Starting /dee2/code/volunteer_pipeline.sh SRR11678134 current disk space = 3051933704192 free memory = 1000607796 SRR11678134 SRAfilesize 06ca5aed313e771ac4e6cc39129254cb SRR11678134.sra SRR11678134.sra file validated SRR11678134 is paired end SRR11678134 is conventional basespace SRR11678134 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678134_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.787 37.0 36.0 37.0 32.0 38.0 2 35.2265 37.0 36.0 37.0 30.0 38.0 3 35.8725 37.0 36.0 37.0 33.0 38.0 4 35.834 37.0 36.0 37.0 32.0 38.0 5 35.78325 37.0 36.0 37.0 32.0 38.0 6 35.74 37.0 36.0 37.0 32.0 38.0 7 35.79375 37.0 36.0 37.0 32.0 38.0 8 35.70875 37.0 36.0 37.0 32.0 38.0 9 35.6925 37.0 36.0 37.0 32.0 38.0 10-14 35.69025 37.0 36.0 37.0 31.8 38.0 15-19 35.65214999999999 37.0 36.0 37.0 32.0 38.0 20-24 35.610299999999995 37.0 36.0 37.0 31.6 38.0 25-29 35.613350000000004 37.0 36.0 37.0 32.0 38.0 30-34 35.6189 37.0 36.0 37.0 31.8 38.0 35-39 35.555899999999994 37.0 36.0 37.0 31.8 38.0 40-44 35.57075 37.0 36.0 37.0 31.8 38.0 45-49 35.504999999999995 37.0 36.0 37.0 31.4 38.0 50-54 35.51065 37.0 36.0 37.0 31.4 38.0 55-59 35.455 37.0 36.0 37.0 31.2 38.0 60-64 35.3885 37.0 36.0 37.0 31.0 38.0 65-69 35.39965 37.0 36.0 37.0 31.2 38.0 70-74 35.340700000000005 37.0 36.0 37.0 31.0 38.0 75-79 35.252300000000005 37.0 35.8 37.0 30.4 38.0 80-84 35.23235 37.0 35.6 37.0 30.6 38.0 85-89 35.22865 37.0 35.8 37.0 30.4 38.0 90-94 35.127750000000006 37.0 35.2 37.0 30.0 38.0 95-99 35.06205 37.0 35.0 37.0 30.0 38.0 100-104 34.976600000000005 37.0 35.0 37.0 29.4 38.0 105-109 34.96035 37.0 35.0 37.0 29.4 38.0 110-114 34.856399999999994 37.0 35.0 37.0 29.0 38.0 115-119 34.82015 37.0 35.0 37.0 29.0 38.0 120-124 34.73584999999999 37.0 35.0 37.0 28.8 38.0 125-129 34.643950000000004 37.0 35.0 37.0 28.2 38.0 130-134 34.4773 37.0 34.4 37.0 27.8 38.0 135-139 34.42065 37.0 34.2 37.0 27.8 38.0 140-144 34.29395000000001 37.0 34.0 37.0 27.2 38.0 145-149 34.17085 37.0 34.0 37.0 27.0 38.0 150 33.9865 37.0 34.0 37.0 26.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 5.0 25 7.0 26 19.0 27 28.0 28 42.0 29 63.0 30 96.0 31 120.0 32 150.0 33 242.0 34 392.0 35 857.0 36 1875.0 37 104.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.975 18.825 12.2 38.0 2 16.950000000000003 23.599999999999998 47.5 11.95 3 14.274999999999999 25.5 35.3 24.925 4 18.375 36.825 27.875 16.925 5 19.375 34.425 29.625 16.575 6 14.875 33.125 32.300000000000004 19.7 7 15.0 15.375 47.0 22.625 8 18.8 21.375 30.725 29.099999999999998 9 19.825 22.400000000000002 30.4 27.375 10-14 19.975 29.044999999999998 27.675 23.305 15-19 20.785 28.515 28.27 22.43 20-24 21.33 28.575 28.065 22.03 25-29 20.95 28.765 28.63 21.654999999999998 30-34 21.435000000000002 28.435 28.315 21.815 35-39 21.75 28.365000000000002 28.050000000000004 21.834999999999997 40-44 21.560000000000002 28.09 28.405 21.945 45-49 21.59 28.599999999999998 27.74 22.07 50-54 21.22 27.97 28.875 21.935 55-59 21.535 28.52 28.355000000000004 21.59 60-64 21.4 28.970000000000002 27.97 21.66 65-69 21.404999999999998 28.63 27.785 22.18 70-74 21.275 28.21 27.900000000000002 22.615 75-79 21.335 28.265 28.435 21.965 80-84 21.82 28.115000000000002 28.255000000000003 21.81 85-89 21.66 28.54 28.29 21.51 90-94 21.685 28.785 27.735 21.795 95-99 22.125 27.66 27.97 22.245 100-104 22.12 28.744999999999997 27.125 22.009999999999998 105-109 21.775 28.000000000000004 28.185 22.040000000000003 110-114 21.675 28.055000000000003 28.24 22.03 115-119 21.85 27.915 28.075 22.16 120-124 21.68 28.02 28.225 22.075 125-129 21.404999999999998 27.35 28.754999999999995 22.49 130-134 22.405 27.165 28.515 21.915000000000003 135-139 21.725 28.32 28.01 21.945 140-144 21.985 27.495000000000005 28.575 21.945 145-149 22.07 27.650000000000002 28.360000000000003 21.92 150 21.25 29.049999999999997 28.299999999999997 21.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 1.0 20 1.5 21 2.0 22 2.5 23 4.0 24 6.0 25 5.5 26 6.5 27 10.0 28 16.0 29 24.0 30 28.0 31 35.0 32 44.5 33 53.0 34 69.0 35 81.0 36 97.5 37 120.5 38 148.0 39 182.5 40 199.5 41 207.5 42 238.0 43 261.0 44 268.0 45 266.5 46 255.0 47 251.5 48 230.5 49 200.0 50 172.0 51 132.5 52 97.5 53 75.0 54 55.0 55 40.0 56 27.5 57 23.0 58 21.0 59 10.0 60 6.0 61 6.0 62 4.5 63 2.5 64 0.5 65 2.0 66 2.5 67 1.0 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75949367088607 97.52499999999999 2 1.2151898734177216 2.4 3 0.025316455696202535 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCATT 10 0.006973645 144.0 1 TTTCTAA 10 0.006973645 144.0 3 CTTGAAT 15 1.1730364E-4 144.0 1 >>END_MODULE SRR11678134 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678134_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.30425 37.0 36.0 37.0 31.0 38.0 2 34.051 37.0 34.0 37.0 26.0 37.0 3 35.1285 37.0 36.0 37.0 30.0 38.0 4 35.1725 37.0 35.0 37.0 30.0 38.0 5 35.14825 37.0 36.0 37.0 30.0 38.0 6 34.98225 37.0 35.0 37.0 30.0 38.0 7 35.1565 37.0 36.0 37.0 30.0 38.0 8 35.18025 37.0 36.0 37.0 30.0 38.0 9 35.10575 37.0 35.0 37.0 30.0 38.0 10-14 35.06065 37.0 35.0 37.0 29.8 38.0 15-19 35.10735 37.0 35.2 37.0 30.0 38.0 20-24 35.0723 37.0 35.0 37.0 30.0 38.0 25-29 35.01284999999999 37.0 35.0 37.0 29.8 38.0 30-34 35.04225 37.0 35.0 37.0 29.8 38.0 35-39 35.0208 37.0 35.0 37.0 30.0 38.0 40-44 34.93075 37.0 35.0 37.0 29.2 38.0 45-49 34.96325 37.0 35.0 37.0 29.4 38.0 50-54 34.92065 37.0 35.0 37.0 29.0 38.0 55-59 34.90015 37.0 35.0 37.0 29.6 38.0 60-64 34.8138 37.0 35.0 37.0 29.0 38.0 65-69 34.88325 37.0 35.0 37.0 29.2 38.0 70-74 34.8189 37.0 35.0 37.0 29.2 38.0 75-79 34.7697 37.0 35.0 37.0 29.0 38.0 80-84 34.693349999999995 37.0 35.0 37.0 28.6 38.0 85-89 34.66175 37.0 35.0 37.0 28.8 38.0 90-94 34.617599999999996 37.0 35.0 37.0 28.6 38.0 95-99 34.5113 37.0 34.6 37.0 28.2 38.0 100-104 34.468450000000004 37.0 34.4 37.0 28.0 38.0 105-109 34.40985 37.0 34.2 37.0 27.8 38.0 110-114 34.358799999999995 37.0 34.0 37.0 27.4 38.0 115-119 34.19445 37.0 34.0 37.0 27.0 38.0 120-124 34.1143 37.0 34.0 37.0 26.6 38.0 125-129 34.07895 37.0 34.0 37.0 26.4 38.0 130-134 33.89164999999999 37.0 33.4 37.0 25.6 37.8 135-139 33.8217 37.0 33.2 37.0 25.6 38.0 140-144 33.6939 37.0 33.0 37.0 25.2 38.0 145-149 33.571749999999994 36.6 32.8 37.0 24.8 37.8 150 33.3915 36.0 33.0 37.0 24.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 5.0 24 19.0 25 37.0 26 57.0 27 71.0 28 72.0 29 82.0 30 111.0 31 175.0 32 186.0 33 264.0 34 430.0 35 762.0 36 1587.0 37 140.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.975 18.425 12.975 38.625 2 17.525 23.95 47.15 11.375 3 14.374999999999998 27.275 33.4 24.95 4 17.375 36.6 30.049999999999997 15.975 5 19.275000000000002 34.050000000000004 28.7 17.974999999999998 6 14.774999999999999 34.449999999999996 31.424999999999997 19.35 7 13.675 14.75 48.5 23.075000000000003 8 17.75 20.775 30.75 30.725 9 19.650000000000002 22.85 30.825000000000003 26.674999999999997 10-14 20.77 29.160000000000004 27.625 22.445 15-19 21.18 28.725 28.125 21.97 20-24 21.41 28.57 28.005000000000003 22.015 25-29 20.615 28.754999999999995 28.84 21.790000000000003 30-34 21.205 28.694999999999997 28.470000000000002 21.63 35-39 21.01 29.015 27.825 22.15 40-44 21.57 28.144999999999996 28.26 22.025 45-49 21.085 28.01 28.925 21.98 50-54 21.175 28.365000000000002 28.025 22.435 55-59 22.235 28.65 27.279999999999998 21.834999999999997 60-64 21.745 28.410000000000004 27.505000000000003 22.34 65-69 21.8 28.515 28.425 21.26 70-74 21.72 28.804999999999996 27.85 21.625 75-79 21.75 28.64 27.765 21.845 80-84 21.055 28.815 28.205000000000002 21.925 85-89 21.85 28.305000000000003 27.500000000000004 22.345000000000002 90-94 21.375 28.115000000000002 28.485 22.025 95-99 22.12 28.244999999999997 27.55 22.085 100-104 22.005 28.24 27.57 22.185 105-109 21.45 28.88 27.439999999999998 22.23 110-114 21.5 27.834999999999997 28.499999999999996 22.165000000000003 115-119 21.990000000000002 27.91 28.1 22.0 120-124 21.865000000000002 28.08 28.444999999999997 21.61 125-129 22.035 28.299999999999997 27.644999999999996 22.02 130-134 21.83 28.46 28.299999999999997 21.41 135-139 22.005 28.015 27.839999999999996 22.14 140-144 21.85 27.894999999999996 27.77 22.485 145-149 22.025 28.060000000000002 27.715 22.2 150 22.780695173793447 27.33183295823956 28.107026756689173 21.780445111277817 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.5 19 2.0 20 2.5 21 4.0 22 3.5 23 3.0 24 5.0 25 6.5 26 8.5 27 12.0 28 16.0 29 20.0 30 27.0 31 34.5 32 39.0 33 56.0 34 65.0 35 74.5 36 93.5 37 104.5 38 137.0 39 174.5 40 205.0 41 242.0 42 273.0 43 288.5 44 278.0 45 258.5 46 261.5 47 246.0 48 210.5 49 178.5 50 154.0 51 124.5 52 86.0 53 75.0 54 64.0 55 41.0 56 28.5 57 25.5 58 21.5 59 14.0 60 7.5 61 6.0 62 4.0 63 3.0 64 3.5 65 2.5 66 2.5 67 3.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88776541961577 97.8 2 1.1122345803842264 2.1999999999999997 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTTTT 10 0.006973645 144.0 1 AGACAGC 10 0.006973645 144.0 6 >>END_MODULE Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087107 spots for SRR11678134.sra Written 1087107 spots for SRR11678134.sra Read 1087109 spots for SRR11678134.sra Written 1087109 spots for SRR11678134.sra SRR ids: ['SRR11678134.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1n4wv0j6 SRR11678134.sra spots: 21742142 blocks: [[1, 1087107], [1087108, 2174214], [2174215, 3261321], [3261322, 4348428], [4348429, 5435535], [5435536, 6522642], [6522643, 7609749], [7609750, 8696856], [8696857, 9783963], [9783964, 10871070], [10871071, 11958177], [11958178, 13045284], [13045285, 14132391], [14132392, 15219498], [15219499, 16306605], [16306606, 17393712], [17393713, 18480819], [18480820, 19567926], [19567927, 20655033], [20655034, 21742142]] SRR11678134 file size 7739034 SRR11678134 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11678134 SRR11678134_1.fastq SRR11678134_2.fastq Input file: SRR11678134_1.fastq Paired file: SRR11678134_2.fastq trimmed: SRR11678134-trimmed-pair1.fastq, SRR11678134-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:20:40 2025 >> started Wed Feb 12 17:21:11 2025 >> done (30.467s) 21742142 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 21742142 (100.00%) read pairs available; of these: 548476 ( 2.52%) trimmed read pairs available after processing 21193666 (97.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 142 2 0.00% 143 2 0.00% 144 3 0.00% 145 3 0.00% 146 9 0.00% 147 86 0.00% 148 3178 0.01% 149 545193 2.51% 150 21193666 97.48% 21742142 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=41.82 fanout-score-rank=5 prefix-density=0.38 prefix-fanout=20.5 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=95.01 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=11.2 sequence=CACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAACAAAACGGCCAGATGGGTTGAGGTGAAAGATAGTTTTCTCATCAAGGTACTTCTCCGGGATAACAGGCTTGATGACATACTCCTTTAGATCAGCGGCAATTTCATCATTTGTGACAGTCTCATCATGCTGAGTAGAGATGAGAACAGTGTGGACACGAACAGGGACCATTGCACCATTGTCATTGAAG criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=41.94 fanout-score-rank=2 prefix-density=0.40 prefix-fanout=21.6 sequence=AAGTCGGATCGTAGCCAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=172.08 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=20.8 sequence=GCAGCAGCAGCAA SRR11678134 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:22:02 Started mapping on | Feb 12 17:22:02 Finished on | Feb 12 17:24:07 Mapping speed, Million of reads per hour | 626.17 Number of input reads | 21742142 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20914233 Uniquely mapped reads % | 96.19% Average mapped length | 298.38 Number of splices: Total | 19104878 Number of splices: Annotated (sjdb) | 18717258 Number of splices: GT/AG | 18801463 Number of splices: GC/AG | 235090 Number of splices: AT/AC | 18109 Number of splices: Non-canonical | 50216 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.35 Insertion rate per base | 0.02% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394127 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 1674 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 433782 433782 433782 N_multimapping 394127 394127 394127 N_noFeature 786745 10633918 10895555 N_ambiguous 282733 57227 54685 UnstrandedReadsAssigned:19844755 PositiveStrandReadsAssigned:10223088 NegativeStrandReadsAssigned:9963993 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11678134 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11678134-trimmed-pair1.fastq SRR11678134-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,742,142 reads, 20,289,952 reads pseudoaligned [quant] estimated average fragment length: 263.991 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52401 SRR11678134.ke.tsv 34699 SRR11678134.se.tsv 87100 total ==> SRR11678134.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.01 1071 31.1539 Potri.005G024800.1.v4.1 1035 772.009 161 10.6465 Potri.004G059700.1.v4.1 961 698.025 33 2.41349 Potri.007G009000.2.v4.1 1416 1153.01 0 0 Potri.003G141000.2.v4.1 2943 2680.01 434.38 8.27438 Potri.016G087400.1.v4.1 270 60.2525 948 803.222 Potri.015G069301.1.v4.1 564 302.717 0 0 Potri.010G195200.1.v4.1 1773 1510.01 110 3.71891 Potri.012G127500.1.v4.1 977 714.02 3873 276.911 ==> SRR11678134.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3054 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 596 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 58 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR11678134 completed mapping pipeline successfully