Starting /dee2/code/volunteer_pipeline.sh SRR11611375 current disk space = 3057399087104 free memory = 1016096180 SRR11611375 SRAfilesize 2afe2f55af9ff948e11a85f6887f49bc SRR11611375.sra SRR11611375.sra file validated SRR11611375 is paired end SRR11611375 is conventional basespace SRR11611375 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611375_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.3375 32.0 32.0 32.0 2.0 32.0 2 31.6825 32.0 32.0 32.0 32.0 32.0 3 34.82375 37.0 32.0 37.0 32.0 37.0 4 36.23875 37.0 37.0 37.0 32.0 37.0 5 36.29 37.0 37.0 37.0 37.0 37.0 6 39.06 41.0 41.0 41.0 37.0 41.0 7 39.69575 41.0 41.0 41.0 37.0 41.0 8 39.99025 41.0 41.0 41.0 37.0 41.0 9 40.09675 41.0 41.0 41.0 37.0 41.0 10-14 39.8996 41.0 41.0 41.0 37.0 41.0 15-19 40.091699999999996 41.0 41.0 41.0 37.0 41.0 20-24 40.081 41.0 41.0 41.0 37.0 41.0 25-29 38.90585 41.0 40.2 41.0 33.0 41.0 30-34 39.562349999999995 41.0 41.0 41.0 37.0 41.0 35-39 39.575599999999994 41.0 41.0 41.0 37.0 41.0 40-44 39.10235 41.0 41.0 41.0 36.0 41.0 45-49 39.219550000000005 41.0 41.0 41.0 35.0 41.0 50-54 39.373949999999994 41.0 41.0 41.0 36.0 41.0 55-59 39.26365 41.0 41.0 41.0 37.0 41.0 60-64 39.43835 41.0 41.0 41.0 37.0 41.0 65-69 39.42065 41.0 41.0 41.0 36.0 41.0 70-74 39.364850000000004 41.0 41.0 41.0 37.0 41.0 75-79 39.072950000000006 41.0 40.2 41.0 36.0 41.0 80-84 39.712149999999994 41.0 41.0 41.0 37.0 41.0 85-89 38.89835 41.0 40.2 41.0 34.0 41.0 90-94 39.4882 41.0 41.0 41.0 37.0 41.0 95-99 39.05965 41.0 41.0 41.0 35.0 41.0 100-104 38.95445 41.0 41.0 41.0 34.0 41.0 105-109 38.88825 41.0 40.2 41.0 33.0 41.0 110-114 38.7445 41.0 40.2 41.0 33.0 41.0 115-119 39.17925 41.0 41.0 41.0 35.0 41.0 120-124 38.2008 41.0 38.6 41.0 32.0 41.0 125-129 39.15585 41.0 41.0 41.0 36.0 41.0 130-134 38.6709 41.0 40.2 41.0 33.0 41.0 135-139 38.66145 41.0 41.0 41.0 32.0 41.0 140-144 38.32695 41.0 40.2 41.0 31.0 41.0 145-149 38.76505 41.0 41.0 41.0 33.0 41.0 150 38.23625 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 1.0 20 0.0 21 1.0 22 4.0 23 5.0 24 8.0 25 8.0 26 16.0 27 13.0 28 22.0 29 26.0 30 33.0 31 35.0 32 64.0 33 66.0 34 107.0 35 104.0 36 144.0 37 203.0 38 258.0 39 465.0 40 2415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.95380923815237 16.316736652669466 17.126574685062987 35.60287942411517 2 22.025 20.200000000000003 35.5 22.275 3 21.75 22.8 31.225 24.224999999999998 4 23.724999999999998 26.950000000000003 22.825 26.5 5 24.75 32.25 23.05 19.950000000000003 6 19.425 36.175000000000004 23.775 20.625 7 16.35 19.05 42.125 22.475 8 18.675 24.65 28.999999999999996 27.675 9 20.9 24.474999999999998 30.575000000000003 24.05 10-14 21.325 29.81 26.52 22.345000000000002 15-19 22.105 27.74 27.18 22.975 20-24 21.975 27.845 27.575 22.605 25-29 21.66 28.46 26.75 23.13 30-34 21.63 28.294999999999998 27.21 22.865 35-39 20.93 28.62 27.105 23.345 40-44 21.98 28.12 27.405 22.495 45-49 21.39 27.994999999999997 27.46 23.155 50-54 22.09 27.38 28.044999999999998 22.485 55-59 21.36 28.075 27.665 22.900000000000002 60-64 22.1 27.27 28.23 22.400000000000002 65-69 21.845 28.689999999999998 27.0 22.465 70-74 21.715 27.85 27.395000000000003 23.04 75-79 22.15 27.839999999999996 27.839999999999996 22.17 80-84 21.884999999999998 28.199999999999996 27.855 22.06 85-89 22.345000000000002 28.02 27.21 22.425 90-94 22.42 28.78 26.445 22.355 95-99 22.24 28.24 26.77 22.75 100-104 22.650000000000002 27.1 27.245 23.005 105-109 21.685 28.78 27.365000000000002 22.17 110-114 22.155 28.09 27.525 22.23 115-119 21.995 28.115000000000002 27.48 22.41 120-124 22.93 27.62 27.175 22.275 125-129 22.06 27.589999999999996 27.495000000000005 22.855 130-134 22.27 27.36 27.71 22.66 135-139 21.765 28.315 27.235 22.685 140-144 22.689999999999998 27.365000000000002 27.474999999999998 22.470000000000002 145-149 22.185 28.225 26.674999999999997 22.915 150 22.125 28.675 26.700000000000003 22.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 1.5 25 1.5 26 4.5 27 6.5 28 5.0 29 9.0 30 14.5 31 18.5 32 25.0 33 35.0 34 49.0 35 59.5 36 76.0 37 99.5 38 121.5 39 159.0 40 193.0 41 214.0 42 231.5 43 268.5 44 285.0 45 263.5 46 260.5 47 258.0 48 225.5 49 191.0 50 174.0 51 156.0 52 128.0 53 107.0 54 87.0 55 64.0 56 46.5 57 31.5 58 23.5 59 21.5 60 19.5 61 12.5 62 9.0 63 6.0 64 5.0 65 3.5 66 2.5 67 8.0 68 6.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 16.650000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 90.61898211829435 82.35 2 8.775790921595599 15.950000000000001 3 0.5502063273727648 1.5 4 0.055020632737276476 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.0750000000000002 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.6375000000000002 0.0 0.0 0.0 0.0 128-129 1.8375 0.0 0.0 0.0 0.0 130-131 2.025 0.0 0.0 0.0 0.0 132-133 2.1 0.0 0.0 0.0 0.0 134-135 2.2375 0.0 0.0 0.0 0.0 136-137 2.4 0.0 0.0 0.0 0.0 138 2.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11611375 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11611375_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.735 12.0 2.0 32.0 2.0 32.0 2 31.18625 32.0 32.0 32.0 32.0 32.0 3 31.20875 32.0 32.0 37.0 27.0 37.0 4 32.5375 37.0 32.0 37.0 27.0 37.0 5 35.23125 37.0 37.0 37.0 32.0 37.0 6 36.85625 41.0 37.0 41.0 27.0 41.0 7 36.90425 41.0 37.0 41.0 27.0 41.0 8 37.8685 41.0 37.0 41.0 32.0 41.0 9 39.00925 41.0 41.0 41.0 37.0 41.0 10-14 39.04325000000001 41.0 41.0 41.0 35.0 41.0 15-19 38.81759999999999 41.0 41.0 41.0 34.0 41.0 20-24 37.10465 41.0 36.6 41.0 28.0 41.0 25-29 38.3273 41.0 40.2 41.0 32.0 41.0 30-34 38.8768 41.0 40.2 41.0 34.0 41.0 35-39 37.96355 41.0 39.2 41.0 28.0 41.0 40-44 38.70035 41.0 41.0 41.0 35.0 41.0 45-49 38.4827 41.0 40.2 41.0 31.0 41.0 50-54 37.5678 41.0 37.8 41.0 28.0 41.0 55-59 37.49444999999999 41.0 38.6 41.0 27.0 41.0 60-64 38.1554 41.0 38.6 41.0 31.0 41.0 65-69 37.8329 41.0 39.4 41.0 29.0 41.0 70-74 37.6768 41.0 37.0 41.0 28.0 41.0 75-79 36.69769999999999 40.2 36.0 41.0 25.0 41.0 80-84 37.215149999999994 41.0 36.8 41.0 26.0 41.0 85-89 36.4305 41.0 35.0 41.0 23.0 41.0 90-94 37.013850000000005 41.0 37.0 41.0 24.0 41.0 95-99 35.91030000000001 40.2 34.0 41.0 21.0 41.0 100-104 36.19345 41.0 35.0 41.0 23.0 41.0 105-109 34.955799999999996 38.4 31.0 41.0 23.0 41.0 110-114 35.84275 40.2 34.0 41.0 21.0 41.0 115-119 35.21575 40.2 34.0 41.0 16.0 41.0 120-124 36.6155 41.0 35.0 41.0 25.0 41.0 125-129 36.074149999999996 41.0 36.0 41.0 22.0 41.0 130-134 35.145250000000004 38.6 33.0 41.0 18.0 41.0 135-139 34.775850000000005 40.2 32.0 41.0 18.0 41.0 140-144 36.5993 41.0 37.0 41.0 25.0 41.0 145-149 35.8348 40.2 35.0 41.0 21.0 41.0 150 36.20525 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 5.0 19 14.0 20 15.0 21 26.0 22 26.0 23 32.0 24 37.0 25 46.0 26 46.0 27 44.0 28 61.0 29 91.0 30 89.0 31 120.0 32 107.0 33 122.0 34 152.0 35 159.0 36 208.0 37 262.0 38 361.0 39 674.0 40 1300.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.0029732408325 15.411298315163528 15.906838453914768 35.678889990089196 2 22.0 19.45 36.449999999999996 22.1 3 22.925 25.025 28.825 23.225 4 25.650000000000002 28.525 20.825 25.0 5 23.724999999999998 33.2 23.825 19.25 6 20.025000000000002 35.925000000000004 22.425 21.625 7 18.4 19.175 41.75 20.674999999999997 8 18.125 23.575 30.65 27.650000000000002 9 21.0 23.525 31.3 24.175 10-14 21.57 29.299999999999997 27.24 21.89 15-19 21.435000000000002 27.77 28.18 22.615 20-24 22.365 28.58 26.790000000000003 22.264999999999997 25-29 22.040000000000003 27.765 27.794999999999998 22.400000000000002 30-34 21.654999999999998 27.74 28.03 22.575 35-39 21.515 28.415000000000003 27.48 22.59 40-44 22.025 28.465 27.139999999999997 22.37 45-49 22.005 28.165000000000003 27.425 22.405 50-54 21.865000000000002 27.325 27.83 22.98 55-59 22.66 26.985 27.865000000000002 22.49 60-64 21.435000000000002 27.925 28.125 22.515 65-69 22.189999999999998 28.310000000000002 27.505000000000003 21.995 70-74 22.275 27.66 27.589999999999996 22.475 75-79 22.475 27.765 27.644999999999996 22.115000000000002 80-84 22.545 27.175 27.755000000000003 22.525000000000002 85-89 22.115000000000002 28.155 27.295 22.435 90-94 22.25 27.465 27.810000000000002 22.475 95-99 22.725 27.634999999999998 27.279999999999998 22.36 100-104 22.925 27.595 27.365000000000002 22.115000000000002 105-109 23.03 27.915 27.05 22.005 110-114 23.01 27.57 27.279999999999998 22.14 115-119 22.475 27.634999999999998 27.634999999999998 22.255 120-124 22.98 27.77 26.900000000000002 22.35 125-129 22.939999999999998 27.634999999999998 27.189999999999998 22.235 130-134 23.41 27.700000000000003 26.924999999999997 21.965 135-139 23.035 27.82 26.985 22.16 140-144 23.215 27.284999999999997 27.825 21.675 145-149 23.125 27.779999999999998 27.139999999999997 21.955 150 23.625 26.674999999999997 28.299999999999997 21.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.5 24 2.5 25 4.0 26 5.5 27 8.0 28 12.5 29 15.5 30 16.0 31 21.0 32 26.0 33 33.0 34 48.5 35 55.0 36 84.0 37 117.5 38 126.5 39 153.0 40 202.5 41 236.5 42 246.5 43 268.0 44 267.0 45 263.0 46 260.0 47 230.5 48 217.0 49 200.5 50 167.0 51 136.0 52 116.0 53 106.5 54 82.5 55 61.0 56 51.5 57 34.0 58 22.5 59 18.5 60 14.0 61 12.5 62 10.0 63 11.0 64 10.0 65 3.0 66 3.5 67 3.5 68 2.5 69 2.0 70 1.5 71 2.0 72 2.0 73 1.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 49.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.96525515743757 84.7 2 7.51900108577633 13.850000000000001 3 0.4885993485342019 1.35 4 0.02714440825190011 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 0.9125000000000001 0.0 0.0 0.0 0.0 114-115 0.9625 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.1125 0.0 0.0 0.0 0.0 120-121 1.1375 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.4874999999999998 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.8624999999999998 0.0 0.0 0.0 0.0 130-131 2.025 0.0 0.0 0.0 0.0 132-133 2.05 0.0 0.0 0.0 0.0 134-135 2.1875 0.0 0.0 0.0 0.0 136-137 2.375 0.0 0.0 0.0 0.0 138 2.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652497 spots for SRR11611375.sra Written 652497 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra Read 652478 spots for SRR11611375.sra Written 652478 spots for SRR11611375.sra SRR ids: ['SRR11611375.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0i14xnhn SRR11611375.sra spots: 13049579 blocks: [[1, 652478], [652479, 1304956], [1304957, 1957434], [1957435, 2609912], [2609913, 3262390], [3262391, 3914868], [3914869, 4567346], [4567347, 5219824], [5219825, 5872302], [5872303, 6524780], [6524781, 7177258], [7177259, 7829736], [7829737, 8482214], [8482215, 9134692], [9134693, 9787170], [9787171, 10439648], [10439649, 11092126], [11092127, 11744604], [11744605, 12397082], [12397083, 13049579]] SRR11611375 file size 4387630 SRR11611375 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11611375 SRR11611375_1.fastq SRR11611375_2.fastq Input file: SRR11611375_1.fastq Paired file: SRR11611375_2.fastq trimmed: SRR11611375-trimmed-pair1.fastq, SRR11611375-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:53:48 2025 >> started Tue Feb 11 00:54:06 2025 >> done (18.159s) 13049579 read pairs processed; of these: 1410 ( 0.01%) short read pairs filtered out after trimming by size control 2556 ( 0.02%) empty read pairs filtered out after trimming by size control 13045613 (99.97%) read pairs available; of these: 585143 ( 4.49%) trimmed read pairs available after processing 12460470 (95.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 114 0.00% 19 110 0.00% 20 110 0.00% 21 91 0.00% 22 103 0.00% 23 119 0.00% 24 115 0.00% 25 99 0.00% 26 150 0.00% 27 144 0.00% 28 157 0.00% 29 157 0.00% 30 144 0.00% 31 140 0.00% 32 156 0.00% 33 167 0.00% 34 132 0.00% 35 197 0.00% 36 189 0.00% 37 190 0.00% 38 186 0.00% 39 174 0.00% 40 222 0.00% 41 231 0.00% 42 200 0.00% 43 222 0.00% 44 223 0.00% 45 206 0.00% 46 225 0.00% 47 242 0.00% 48 222 0.00% 49 229 0.00% 50 241 0.00% 51 266 0.00% 52 279 0.00% 53 292 0.00% 54 258 0.00% 55 280 0.00% 56 267 0.00% 57 282 0.00% 58 276 0.00% 59 299 0.00% 60 311 0.00% 61 293 0.00% 62 367 0.00% 63 361 0.00% 64 335 0.00% 65 390 0.00% 66 335 0.00% 67 354 0.00% 68 355 0.00% 69 417 0.00% 70 458 0.00% 71 490 0.00% 72 541 0.00% 73 572 0.00% 74 621 0.00% 75 605 0.00% 76 575 0.00% 77 602 0.00% 78 597 0.00% 79 630 0.00% 80 678 0.01% 81 829 0.01% 82 987 0.01% 83 1073 0.01% 84 1221 0.01% 85 1205 0.01% 86 1123 0.01% 87 1004 0.01% 88 1104 0.01% 89 1223 0.01% 90 1287 0.01% 91 1621 0.01% 92 1930 0.01% 93 2227 0.02% 94 2618 0.02% 95 2707 0.02% 96 2634 0.02% 97 2577 0.02% 98 2489 0.02% 99 2510 0.02% 100 2723 0.02% 101 3076 0.02% 102 3734 0.03% 103 4618 0.04% 104 5314 0.04% 105 5405 0.04% 106 5393 0.04% 107 5184 0.04% 108 4842 0.04% 109 4972 0.04% 110 4966 0.04% 111 5397 0.04% 112 6322 0.05% 113 7288 0.06% 114 8398 0.06% 115 9035 0.07% 116 9114 0.07% 117 8773 0.07% 118 8482 0.07% 119 7925 0.06% 120 7838 0.06% 121 8271 0.06% 122 8933 0.07% 123 10146 0.08% 124 11525 0.09% 125 12485 0.10% 126 13073 0.10% 127 12822 0.10% 128 12114 0.09% 129 11154 0.09% 130 10808 0.08% 131 11076 0.08% 132 11706 0.09% 133 12856 0.10% 134 14047 0.11% 135 15561 0.12% 136 16117 0.12% 137 15900 0.12% 138 15370 0.12% 139 14406 0.11% 140 13885 0.11% 141 13790 0.11% 142 13899 0.11% 143 15060 0.12% 144 16164 0.12% 145 18129 0.14% 146 18655 0.14% 147 18959 0.15% 148 18417 0.14% 149 20654 0.16% 150 12460470 95.51% 13045613 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=5.32 fanout-score-rank=27 prefix-density=0.12 prefix-fanout=3.4 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=200.44 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=14.7 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=5.02 fanout-score-rank=28 prefix-density=0.11 prefix-fanout=3.3 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=4 fanout-score=270.44 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=31.0 sequence=AAGAAGAAGAAA SRR11611375 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:54:50 Started mapping on | Feb 11 00:54:51 Finished on | Feb 11 00:56:31 Mapping speed, Million of reads per hour | 469.64 Number of input reads | 13045613 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11752112 Uniquely mapped reads % | 90.08% Average mapped length | 296.31 Number of splices: Total | 11409905 Number of splices: Annotated (sjdb) | 11230977 Number of splices: GT/AG | 11219550 Number of splices: GC/AG | 153983 Number of splices: AT/AC | 9170 Number of splices: Non-canonical | 27202 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.77 Insertion rate per base | 0.01% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 486252 % of reads mapped to multiple loci | 3.73% Number of reads mapped to too many loci | 359397 % of reads mapped to too many loci | 2.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.90% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 807249 807249 807249 N_multimapping 486252 486252 486252 N_noFeature 357484 6073492 5977163 N_ambiguous 123649 32070 32885 UnstrandedReadsAssigned:11270979 PositiveStrandReadsAssigned:5646550 NegativeStrandReadsAssigned:5742064 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11611375 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11611375-trimmed-pair1.fastq SRR11611375-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,045,613 reads, 12,102,439 reads pseudoaligned [quant] estimated average fragment length: 270.843 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR11611375.ke.tsv 34699 SRR11611375.se.tsv 87100 total ==> SRR11611375.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.16 473 21.5007 Potri.005G024800.1.v4.1 1035 765.157 100 10.3854 Potri.004G059700.1.v4.1 961 691.163 25 2.8743 Potri.007G009000.2.v4.1 1416 1146.16 0 0 Potri.003G141000.2.v4.1 2943 2673.16 508 15.1012 Potri.016G087400.1.v4.1 270 67.4206 710 836.831 Potri.015G069301.1.v4.1 564 294.43 0 0 Potri.010G195200.1.v4.1 1773 1503.16 28 1.48022 Potri.012G127500.1.v4.1 977 707.163 5900 662.986 ==> SRR11611375.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 266 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 149 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 514 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 0 SRR11611375 completed mapping pipeline successfully