Starting /dee2/code/volunteer_pipeline.sh SRR1165054 current disk space = 3088705007616 free memory = 1448976988 SRR1165054 SRAfilesize ff44189c8aef41eb24a99d808fc0ea17 SRR1165054.sra SRR1165054.sra file validated SRR1165054 is single end SRR1165054 is conventional basespace SRR1165054 read1 length is 36 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1165054_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.61925 35.0 4.0 39.0 4.0 40.0 2 28.7245 38.0 14.0 40.0 10.0 40.0 3 28.7055 38.0 14.0 40.0 10.0 40.0 4 28.7095 38.0 14.0 40.0 9.0 40.0 5 28.702 38.0 13.0 40.0 9.0 40.0 6 30.2205 38.0 21.0 40.0 11.0 40.0 7 30.01775 38.0 21.0 40.0 12.0 40.0 8 30.00925 38.0 21.0 40.0 11.0 40.0 9 29.7345 37.0 20.0 40.0 10.0 40.0 10 29.98325 38.0 21.0 40.0 11.0 40.0 11 34.23725 38.0 31.0 40.0 27.0 40.0 12 34.16875 38.0 31.0 40.0 27.0 40.0 13 34.00325 38.0 31.0 40.0 25.0 40.0 14 33.968 38.0 31.0 40.0 25.0 40.0 15 33.9535 38.0 31.0 40.0 25.0 40.0 16 33.72875 38.0 31.0 40.0 25.0 40.0 17 33.4245 36.0 31.0 40.0 25.0 40.0 18 33.70875 38.0 31.0 40.0 25.0 40.0 19 33.8245 38.0 31.0 40.0 25.0 40.0 20 33.548 37.0 31.0 40.0 25.0 40.0 21 33.64 38.0 31.0 40.0 25.0 40.0 22 33.72375 38.0 31.0 40.0 25.0 40.0 23 33.45825 36.0 31.0 40.0 25.0 40.0 24 33.664 38.0 31.0 40.0 25.0 40.0 25 33.67475 38.0 31.0 40.0 25.0 40.0 26 31.861 36.0 31.0 39.0 4.0 40.0 27 31.614 35.0 31.0 39.0 4.0 40.0 28 31.67425 35.0 31.0 39.0 4.0 40.0 29 31.641 35.0 31.0 39.0 4.0 40.0 30 31.53325 35.0 31.0 39.0 4.0 40.0 31 30.2005 35.0 28.0 39.0 4.0 40.0 32 30.60225 35.0 31.0 39.0 4.0 40.0 33 30.29875 35.0 29.0 39.0 4.0 40.0 34 30.49825 35.0 30.0 39.0 4.0 40.0 35 30.24975 34.0 29.0 39.0 4.0 40.0 36 30.271 35.0 29.0 39.0 4.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 204.0 5 1.0 6 0.0 7 1.0 8 1.0 9 4.0 10 3.0 11 7.0 12 4.0 13 7.0 14 4.0 15 13.0 16 9.0 17 22.0 18 29.0 19 54.0 20 44.0 21 57.0 22 82.0 23 82.0 24 114.0 25 169.0 26 238.0 27 235.0 28 148.0 29 67.0 30 49.0 31 45.0 32 60.0 33 71.0 34 89.0 35 125.0 36 194.0 37 283.0 38 402.0 39 1014.0 40 69.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.067466266866566 51.911544227886054 18.778110944527736 14.24287856071964 2 14.85 51.675000000000004 20.8 12.675 3 43.2 22.925 19.775000000000002 14.099999999999998 4 15.15 23.225 20.0 41.625 5 16.125 50.324999999999996 20.200000000000003 13.350000000000001 6 44.15 23.400000000000002 19.35 13.100000000000001 7 14.549999999999999 21.625 49.75 14.075 8 43.85 21.975 18.875 15.299999999999999 9 43.0 22.125 19.5 15.375 10 14.2 22.975 48.325 14.499999999999998 11 14.2 50.1 22.25 13.450000000000001 12 14.475 21.075 48.9 15.55 13 12.875 22.975 20.25 43.9 14 14.025000000000002 51.975 19.675 14.325 15 13.675 51.05 19.75 15.525 16 14.325 23.0 19.950000000000003 42.725 17 42.35 20.849999999999998 19.55 17.25 18 14.124999999999998 23.025000000000002 19.275000000000002 43.575 19 14.899999999999999 51.349999999999994 19.575 14.174999999999999 20 42.75 23.05 19.425 14.774999999999999 21 16.475 49.775000000000006 19.225 14.524999999999999 22 43.075 22.400000000000002 20.65 13.875000000000002 23 15.0 23.075000000000003 47.85 14.075 24 13.8 50.449999999999996 20.875 14.875 25 15.049999999999999 21.575 20.95 42.425000000000004 26 24.375 29.325000000000003 30.825000000000003 15.475 27 15.45 22.625 36.575 25.35 28 33.1 22.85 30.099999999999998 13.950000000000001 29 33.0 22.375 30.099999999999998 14.524999999999999 30 32.58258258258258 21.57157157157157 29.82982982982983 16.016016016016017 31 24.424424424424423 27.2022022022022 31.78178178178178 16.59159159159159 32 20.110055027513756 30.240120060030012 33.09154577288644 16.558279139569784 33 17.942942942942945 28.303303303303302 36.186186186186184 17.56756756756757 34 18.509254627313656 28.414207103551774 34.592296148074034 18.48424212106053 35 17.5 28.199999999999996 35.6 18.7 36 16.7 28.225 35.875 19.2 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 12.0 1 6.5 2 1.0 3 1.0 4 1.5 5 2.0 6 2.0 7 2.0 8 2.0 9 2.0 10 1.5 11 1.0 12 1.0 13 3.5 14 6.0 15 7.0 16 8.0 17 8.0 18 13.0 19 18.0 20 18.0 21 28.0 22 38.0 23 38.0 24 51.0 25 64.0 26 96.0 27 128.0 28 128.0 29 170.0 30 212.0 31 212.0 32 408.0 33 604.0 34 604.0 35 460.5 36 317.0 37 317.0 38 350.0 39 383.0 40 395.0 41 407.0 42 407.0 43 383.0 44 359.0 45 359.0 46 355.5 47 352.0 48 352.0 49 351.0 50 350.0 51 344.5 52 339.0 53 339.0 54 283.5 55 228.0 56 228.0 57 172.5 58 117.0 59 117.0 60 77.5 61 38.0 62 38.0 63 25.5 64 13.0 65 7.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 33.300000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.1 31 0.1 32 0.05 33 0.1 34 0.05 35 0.0 36 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 36 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.13058035714286 87.925 2 1.3950892857142858 2.5 3 0.2232142857142857 0.6 4 0.027901785714285712 0.1 5 0.08370535714285714 0.375 6 0.0 0.0 7 0.055803571428571425 0.35000000000000003 8 0.027901785714285712 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.027901785714285712 2.275 >100 0.027901785714285712 5.675 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTT 227 5.675 No Hit NAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTT 91 2.275 No Hit AGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTT 8 0.2 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 7 0.17500000000000002 No Hit NAGCAGTGGTATCAACGCAGAGTTGATATCACTAAG 7 0.17500000000000002 No Hit AAGCAGTGGTATCAACGCAGAGTAGTTTTTTTTTTT 5 0.125 No Hit AAGCAGTGGTATCAACGCAGAGTACATGGGGATCCT 5 0.125 No Hit AAGCAGTGGTATCAACGCAGAGTTGATATCACTAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCAGT 70 0.0 40.822754 1 ACATGGG 20 0.0048145195 29.675001 24 GTACATG 20 0.0048145195 29.675001 22 TACATGG 20 0.0048145195 29.675001 23 AGTACGC 40 1.7165075E-7 29.675001 21 AGTACAT 20 0.0048145195 29.675001 21 TACGCGG 40 1.7165075E-7 29.675001 23 GAGTACG 40 1.7165075E-7 29.675001 20 CGCGGGG 25 3.7602012E-4 29.675001 25 CATGGGG 20 0.0048145195 29.675001 25 ACGCGGG 40 1.7165075E-7 29.675001 24 GTACGCG 40 1.7165075E-7 29.675001 22 TGGTATC 105 0.0 28.261908 7 AACGCAG 115 0.0 27.094566 14 ACGCAGA 115 0.0 27.094566 15 TCAACGC 115 0.0 27.094566 12 CAGAGTA 115 0.0 27.094566 18 AGCAGTG 115 0.0 27.094566 2 GCAGTGG 115 0.0 27.094566 3 AGAGTAC 115 0.0 27.094566 19 >>END_MODULE Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra Read 1758700 spots for SRR1165054.sra Written 1758700 spots for SRR1165054.sra SRR ids: ['SRR1165054.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_870zbeog SRR1165054.sra spots: 35174000 blocks: [[1, 1758700], [1758701, 3517400], [3517401, 5276100], [5276101, 7034800], [7034801, 8793500], [8793501, 10552200], [10552201, 12310900], [12310901, 14069600], [14069601, 15828300], [15828301, 17587000], [17587001, 19345700], [19345701, 21104400], [21104401, 22863100], [22863101, 24621800], [24621801, 26380500], [26380501, 28139200], [28139201, 29897900], [29897901, 31656600], [31656601, 33415300], [33415301, 35174000]] SRR1165054 file size 4631889 SRR1165054 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1165054 SRR1165054_1.fastq Input file: SRR1165054_1.fastq trimmed: SRR1165054-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:56:32 2025 >> started Thu Feb 13 15:56:45 2025 >> done (12.348s) 35174000 reads processed; of these: 193384 ( 0.55%) short reads filtered out after trimming by size control 169872 ( 0.48%) empty reads filtered out after trimming by size control 34810744 (98.97%) reads available; of these: 2299570 ( 6.61%) trimmed reads available after processing 32511174 (93.39%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 18251 0.05% 19 29534 0.08% 20 56394 0.16% 21 14903 0.04% 22 21612 0.06% 23 42413 0.12% 24 83737 0.24% 25 610894 1.75% 26 34635 0.10% 27 136341 0.39% 28 84533 0.24% 29 129142 0.37% 30 463670 1.33% 31 54862 0.16% 32 69684 0.20% 33 84833 0.24% 34 138191 0.40% 35 225941 0.65% 36 32511174 93.39% 34810744 reads passed initial QC criterion=sequence-density sequence-density=10.59 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=47 prefix-density=30.09 prefix-fanout=1.0 sequence=ACGCAGAGTACGCGGG criterion=fanout-score sequence-density=0.52 sequence-density-rank=24 fanout-score=58.21 fanout-score-rank=1 prefix-density=30.26 prefix-fanout=1.0 sequence=CAACGCAGAGTTGATATCACTAAGCAGTGGT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x ACGCAGAGTACGCGGG -o SRR1165054 - Input file: STDIN trimmed: SRR1165054-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): ACGCAGAGTACGCGGG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Thu Feb 13 15:57:33 2025 >> started Thu Feb 13 15:57:57 2025 >> done (23.738s) 28481518 reads processed; of these: 3676432 (12.91%) short reads filtered out after trimming by size control 504 ( 0.00%) empty reads filtered out after trimming by size control 24804582 (87.09%) reads available; of these: 214925 ( 0.87%) trimmed reads available after processing 24589657 (99.13%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12796 0.05% 19 19597 0.08% 20 35001 0.14% 21 11385 0.05% 22 15217 0.06% 23 24742 0.10% 24 41067 0.17% 25 101724 0.41% 26 28215 0.11% 27 114753 0.46% 28 60883 0.25% 29 87761 0.35% 30 217081 0.88% 31 51617 0.21% 32 68207 0.27% 33 154174 0.62% 34 78714 0.32% 35 135873 0.55% 36 23545775 94.93% criterion=sequence-density sequence-density=2.71 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=48 prefix-density=7.95 prefix-fanout=1.0 sequence=AGTACATGGGGA criterion=fanout-score sequence-density=0.15 sequence-density-rank=43 fanout-score=129.95 fanout-score-rank=1 prefix-density=19.74 prefix-fanout=1.0 sequence=CGCAGAGTACGC Started job on | Feb 13 15:58:57 Started mapping on | Feb 13 15:58:57 Finished on | Feb 13 15:59:46 Mapping speed, Million of reads per hour | 2287.38 Number of input reads | 31133808 Average input read length | 27 UNIQUE READS: Uniquely mapped reads number | 22718877 Uniquely mapped reads % | 72.97% Average mapped length | 27.03 Number of splices: Total | 982565 Number of splices: Annotated (sjdb) | 876271 Number of splices: GT/AG | 968074 Number of splices: GC/AG | 11192 Number of splices: AT/AC | 553 Number of splices: Non-canonical | 2746 Mismatch rate per base, % | 0.77% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3427798 % of reads mapped to multiple loci | 11.01% Number of reads mapped to too many loci | 132387 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.86% % of reads unmapped: other | 0.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4987133 4987133 4987133 N_multimapping 3427798 3427798 3427798 N_noFeature 2139539 17078052 7667537 N_ambiguous 162984 15271 35296 UnstrandedReadsAssigned:20416354 PositiveStrandReadsAssigned:5625554 NegativeStrandReadsAssigned:15016044 Dataset is classified unstranded MeadianReadLen=28 20thPercentileLength=28 echo kmer=23 SRR1165054 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=23 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 23 [index] number of targets: 52,400 [index] number of k-mers: 60,815,545 [index] number of equivalence classes: 166,953 [quant] running in single-end mode [quant] will process file 1: SRR1165054-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,133,808 reads, 17,057,932 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR1165054.ke.tsv 34699 SRR1165054.se.tsv 87100 total ==> SRR1165054.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 867.431 28.6288 Potri.005G024800.1.v4.1 1035 936 350.787 23.7362 Potri.004G059700.1.v4.1 961 862 197.632 14.5209 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 466.282 10.3839 Potri.016G087400.1.v4.1 270 171 1398.63 518.024 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 95.697 3.62064 Potri.012G127500.1.v4.1 977 878 2166.41 156.275 ==> SRR1165054.se.tsv <== Potri.001G166300.v4.1 4 Potri.001G448400.v4.1 76 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 1448 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 3 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 8 Potri.001G452600.v4.1 49 SRR1165054 completed mapping pipeline successfully