Starting /dee2/code/volunteer_pipeline.sh SRR1165055 current disk space = 3088959164416 free memory = 1513246604 SRR1165055 SRAfilesize 15cf7c3a8381d925cb114423451821c4 SRR1165055.sra SRR1165055.sra file validated SRR1165055 is single end SRR1165055 is conventional basespace SRR1165055 read1 length is 36 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1165055_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.60225 33.0 4.0 39.0 4.0 40.0 2 28.1925 37.0 14.0 40.0 9.0 40.0 3 28.37725 38.0 14.0 40.0 10.0 40.0 4 28.25825 37.0 13.0 40.0 9.0 40.0 5 28.19175 38.0 13.0 40.0 9.0 40.0 6 30.0685 38.0 21.0 40.0 12.0 40.0 7 30.01525 37.0 21.0 40.0 13.0 40.0 8 29.895 37.0 20.0 40.0 12.0 40.0 9 29.6795 36.0 20.0 40.0 12.0 40.0 10 29.8065 36.0 21.0 40.0 12.0 40.0 11 33.90325 38.0 31.0 40.0 26.0 40.0 12 33.7805 37.0 31.0 40.0 25.0 40.0 13 33.83175 38.0 31.0 40.0 26.0 40.0 14 33.79125 38.0 31.0 40.0 26.0 40.0 15 33.65125 37.0 31.0 40.0 25.0 40.0 16 33.6655 38.0 31.0 40.0 25.0 40.0 17 33.52025 36.0 31.0 40.0 25.0 40.0 18 33.594 37.0 31.0 40.0 25.0 40.0 19 33.71375 38.0 31.0 40.0 25.0 40.0 20 33.54175 38.0 31.0 40.0 25.0 40.0 21 33.4595 38.0 31.0 40.0 25.0 40.0 22 33.44575 37.0 31.0 40.0 25.0 40.0 23 33.294 36.0 31.0 40.0 25.0 40.0 24 33.55675 38.0 31.0 40.0 25.0 40.0 25 33.5235 38.0 31.0 40.0 25.0 40.0 26 32.5105 36.0 31.0 40.0 17.0 40.0 27 32.2885 35.0 31.0 40.0 16.0 40.0 28 32.2425 35.0 31.0 40.0 15.0 40.0 29 32.2425 36.0 31.0 40.0 13.0 40.0 30 32.0935 36.0 31.0 40.0 4.0 40.0 31 31.014 35.0 31.0 39.0 4.0 40.0 32 30.6775 35.0 29.0 39.0 4.0 40.0 33 30.9655 35.0 31.0 39.0 4.0 40.0 34 31.027 35.0 31.0 39.0 4.0 40.0 35 30.89925 35.0 31.0 39.0 4.0 40.0 36 30.70425 35.0 31.0 39.0 4.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 229.0 5 0.0 6 1.0 7 0.0 8 0.0 9 5.0 10 5.0 11 2.0 12 9.0 13 6.0 14 7.0 15 5.0 16 7.0 17 10.0 18 14.0 19 32.0 20 42.0 21 50.0 22 48.0 23 108.0 24 125.0 25 174.0 26 234.0 27 245.0 28 181.0 29 50.0 30 44.0 31 50.0 32 62.0 33 82.0 34 108.0 35 127.0 36 168.0 37 267.0 38 419.0 39 1027.0 40 57.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.797487628473544 51.08488770460602 18.195660449181574 14.921964217738864 2 16.25 50.05 19.825 13.875000000000002 3 40.300000000000004 23.125 20.599999999999998 15.975 4 16.1 22.075 20.549999999999997 41.275 5 18.375 47.4 20.875 13.350000000000001 6 41.675000000000004 21.0 19.6 17.724999999999998 7 16.175 20.8 48.875 14.149999999999999 8 42.8 21.775 19.950000000000003 15.475 9 41.55 20.05 22.475 15.925 10 15.5 21.05 46.275 17.175 11 14.899999999999999 47.475 21.625 16.0 12 15.075 20.575 47.475 16.875 13 15.675 22.25 21.25 40.825 14 15.6 47.775 20.025000000000002 16.6 15 14.774999999999999 47.55 21.2 16.475 16 16.400000000000002 20.424999999999997 21.05 42.125 17 42.675000000000004 20.325 21.0 16.0 18 15.4 22.400000000000002 20.025000000000002 42.175000000000004 19 16.175 47.675 21.075 15.075 20 42.5 20.8 20.875 15.825 21 16.325 47.25 21.65 14.774999999999999 22 42.449999999999996 20.95 21.025 15.575 23 15.5 21.775 46.575 16.150000000000002 24 16.0 46.825 20.95 16.225 25 16.650000000000002 21.25 21.75 40.35 26 30.925000000000004 25.674999999999997 27.725 15.675 27 16.579144786196547 20.7551887971993 32.03300825206302 30.632658164541137 28 34.28357089272318 22.405601400350086 27.781945486371594 15.528882220555138 29 35.65 21.6 28.349999999999998 14.399999999999999 30 34.08352088022005 21.10527631907977 29.057264316079017 15.753938484621155 31 27.120340255191394 26.1195896922692 29.82236677508131 16.937703277458095 32 21.630407601900476 30.23255813953488 32.00800200050013 16.129032258064516 33 20.99074305729297 26.244683512634477 33.4250688016012 19.339504628471353 34 19.409704852426213 26.688344172086044 33.01650825412706 20.885442721360683 35 21.0 27.075 32.25 19.675 36 19.875 26.525 33.074999999999996 20.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 3.5 2 3.0 3 3.0 4 2.5 5 2.0 6 2.0 7 2.0 8 2.0 9 2.0 10 2.5 11 3.0 12 3.0 13 7.5 14 12.0 15 10.0 16 8.0 17 8.0 18 14.5 19 21.0 20 21.0 21 32.0 22 43.0 23 43.0 24 50.5 25 58.0 26 71.5 27 85.0 28 85.0 29 114.0 30 143.0 31 143.0 32 303.5 33 464.0 34 464.0 35 382.5 36 301.0 37 301.0 38 304.0 39 307.0 40 335.0 41 363.0 42 363.0 43 356.0 44 349.0 45 349.0 46 364.5 47 380.0 48 380.0 49 389.0 50 398.0 51 406.0 52 414.0 53 414.0 54 372.5 55 331.0 56 331.0 57 269.5 58 208.0 59 208.0 60 141.5 61 75.0 62 75.0 63 47.5 64 20.0 65 11.5 66 3.0 67 3.0 68 2.5 69 2.0 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 34.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.025 29 0.0 30 0.025 31 0.075 32 0.025 33 0.075 34 0.05 35 0.0 36 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 36 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.85 #Duplication Level Percentage of deduplicated Percentage of total 1 97.74353329664281 88.8 2 1.6235553109521188 2.9499999999999997 3 0.4402861860209136 1.2 4 0.1100715465052284 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0275178866263071 0.35000000000000003 >50 0.0275178866263071 2.225 >100 0.0275178866263071 4.075 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTT 163 4.075 No Hit NAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTT 89 2.225 No Hit AAGCAGTGGTATCAACGCAGAGTACGCGGGAAGCAG 14 0.35000000000000003 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCAGT 60 1.8189894E-12 41.042454 1 ACATGGG 30 2.9258008E-5 29.6625 24 GTACATG 30 2.9258008E-5 29.6625 22 AGTACAT 30 2.9258008E-5 29.6625 21 GAGTACA 30 2.9258008E-5 29.6625 20 CATGGGG 25 3.769507E-4 29.6625 25 TGGTATC 100 0.0 26.69625 7 AGTGGTA 100 0.0 26.69625 5 GTATCAA 100 0.0 26.69625 9 AGCAGTG 100 0.0 26.69625 2 GCAGTGG 100 0.0 26.69625 3 TATCAAC 100 0.0 26.69625 10 GTGGTAT 100 0.0 26.69625 6 CAGTGGT 100 0.0 26.69625 4 GGTATCA 100 0.0 26.69625 8 ATCAACG 95 0.0 26.54013 11 TACATGG 35 8.3788946E-5 25.425 23 TACGCGG 35 8.3788946E-5 25.425 23 AGAGTAC 105 0.0 25.425 19 ACGCGGG 35 8.3788946E-5 25.425 24 >>END_MODULE Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763620 spots for SRR1165055.sra Written 1763620 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra Read 1763605 spots for SRR1165055.sra Written 1763605 spots for SRR1165055.sra SRR ids: ['SRR1165055.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sqimulpb SRR1165055.sra spots: 35272115 blocks: [[1, 1763605], [1763606, 3527210], [3527211, 5290815], [5290816, 7054420], [7054421, 8818025], [8818026, 10581630], [10581631, 12345235], [12345236, 14108840], [14108841, 15872445], [15872446, 17636050], [17636051, 19399655], [19399656, 21163260], [21163261, 22926865], [22926866, 24690470], [24690471, 26454075], [26454076, 28217680], [28217681, 29981285], [29981286, 31744890], [31744891, 33508495], [33508496, 35272115]] SRR1165055 file size 4644636 SRR1165055 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1165055 SRR1165055_1.fastq Input file: SRR1165055_1.fastq trimmed: SRR1165055-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 16:05:42 2025 >> started Thu Feb 13 16:05:58 2025 >> done (15.328s) 35272115 reads processed; of these: 171308 ( 0.49%) short reads filtered out after trimming by size control 137066 ( 0.39%) empty reads filtered out after trimming by size control 34963741 (99.13%) reads available; of these: 2195735 ( 6.28%) trimmed reads available after processing 32768006 (93.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 17829 0.05% 19 30149 0.09% 20 63929 0.18% 21 16333 0.05% 22 23613 0.07% 23 37547 0.11% 24 80090 0.23% 25 548346 1.57% 26 33652 0.10% 27 85045 0.24% 28 79542 0.23% 29 143201 0.41% 30 425396 1.22% 31 54608 0.16% 32 69226 0.20% 33 89881 0.26% 34 146761 0.42% 35 250587 0.72% 36 32768006 93.72% 34963741 reads passed initial QC criterion=sequence-density sequence-density=24.68 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=43 prefix-density=1.13 prefix-fanout=2.6 sequence=AAGCAGTGGTATCAACGCAGAGTACGCGGG criterion=fanout-score sequence-density=0.52 sequence-density-rank=21 fanout-score=54.83 fanout-score-rank=1 prefix-density=27.70 prefix-fanout=1.0 sequence=ACGCAGAGTACTTTTTTT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AAGCAGTGGTATCAACGCAGAGTACGCGGG -o SRR1165055 - Input file: STDIN trimmed: SRR1165055-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AAGCAGTGGTATCAACGCAGAGTACGCGGG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Thu Feb 13 16:06:53 2025 >> started Thu Feb 13 16:07:14 2025 >> done (21.070s) 32166642 reads processed; of these: 238034 ( 0.74%) short reads filtered out after trimming by size control 4922559 (15.30%) empty reads filtered out after trimming by size control 27006049 (83.96%) reads available; of these: 1102631 ( 4.08%) trimmed reads available after processing 25903418 (95.92%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 25712 0.10% 19 35006 0.13% 20 63131 0.23% 21 31301 0.12% 22 40769 0.15% 23 71267 0.26% 24 69266 0.26% 25 144764 0.54% 26 48147 0.18% 27 66464 0.25% 28 70534 0.26% 29 105420 0.39% 30 261826 0.97% 31 86594 0.32% 32 155172 0.57% 33 571496 2.12% 34 79757 0.30% 35 143651 0.53% 36 24935772 92.33% criterion=sequence-density sequence-density=12.45 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=43 prefix-density=0.06 prefix-fanout=3.0 sequence=AAGCAGTGGTATCAACGCAGAGTACATGGGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=36 fanout-score=132.23 fanout-score-rank=1 prefix-density=15.26 prefix-fanout=1.0 sequence=CAACGCAGAGTT Started job on | Feb 13 16:08:02 Started mapping on | Feb 13 16:08:02 Finished on | Feb 13 16:08:40 Mapping speed, Million of reads per hour | 2823.46 Number of input reads | 29803148 Average input read length | 31 UNIQUE READS: Uniquely mapped reads number | 19538175 Uniquely mapped reads % | 65.56% Average mapped length | 30.45 Number of splices: Total | 1115513 Number of splices: Annotated (sjdb) | 1058946 Number of splices: GT/AG | 1093843 Number of splices: GC/AG | 12386 Number of splices: AT/AC | 668 Number of splices: Non-canonical | 8616 Mismatch rate per base, % | 0.73% Deletion rate per base | 0.01% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2711086 % of reads mapped to multiple loci | 9.10% Number of reads mapped to too many loci | 519934 % of reads mapped to too many loci | 1.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 23.44% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7553887 7553887 7553887 N_multimapping 2711086 2711086 2711086 N_noFeature 1484729 14124777 6810937 N_ambiguous 128336 14496 26918 UnstrandedReadsAssigned:17925110 PositiveStrandReadsAssigned:5398902 NegativeStrandReadsAssigned:12700320 Dataset is classified unstranded MeadianReadLen=32 20thPercentileLength=32 echo kmer=27 SRR1165055 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=27 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 27 [index] number of targets: 52,400 [index] number of k-mers: 61,548,610 [index] number of equivalence classes: 141,804 [quant] running in single-end mode [quant] will process file 1: SRR1165055-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,803,148 reads, 14,830,354 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 998 rounds 52401 SRR1165055.ke.tsv 34699 SRR1165055.se.tsv 87100 total ==> SRR1165055.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 606.646 23.3161 Potri.005G024800.1.v4.1 1035 936 188.606 14.8619 Potri.004G059700.1.v4.1 961 862 124.436 10.6472 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 384.473 9.97082 Potri.016G087400.1.v4.1 270 171 987.118 425.763 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 98.0836 4.32152 Potri.012G127500.1.v4.1 977 878 1499 125.922 ==> SRR1165055.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 920 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 49 SRR1165055 completed mapping pipeline successfully