009, 6377592], [6377593, 6868176], [6868177, 7358760], [7358761, 7849344], [7849345, 8339928], [8339929, 8830512], [8830513, 9321096], [9321097, 9811681]] SRR11611374 file size 3293942 SRR11611374 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11611374 SRR11611374_1.fastq SRR11611374_2.fastq Input file: SRR11611374_1.fastq Paired file: SRR11611374_2.fastq trimmed: SRR11611374-trimmed-pair1.fastq, SRR11611374-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:49:56 2025 >> started Tue Feb 11 00:50:08 2025 >> done (11.893s) 9811681 read pairs processed; of these: 922 ( 0.01%) short read pairs filtered out after trimming by size control 1852 ( 0.02%) empty read pairs filtered out after trimming by size control 9808907 (99.97%) read pairs available; of these: 409388 ( 4.17%) trimmed read pairs available after processing 9399519 (95.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 80 0.00% 19 77 0.00% 20 70 0.00% 21 71 0.00% 22 88 0.00% 23 79 0.00% 24 90 0.00% 25 69 0.00% 26 111 0.00% 27 90 0.00% 28 84 0.00% 29 102 0.00% 30 113 0.00% 31 109 0.00% 32 107 0.00% 33 122 0.00% 34 110 0.00% 35 109 0.00% 36 132 0.00% 37 115 0.00% 38 159 0.00% 39 122 0.00% 40 143 0.00% 41 142 0.00% 42 149 0.00% 43 172 0.00% 44 166 0.00% 45 155 0.00% 46 139 0.00% 47 171 0.00% 48 162 0.00% 49 173 0.00% 50 215 0.00% 51 215 0.00% 52 211 0.00% 53 174 0.00% 54 195 0.00% 55 225 0.00% 56 191 0.00% 57 212 0.00% 58 195 0.00% 59 204 0.00% 60 224 0.00% 61 242 0.00% 62 284 0.00% 63 262 0.00% 64 280 0.00% 65 256 0.00% 66 260 0.00% 67 271 0.00% 68 258 0.00% 69 249 0.00% 70 310 0.00% 71 307 0.00% 72 415 0.00% 73 458 0.00% 74 405 0.00% 75 378 0.00% 76 374 0.00% 77 396 0.00% 78 439 0.00% 79 470 0.00% 80 452 0.00% 81 582 0.01% 82 632 0.01% 83 778 0.01% 84 833 0.01% 85 803 0.01% 86 812 0.01% 87 796 0.01% 88 775 0.01% 89 896 0.01% 90 887 0.01% 91 1153 0.01% 92 1357 0.01% 93 1497 0.02% 94 1667 0.02% 95 1812 0.02% 96 1785 0.02% 97 1717 0.02% 98 1655 0.02% 99 1731 0.02% 100 1952 0.02% 101 2262 0.02% 102 2547 0.03% 103 3031 0.03% 104 3358 0.03% 105 3657 0.04% 106 3596 0.04% 107 3420 0.03% 108 3401 0.03% 109 3468 0.04% 110 3461 0.04% 111 3864 0.04% 112 4339 0.04% 113 5010 0.05% 114 5660 0.06% 115 6131 0.06% 116 6285 0.06% 117 5970 0.06% 118 5427 0.06% 119 5349 0.05% 120 5703 0.06% 121 5859 0.06% 122 6287 0.06% 123 7165 0.07% 124 8114 0.08% 125 8626 0.09% 126 9008 0.09% 127 8577 0.09% 128 8321 0.08% 129 7800 0.08% 130 7521 0.08% 131 7758 0.08% 132 8462 0.09% 133 9187 0.09% 134 10251 0.10% 135 10879 0.11% 136 11106 0.11% 137 11148 0.11% 138 10774 0.11% 139 10201 0.10% 140 10056 0.10% 141 9791 0.10% 142 9848 0.10% 143 10842 0.11% 144 11576 0.12% 145 12909 0.13% 146 13426 0.14% 147 13231 0.13% 148 12999 0.13% 149 14799 0.15% 150 9399519 95.83% 9808907 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=48 prefix-density=0.00 prefix-fanout=1.0 sequence=CGATGTTTAATTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=579.48 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=32.0 sequence=CTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.98 fanout-score-rank=30 prefix-density=0.10 prefix-fanout=3.0 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=11 fanout-score=359.08 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=34.6 sequence=TTCTTCTTCTTT SRR11611374 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:50:52 Started mapping on | Feb 11 00:50:52 Finished on | Feb 11 00:52:24 Mapping speed, Million of reads per hour | 383.83 Number of input reads | 9808907 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 8763052 Uniquely mapped reads % | 89.34% Average mapped length | 296.54 Number of splices: Total | 8475923 Number of splices: Annotated (sjdb) | 8343030 Number of splices: GT/AG | 8336878 Number of splices: GC/AG | 112683 Number of splices: AT/AC | 6465 Number of splices: Non-canonical | 19897 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.77 Insertion rate per base | 0.01% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385711 % of reads mapped to multiple loci | 3.93% Number of reads mapped to too many loci | 342081 % of reads mapped to too many loci | 3.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.57% % of reads unmapped: other | 0.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 660144 660144 660144 N_multimapping 385711 385711 385711 N_noFeature 287869 4547544 4459846 N_ambiguous 92068 24092 24682 UnstrandedReadsAssigned:8383115 PositiveStrandReadsAssigned:4191416 NegativeStrandReadsAssigned:4278524 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11611374 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11611374-trimmed-pair1.fastq SRR11611374-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,808,907 reads, 9,092,807 reads pseudoaligned [quant] estimated average fragment length: 271.849 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,019 rounds 52401 SRR11611374.ke.tsv 34699 SRR11611374.se.tsv 87100 total ==> SRR11611374.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.15 386 22.8007 Potri.005G024800.1.v4.1 1035 764.151 130 17.5572 Potri.004G059700.1.v4.1 961 690.159 29 4.33651 Potri.007G009000.2.v4.1 1416 1145.15 1 0.0901214 Potri.003G141000.2.v4.1 2943 2672.15 451 17.4183 Potri.016G087400.1.v4.1 270 65.8382 421 659.926 Potri.015G069301.1.v4.1 564 293.393 0 0 Potri.010G195200.1.v4.1 1773 1502.15 25 1.71758 Potri.012G127500.1.v4.1 977 706.159 3693 539.719 ==> SRR11611374.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 205 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 112 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 399 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 0 SRR11611374 completed mapping pipeline successfully