Starting /dee2/code/volunteer_pipeline.sh SRR1165056 current disk space = 3088981966848 free memory = 1472847220 SRR1165056 SRAfilesize 89baa43ea135ede1fbc5afa39abcb658 SRR1165056.sra SRR1165056.sra file validated SRR1165056 is single end SRR1165056 is conventional basespace SRR1165056 read1 length is 36 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1165056_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.03475 33.0 4.0 39.0 4.0 40.0 2 28.48275 37.0 14.0 40.0 10.0 40.0 3 28.5565 38.0 14.0 40.0 10.0 40.0 4 28.458 37.0 14.0 40.0 9.0 40.0 5 28.2855 37.0 13.0 40.0 9.0 40.0 6 30.3395 38.0 21.0 40.0 12.0 40.0 7 30.169 37.0 21.0 40.0 12.0 40.0 8 30.1235 38.0 21.0 40.0 12.0 40.0 9 29.89375 36.0 20.0 40.0 12.0 40.0 10 29.93725 37.0 21.0 40.0 12.0 40.0 11 33.9975 38.0 31.0 40.0 26.0 40.0 12 33.896 38.0 31.0 40.0 25.0 40.0 13 33.763 37.0 31.0 40.0 25.0 40.0 14 33.80675 37.0 31.0 40.0 25.0 40.0 15 33.6885 37.0 31.0 40.0 25.0 40.0 16 33.63575 36.0 31.0 40.0 25.0 40.0 17 33.4985 36.0 31.0 40.0 25.0 40.0 18 33.4695 36.0 31.0 40.0 25.0 40.0 19 33.704 37.0 31.0 40.0 25.0 40.0 20 33.5435 37.0 31.0 40.0 25.0 40.0 21 33.54375 37.0 31.0 40.0 25.0 40.0 22 33.5105 37.0 31.0 40.0 25.0 40.0 23 33.4175 37.0 31.0 40.0 25.0 40.0 24 33.403 37.0 31.0 40.0 25.0 40.0 25 33.528 38.0 31.0 40.0 25.0 40.0 26 32.81775 36.0 31.0 40.0 18.0 40.0 27 32.60225 36.0 31.0 40.0 17.0 40.0 28 32.51025 36.0 31.0 40.0 17.0 40.0 29 32.52525 36.0 31.0 40.0 17.0 40.0 30 32.4265 36.0 31.0 39.0 17.0 40.0 31 31.39675 35.0 31.0 39.0 4.0 40.0 32 31.3655 35.0 31.0 39.0 4.0 40.0 33 31.41975 35.0 31.0 39.0 4.0 40.0 34 31.49025 35.0 31.0 39.0 4.0 40.0 35 31.29925 35.0 31.0 39.0 4.0 40.0 36 31.34025 35.0 31.0 39.0 4.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 210.0 5 0.0 6 1.0 7 1.0 8 0.0 9 3.0 10 3.0 11 5.0 12 3.0 13 10.0 14 2.0 15 6.0 16 14.0 17 11.0 18 16.0 19 32.0 20 39.0 21 41.0 22 81.0 23 77.0 24 109.0 25 176.0 26 198.0 27 310.0 28 178.0 29 43.0 30 46.0 31 54.0 32 61.0 33 83.0 34 103.0 35 123.0 36 182.0 37 250.0 38 402.0 39 1079.0 40 48.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.243102162565249 47.20357941834452 21.84936614466816 16.703952274422072 2 15.975 44.95 23.025000000000002 16.05 3 36.375 25.074999999999996 20.95 17.599999999999998 4 18.375 24.075 21.3 36.25 5 18.325 44.375 21.8 15.5 6 38.875 23.75 20.075000000000003 17.299999999999997 7 16.325 22.35 44.925 16.400000000000002 8 38.4 22.775000000000002 21.95 16.875 9 38.15 22.2 22.35 17.299999999999997 10 16.6 24.325 42.65 16.425 11 17.05 43.85 22.5 16.6 12 16.575 23.425 43.125 16.875 13 17.325 23.425 21.15 38.1 14 15.825 44.824999999999996 22.375 16.975 15 16.950000000000003 43.725 22.7 16.625 16 17.125 21.95 22.625 38.3 17 37.675 23.325000000000003 22.15 16.85 18 18.15 23.125 19.975 38.75 19 15.975 45.025 22.45 16.55 20 37.7 22.75 22.75 16.8 21 16.325 45.025 21.625 17.025000000000002 22 37.45 23.75 22.025 16.775000000000002 23 16.675 22.675 42.8 17.849999999999998 24 15.825 43.55 23.35 17.275 25 17.575 23.05 22.775000000000002 36.6 26 29.4 26.6 26.325 17.675 27 16.75 22.375 31.900000000000002 28.975 28 31.5 24.325 26.6 17.575 29 32.59129564782391 23.13656828414207 27.363681840920464 16.908454227113555 30 30.24768576432324 23.117338003502628 28.77157868401301 17.86339754816112 31 25.969477107830873 25.794345759319487 29.221916437327994 19.014260695521642 32 22.59194395796848 30.522892169126848 28.921691268451337 17.96347260445334 33 20.76038019009505 27.538769384692348 31.89094547273637 19.809904952476238 34 19.3 29.425 31.424999999999997 19.85 35 19.675 27.525 33.225 19.575 36 19.875 26.974999999999998 30.95 22.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 1.5 8 2.0 9 2.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 6.0 17 6.0 18 9.0 19 12.0 20 12.0 21 15.5 22 19.0 23 19.0 24 23.5 25 28.0 26 55.5 27 83.0 28 83.0 29 104.0 30 125.0 31 125.0 32 263.5 33 402.0 34 402.0 35 376.5 36 351.0 37 351.0 38 381.5 39 412.0 40 438.0 41 464.0 42 464.0 43 474.0 44 484.0 45 484.0 46 466.5 47 449.0 48 449.0 49 425.0 50 401.0 51 350.0 52 299.0 53 299.0 54 284.5 55 270.0 56 270.0 57 201.0 58 132.0 59 132.0 60 86.5 61 41.0 62 41.0 63 25.0 64 9.0 65 7.5 66 6.0 67 6.0 68 3.5 69 1.0 70 1.0 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 32.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.05 30 0.075 31 0.075 32 0.075 33 0.05 34 0.0 35 0.0 36 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 36 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.6740917528507 93.025 2 1.0607265977194378 2.0 3 0.07955449482895784 0.22499999999999998 4 0.026518164942985947 0.1 5 0.05303632988597189 0.25 6 0.026518164942985947 0.15 7 0.026518164942985947 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026518164942985947 1.55 >100 0.026518164942985947 2.5250000000000004 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTT 101 2.5250000000000004 No Hit NAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTT 62 1.55 No Hit AAGCAGTGGTATCAACGCAGAGTAAGCAGTGGTATC 7 0.17500000000000002 No Hit AAGCAGTGGTATCAACGCAGAGTTGATATCACTAAG 6 0.15 No Hit NAGCAGTGGTATCAACGCAGAGTAAGCAGTGGTATC 5 0.125 No Hit AAGCAGTGGTATCAACGCAGAGTTGATAACACTAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCAGT 50 7.057679E-10 38.86364 1 CGCGGGG 20 0.004804605 29.687502 25 GTACTTT 30 2.9089928E-5 29.6875 22 ACTTTTT 30 2.9089928E-5 29.6875 24 AGTACTT 35 2.2396198E-6 29.6875 21 GAGTACT 35 2.2396198E-6 29.6875 20 TACTTTT 30 2.9089928E-5 29.6875 23 CTTTTTT 30 2.9089928E-5 29.6875 25 AGAGTAC 85 0.0 27.941175 19 AACGCAG 90 0.0 26.38889 14 ACGCAGA 90 0.0 26.38889 15 TCAACGC 90 0.0 26.38889 12 CAGAGTA 90 0.0 26.38889 18 GAGTACG 45 4.8052607E-7 26.38889 20 GCAGAGT 90 0.0 26.38889 17 CGCAGAG 90 0.0 26.38889 16 ATCAACG 90 0.0 26.38889 11 CAACGCA 90 0.0 26.38889 13 AGTGGTA 85 0.0 26.194853 5 GCAGTGG 85 0.0 26.194853 3 >>END_MODULE Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638223 spots for SRR1165056.sra Written 1638223 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra Read 1638208 spots for SRR1165056.sra Written 1638208 spots for SRR1165056.sra SRR ids: ['SRR1165056.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lczz7ik1 SRR1165056.sra spots: 32764175 blocks: [[1, 1638208], [1638209, 3276416], [3276417, 4914624], [4914625, 6552832], [6552833, 8191040], [8191041, 9829248], [9829249, 11467456], [11467457, 13105664], [13105665, 14743872], [14743873, 16382080], [16382081, 18020288], [18020289, 19658496], [19658497, 21296704], [21296705, 22934912], [22934913, 24573120], [24573121, 26211328], [26211329, 27849536], [27849537, 29487744], [29487745, 31125952], [31125953, 32764175]] SRR1165056 file size 4313763 SRR1165056 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1165056 SRR1165056_1.fastq Input file: SRR1165056_1.fastq trimmed: SRR1165056-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 16:09:18 2025 >> started Thu Feb 13 16:09:31 2025 >> done (12.737s) 32764175 reads processed; of these: 120609 ( 0.37%) short reads filtered out after trimming by size control 117453 ( 0.36%) empty reads filtered out after trimming by size control 32526113 (99.27%) reads available; of these: 1425104 ( 4.38%) trimmed reads available after processing 31101009 (95.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12537 0.04% 19 20948 0.06% 20 43712 0.13% 21 12006 0.04% 22 17195 0.05% 23 33979 0.10% 24 61414 0.19% 25 300594 0.92% 26 24436 0.08% 27 53458 0.16% 28 54815 0.17% 29 94298 0.29% 30 271245 0.83% 31 37642 0.12% 32 49574 0.15% 33 64036 0.20% 34 101805 0.31% 35 171410 0.53% 36 31101009 95.62% 32526113 reads passed initial QC criterion=sequence-density sequence-density=5.50 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=49 prefix-density=10.75 prefix-fanout=1.0 sequence=GAGTACGCGGGG criterion=fanout-score sequence-density=0.35 sequence-density-rank=30 fanout-score=63.39 fanout-score-rank=1 prefix-density=22.34 prefix-fanout=1.0 sequence=ACGCAGAGTACTTTTTTT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 0 (0.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 1 (100.00%) aligned >1 times 100.00% overall alignment rate Potential adapter found in reference sequence. Continuing without clipping. Started job on | Feb 13 16:10:12 Started mapping on | Feb 13 16:10:15 Finished on | Feb 13 16:10:55 Mapping speed, Million of reads per hour | 2927.35 Number of input reads | 32526113 Average input read length | 31 UNIQUE READS: Uniquely mapped reads number | 22444974 Uniquely mapped reads % | 69.01% Average mapped length | 31.08 Number of splices: Total | 1503750 Number of splices: Annotated (sjdb) | 1460999 Number of splices: GT/AG | 1480078 Number of splices: GC/AG | 17712 Number of splices: AT/AC | 1397 Number of splices: Non-canonical | 4563 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.01% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2767092 % of reads mapped to multiple loci | 8.51% Number of reads mapped to too many loci | 93708 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 22.08% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7314047 7314047 7314047 N_multimapping 2767092 2767092 2767092 N_noFeature 1684700 14839201 9182081 N_ambiguous 162980 19868 35058 UnstrandedReadsAssigned:20597294 PositiveStrandReadsAssigned:7585905 NegativeStrandReadsAssigned:13227835 Dataset is classified unstranded MeadianReadLen=32 20thPercentileLength=32 echo kmer=27 SRR1165056 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=27 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 27 [index] number of targets: 52,400 [index] number of k-mers: 61,548,610 [index] number of equivalence classes: 141,804 [quant] running in single-end mode [quant] will process file 1: SRR1165056-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,526,113 reads, 19,064,017 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR1165056.ke.tsv 34699 SRR1165056.se.tsv 87100 total ==> SRR1165056.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 899.199 29.156 Potri.005G024800.1.v4.1 1035 936 363.934 24.1932 Potri.004G059700.1.v4.1 961 862 414.028 29.8862 Potri.007G009000.2.v4.1 1416 1317 1 0.0472456 Potri.003G141000.2.v4.1 2943 2844 723.209 15.8228 Potri.016G087400.1.v4.1 270 171 1508.91 549.055 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 136.919 5.08926 Potri.012G127500.1.v4.1 977 878 1894 134.225 ==> SRR1165056.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 146 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 2244 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 5 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 187 SRR1165056 completed mapping pipeline successfully