Starting /dee2/code/volunteer_pipeline.sh SRR1165058 current disk space = 3088842944512 free memory = 1489701844 SRR1165058 SRAfilesize 864b2f37673381e74a38284d03920a8f SRR1165058.sra SRR1165058.sra file validated SRR1165058 is single end SRR1165058 is conventional basespace SRR1165058 read1 length is 36 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1165058_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.656 35.0 4.0 39.0 4.0 40.0 2 29.95125 38.0 16.0 40.0 10.0 40.0 3 29.5465 38.0 16.0 40.0 10.0 40.0 4 29.848 38.0 16.0 40.0 10.0 40.0 5 29.38025 38.0 15.0 40.0 9.0 40.0 6 31.5845 38.0 22.0 40.0 16.0 40.0 7 31.51275 38.0 22.0 40.0 16.0 40.0 8 31.51675 38.0 22.0 40.0 15.0 40.0 9 31.4155 38.0 22.0 40.0 15.0 40.0 10 31.26875 38.0 22.0 40.0 15.0 40.0 11 34.59325 38.0 31.0 40.0 29.0 40.0 12 34.64825 38.0 32.0 40.0 29.0 40.0 13 34.537 38.0 31.0 40.0 28.0 40.0 14 34.08375 38.0 31.0 40.0 27.0 40.0 15 34.39625 38.0 31.0 40.0 28.0 40.0 16 34.1905 38.0 31.0 40.0 25.0 40.0 17 34.122 38.0 31.0 40.0 26.0 40.0 18 34.03925 38.0 31.0 40.0 25.0 40.0 19 34.2275 38.0 31.0 40.0 27.0 40.0 20 34.3405 38.0 31.0 40.0 27.0 40.0 21 33.9115 38.0 31.0 40.0 25.0 40.0 22 34.08325 38.0 31.0 40.0 25.0 40.0 23 34.16925 38.0 31.0 40.0 27.0 40.0 24 34.1775 38.0 31.0 40.0 26.0 40.0 25 34.217 38.0 31.0 40.0 25.0 40.0 26 33.477 38.0 31.0 40.0 22.0 40.0 27 32.78675 36.0 31.0 40.0 18.0 40.0 28 33.32675 38.0 31.0 40.0 22.0 40.0 29 33.21225 38.0 31.0 40.0 20.0 40.0 30 33.35125 38.0 31.0 40.0 22.0 40.0 31 32.72 38.0 31.0 40.0 17.0 40.0 32 32.62825 38.0 31.0 40.0 17.0 40.0 33 32.76675 38.0 31.0 40.0 17.0 40.0 34 32.61475 38.0 31.0 40.0 17.0 40.0 35 32.61225 38.0 31.0 40.0 17.0 40.0 36 32.55825 38.0 31.0 40.0 16.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 181.0 5 1.0 6 0.0 7 1.0 8 0.0 9 4.0 10 2.0 11 4.0 12 5.0 13 5.0 14 3.0 15 7.0 16 8.0 17 13.0 18 17.0 19 22.0 20 23.0 21 33.0 22 45.0 23 62.0 24 95.0 25 162.0 26 198.0 27 237.0 28 167.0 29 50.0 30 45.0 31 61.0 32 74.0 33 78.0 34 106.0 35 133.0 36 185.0 37 272.0 38 484.0 39 1141.0 40 76.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.30470914127424 46.64127423822715 20.325484764542935 17.72853185595568 2 15.950000000000001 45.475 22.325 16.25 3 38.125 25.025 20.525 16.325 4 16.975 23.45 21.775 37.8 5 17.1 45.925 21.625 15.35 6 38.275 24.5 20.674999999999997 16.55 7 16.825000000000003 22.925 44.05 16.2 8 38.975 22.2 23.1 15.725 9 38.725 22.975 21.175 17.125 10 15.8 25.15 41.875 17.175 11 16.725 45.324999999999996 20.875 17.075000000000003 12 16.875 23.674999999999997 42.925000000000004 16.525000000000002 13 16.6 23.95 21.6 37.85 14 16.975 45.625 21.675 15.725 15 17.224999999999998 45.475 21.5 15.8 16 17.474999999999998 22.35 22.175 38.0 17 38.574999999999996 22.55 22.525000000000002 16.35 18 16.925 23.275000000000002 22.95 36.85 19 16.650000000000002 45.275 21.775 16.3 20 38.6 23.875 22.35 15.174999999999999 21 17.275 45.925 21.55 15.25 22 37.775 23.575 20.525 18.125 23 16.625 23.325000000000003 43.675000000000004 16.375 24 16.125 45.45 22.075 16.35 25 17.9 22.825 21.45 37.824999999999996 26 24.4 30.125 29.15 16.325 27 17.9 22.325 36.175000000000004 23.599999999999998 28 32.675 23.075000000000003 27.474999999999998 16.775000000000002 29 31.900000000000002 22.325 30.225 15.55 30 31.10777694423606 22.83070767691923 30.532633158289574 15.528882220555138 31 26.0 25.7 30.55 17.75 32 21.5 30.025000000000002 31.075000000000003 17.4 33 20.125 27.500000000000004 33.825 18.55 34 21.05 26.75 32.95 19.25 35 19.55 26.974999999999998 32.824999999999996 20.65 36 19.125 27.3 33.575 20.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 1.0 8 1.0 9 1.0 10 3.0 11 5.0 12 5.0 13 5.0 14 5.0 15 4.0 16 3.0 17 3.0 18 7.5 19 12.0 20 12.0 21 20.5 22 29.0 23 29.0 24 42.5 25 56.0 26 73.0 27 90.0 28 90.0 29 139.5 30 189.0 31 189.0 32 326.5 33 464.0 34 464.0 35 399.5 36 335.0 37 335.0 38 362.0 39 389.0 40 403.0 41 417.0 42 417.0 43 421.0 44 425.0 45 425.0 46 416.5 47 408.0 48 408.0 49 402.5 50 397.0 51 376.5 52 356.0 53 356.0 54 295.5 55 235.0 56 235.0 57 181.0 58 127.0 59 127.0 60 81.5 61 36.0 62 36.0 63 23.0 64 10.0 65 8.5 66 7.0 67 7.0 68 3.5 69 0.0 70 0.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 27.800000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.025 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 36 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.35135135135134 90.975 2 1.4054054054054055 2.6 3 0.13513513513513514 0.375 4 0.05405405405405406 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02702702702702703 1.625 >100 0.02702702702702703 4.2250000000000005 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTT 169 4.2250000000000005 No Hit NAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTT 65 1.625 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.1 0.0 0.0 0.0 0.0 21 0.1 0.0 0.0 0.0 0.0 22 0.1 0.0 0.0 0.0 0.0 23 0.1 0.0 0.0 0.0 0.0 24 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCAGT 85 0.0 36.17647 1 ACATGGG 25 3.723246E-4 29.725002 24 GTACATG 25 3.723246E-4 29.725002 22 TACATGG 25 3.723246E-4 29.725002 23 AGTACAT 25 3.723246E-4 29.725002 21 AGAGTAC 100 0.0 29.725002 19 AACGCAG 105 0.0 29.725 14 GTATCAA 105 0.0 29.725 9 TCAACGC 105 0.0 29.725 12 ACTTTTT 35 2.2176428E-6 29.725 24 AGTACTT 35 2.2176428E-6 29.725 21 TACGCGG 30 2.8839868E-5 29.725 23 GAGTACT 35 2.2176428E-6 29.725 20 GAGTACG 35 2.2176428E-6 29.725 20 GAGTACA 30 2.8839868E-5 29.725 20 GCAGAGT 105 0.0 29.725 17 ATCAACG 105 0.0 29.725 11 ACGCGGG 30 2.8839868E-5 29.725 24 GGTATCA 105 0.0 29.725 8 GTACGCG 30 2.8839868E-5 29.725 22 >>END_MODULE Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra Read 1491171 spots for SRR1165058.sra Written 1491171 spots for SRR1165058.sra Read 1491165 spots for SRR1165058.sra Written 1491165 spots for SRR1165058.sra SRR ids: ['SRR1165058.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6xpgkqm7 SRR1165058.sra spots: 29823306 blocks: [[1, 1491165], [1491166, 2982330], [2982331, 4473495], [4473496, 5964660], [5964661, 7455825], [7455826, 8946990], [8946991, 10438155], [10438156, 11929320], [11929321, 13420485], [13420486, 14911650], [14911651, 16402815], [16402816, 17893980], [17893981, 19385145], [19385146, 20876310], [20876311, 22367475], [22367476, 23858640], [23858641, 25349805], [25349806, 26840970], [26840971, 28332135], [28332136, 29823306]] SRR1165058 file size 3925455 SRR1165058 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1165058 SRR1165058_1.fastq Input file: SRR1165058_1.fastq trimmed: SRR1165058-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 16:15:29 2025 >> started Thu Feb 13 16:15:41 2025 >> done (12.450s) 29823306 reads processed; of these: 264213 ( 0.89%) short reads filtered out after trimming by size control 233622 ( 0.78%) empty reads filtered out after trimming by size control 29325471 (98.33%) reads available; of these: 1194491 ( 4.07%) trimmed reads available after processing 28130980 (95.93%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14045 0.05% 19 22068 0.08% 20 42000 0.14% 21 12360 0.04% 22 16244 0.06% 23 28726 0.10% 24 52590 0.18% 25 224878 0.77% 26 22717 0.08% 27 64150 0.22% 28 50453 0.17% 29 79056 0.27% 30 189487 0.65% 31 33226 0.11% 32 42421 0.14% 33 56013 0.19% 34 90385 0.31% 35 153672 0.52% 36 28130980 95.93% 29325471 reads passed initial QC criterion=sequence-density sequence-density=8.19 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=46 prefix-density=22.38 prefix-fanout=1.0 sequence=ACGCAGAGTACGCGGGG criterion=fanout-score sequence-density=0.44 sequence-density-rank=25 fanout-score=51.18 fanout-score-rank=1 prefix-density=22.38 prefix-fanout=1.0 sequence=ACGCAGAGTACTTTTTTT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x ACGCAGAGTACGCGGGG -o SRR1165058 - Input file: STDIN trimmed: SRR1165058-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): ACGCAGAGTACGCGGGG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Thu Feb 13 16:16:19 2025 >> started Thu Feb 13 16:16:36 2025 >> done (16.610s) 22808700 reads processed; of these: 1544041 ( 6.77%) short reads filtered out after trimming by size control 214 ( 0.00%) empty reads filtered out after trimming by size control 21264445 (93.23%) reads available; of these: 143119 ( 0.67%) trimmed reads available after processing 21121326 (99.33%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9428 0.04% 19 14973 0.07% 20 28602 0.13% 21 9394 0.04% 22 12061 0.06% 23 19787 0.09% 24 33133 0.16% 25 70463 0.33% 26 17255 0.08% 27 49577 0.23% 28 35863 0.17% 29 55195 0.26% 30 108442 0.51% 31 33387 0.16% 32 48400 0.23% 33 130683 0.61% 34 59703 0.28% 35 103230 0.49% 36 20424869 96.05% criterion=sequence-density sequence-density=2.79 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=44 prefix-density=7.07 prefix-fanout=1.0 sequence=AGTACATGGGGA criterion=fanout-score sequence-density=0.14 sequence-density-rank=46 fanout-score=49.53 fanout-score-rank=1 prefix-density=7.07 prefix-fanout=1.0 sequence=AGTACATGGGAC Started job on | Feb 13 16:17:29 Started mapping on | Feb 13 16:17:29 Finished on | Feb 13 16:17:59 Mapping speed, Million of reads per hour | 3333.75 Number of input reads | 27781216 Average input read length | 31 UNIQUE READS: Uniquely mapped reads number | 20791790 Uniquely mapped reads % | 74.84% Average mapped length | 30.86 Number of splices: Total | 1307152 Number of splices: Annotated (sjdb) | 1264620 Number of splices: GT/AG | 1285894 Number of splices: GC/AG | 14923 Number of splices: AT/AC | 820 Number of splices: Non-canonical | 5515 Mismatch rate per base, % | 0.61% Deletion rate per base | 0.01% Deletion average length | 1.48 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2629721 % of reads mapped to multiple loci | 9.47% Number of reads mapped to too many loci | 91840 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.26% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4359705 4359705 4359705 N_multimapping 2629721 2629721 2629721 N_noFeature 1578871 13822091 8460653 N_ambiguous 129785 15422 26786 UnstrandedReadsAssigned:19083134 PositiveStrandReadsAssigned:6954277 NegativeStrandReadsAssigned:12304351 Dataset is classified unstranded MeadianReadLen=32 20thPercentileLength=32 echo kmer=27 SRR1165058 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=27 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 27 [index] number of targets: 52,400 [index] number of k-mers: 61,548,610 [index] number of equivalence classes: 141,804 [quant] running in single-end mode [quant] will process file 1: SRR1165058-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,781,216 reads, 16,404,403 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52401 SRR1165058.ke.tsv 34699 SRR1165058.se.tsv 87100 total ==> SRR1165058.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 688.566 24.0362 Potri.005G024800.1.v4.1 1035 936 215.867 15.4492 Potri.004G059700.1.v4.1 961 862 479.572 37.2685 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 638.213 15.0325 Potri.016G087400.1.v4.1 270 171 1543.38 604.606 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 101.799 4.07365 Potri.012G127500.1.v4.1 977 878 2371 180.898 ==> SRR1165058.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1249 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 799 SRR1165058 completed mapping pipeline successfully